Datasets:

zekeZZ

/

pile_10000_subset

like 0

# Install BIN = demo # Flags CFLAGS += -std=c99 -pedantic -O2 SRC = main.c OBJ = $(SRC:.c=.o) UNAME_S := $(shell uname -s) ifeq ($(UNAME_S),Darwin) LIBS = -lSDL2 -framework OpenGLES -lm else LIBS = -lSDL2 -lGLESv2 -lm endif $(BIN): prepare $(CC) $(SRC) $(CFLAGS) -o bin/$(BIN) $(LIBS) web: prepare emcc $(SRC) -Os -s USE_SDL=2 -o bin/index.html rpi: prepare $(CC) $(SRC) $(CFLAGS) -o bin/$(BIN) `PKG_CONFIG_PATH=/opt/vc/lib/pkgconfig/ pkg-config --cflags --libs bcm_host brcmglesv2` `/usr/local/bin/sdl2-config --libs --cflags` prepare: @mkdir -p bin rm -f bin/$(BIN) $(OBJS)

5-hydroxytryptamine type-3 receptor antagonists for chemotherapy-induced and radiotherapy-induced nausea and emesis: can we safely reduce the dose of administered agents? Nausea and emesis as a consequence of chemotherapy or radiotherapy can have an adverse effect on patients' quality of life during cancer treatment and may last for > 5 days after administration. Guidelines suggest that, used at appropriate doses, the 5-hydroxytryptamine type-3 (5-HT3) receptor antagonists--which are considered the antiemetic "gold standard" when they are administered in combination with corticosteroids--demonstrate equivalent efficacy and safety. However, due to financial considerations, these agents often are used at lower doses than recommended. A literature review of relevant publications pertaining to the control of chemotherapy-induced nausea and emesis and dosing issues of the 5-HT3 receptor antagonists was undertaken to provide a comprehensive review of dosing issues relevant to the 5-HT3 receptor antagonists. The issue of "down dosing" was particularly pertinent because of the nature of the 5-HT3 receptor antagonist dose-response curve: A steep dose-response profile within a narrow dose range suggests that antiemetic control will be lost suddenly after dose deescalation. However, the array of predisposing and confounding patient factors indicates that it is unlikely that a loss of antiemetic control will be apparent across a population; rather, individuals will experience loss of control as the dose is reduced below threshold. Of the 4 5-HT3 receptor antagonists currently licensed in the United States (granisetron, ondansetron, dolasetron, and palonosetron), ondansetron is used sometimes at lower than optimal doses, and there is evidence to suggest that even the approved oral dose of dolasetron may be suboptimal. Suboptimal dosing not only will be detrimental to patients' quality of life but, ultimately, will prove counterproductive in terms of hospital resources, and it will add to the already significant socioeconomic burden associated with cancer therapy. Therefore, the dose of antiemetic agent administered should be sufficiently high to ensure good emesis control across the whole patient population.

Introduction ============ Increasing dietary protein at the expense of carbohydrate in either Type 2 diabetics or in overweight adults in response to energy restriction improves insulin sensitivity and glycemic control \[[@B1]-[@B5]\]. Studies have shown that protein intake in excess of the current recommended dietary allowance (RDA: 0.8 g kg^-1^d^-1^) stabilizes blood glucose and reduces the postprandial insulin response after weight loss \[[@B2],[@B3]\]. The metabolic advantage of a diet which provides dietary protein above the RDA specific to glucose utilization in healthy, physically active adults is unclear \[[@B6]\]. Higher-protein intakes are recommended for physically active adults who routinely participate in endurance exercise \[[@B7]-[@B9]\]. To date, no studies have investigated the impact of dietary protein intake on glucose homeostasis in endurance-trained adults. The objective of our study was to examine the effects of consuming dietary protein intakes spanning the current Acceptable Macronutrient Distribution Range (AMDR) on resting glucose turnover in endurance-trained men \[[@B10]\]. We hypothesized that protein availability would influence glucose turnover during a eucaloric state such that glucose rate of appearance (Ra) would be greater when the proportion of energy derived from dietary protein was increased with a simultaneous reduction in carbohydrate consumption. Methods ======= Using a randomized, crossover design, five endurance-trained men (21.3 ± 0.3 y, 179.1 ± 1.6 cm, 70.6 ± 0.1 kg, 8.7 ± 0.4% fat, VO~2peak~70.6 ± 0.1 mL kg^-1^min^-1^) were assigned to a diet providing 0.8 (Low Protein; LP), 1.8 (Moderate Protein; MP) or 3.6 (High Protein; HP) grams of protein per kilogram body mass per day for four weeks. Participants crossed over and consumed each of the remaining diets in randomized order following a 2 wk wash out period between each diet intervention. Actual macronutrient composition of the each diet was 48% carbohydrate (5.4 g kg^-1^d^-1^), 26% fat, and 26% protein (3.1 g kg^-1^d^-1^) for HP, 60% carbohydrate (7.4 g kg^-1^d^-1^), 26% fat, and 14% protein (1.8 g kg^-1^d^-1^) for MP, and 66% carbohydrate (8.3 g kg^-1^d^-1^), 27% fat, and 7% protein (0.9 g kg^-1^d^-1^) for LP. Extended details of the diet intervention have been previously reported \[[@B8]\]. Volunteers maintained their normal level of training throughout the study. However, exercise was restricted for 24 h before glucose turnover assessments to minimize the potential influence of previous exercise on study measures. Glucose turnover was assessed after 3 wks of each 4 wk diet intervention using a 120 min primed, constant infusion of \[6,6-^2^H~2~\] glucose (17 μmol kg^-1^; 0.2 μmol kg^-1^min^-1^; Cambridge Isotope Laboratories, Andover, MA) at 0700 h after an overnight fast (≥ 10 h). Arterialized blood samples were obtained from a dorsal hand vein at baseline, 60, 75, 90, 105 and 120 min to determine glucose turnover, insulin, and glucose concentrations. Plasma enrichment of \[6,6-^2^H~2~\] glucose was determined in duplicate with a precision of ± 0.2% SD using a Hewlett Packard 5989A GC-MS (Metabolic Solutions Inc, Nashua, NH). Glucose rates of appearance (Ra) and disappearance (Rd) were calculated using a modified version of the Steele equation \[[@B11],[@B12]\]. Plasma insulin and glucose concentrations were determined using a commercial RIA (DSL-1600, Diagnostic Systems Laboratories, Webster, TX) and automated glucose oxidase-peroxidase method (YSI Model 2300, Yellow Springs Instruments, Yellow Springs, OH), respectively. Baseline participant characteristics and macronutrient data were described using common descriptive statistics. Shapiro-Wilk tests of normality confirmed that plasma glucose, insulin, and glucose turnover data were normally distributed. Repeated measures ANOVA (within-subjects factors, diet: LP vs. MP. vs. HP; and time: time points over infusion protocols) were used to evaluate effects of dietary protein intake on glucose turnover, insulin, and glucose. In cases in which significant main effects (diet or time) or interactions were present, post hoc analyses were conducted by using Bonferroni adjustments to reduce the type I error rate. The alpha level for significance was set at *P*\< 0.05. Data were analyzed using SPSS (version 18.0, 2006; SPSS Inc.) and expressed as means ± SEM. Results ======= Diet main effects (*P*\< 0.05) were noted for glucose turnover. Ra (mg kg^-1^min^-1^) was greater for MP (2.8 ± 0.1) compared to HP (2.4 ± 0.1, *P*\< 0.05) and LP (2.3 ± 0.1, *P*\< 0.01) diets **(**Figure [1](#F1){ref-type="fig"}**)**. Rd (mg kg^-1^min^-1^) was also greater for MP (2.7 ± 0.1) than for HP (2.3 ± 0.2, *P*\< 0.05) and LP (2.2 ± 0.1, *P*\< 0.01) diets (Figure [1](#F1){ref-type="fig"}). Ra tended to be greater for HP compared to LP (2.4 ± 0.1 vs. 2.3 ± 0.1 for HP and LP respectively, *P*= 0.07). No difference was observed between LP and HP for Rd. {#F1} A main effect of diet (*P*\< 0.05) was observed for plasma insulin, as mean insulin concentrations (pmol/L) were greater (*P*\< 0.01) for LP (49.4 ± 6.4) compared to MP (22.8 ± 2.7) and HP (16.2 ± 0.6) diets. Insulin levels did not change over time (*P*\> 0.05). No main effects of time or diet were observed for plasma glucose (mmol/L), as levels remained steady over time and were not different between the LP (4.6 ± 0.1), MP (4.8 ± 0.1), and HP (4.7 ± 0.1) diets (*P*\> 0.05). No interactive effects (*P*\> 0.05) were observed for plasma glucose and insulin concentrations. Discussion ========== In the present study glucose turnover was greater when protein intake approximated 1.8 g kg^-1^d^-1^compared to that noted with protein intakes equivalent to the RDA or near the upper limit of the AMDR under fasted, resting conditions in endurance-trained men \[[@B10]\]. To the best of our knowledge, no other studies have examined the influence of dietary protein intake on glucose turnover in endurance-trained men. Findings from other studies indicate that level of protein intake contributes to glucose homeostasis \[[@B1]-[@B3],[@B13]\]. In overweight adult women, a 10 wk, moderate protein (1.5 g kg^-1^d^-1^), energy restricted diet stabilized blood glucose and lowered the postprandial insulin response compared to a diet providing protein at 0.8 g kg^-1^d^-1^\[[@B3]\]. Consistent with the present study, long-term protein intake at 1.9 g kg^-1^d^-1^increased hepatic glucose output (Ra) compared to that observed when protein intake was 0.7 g kg^-1^d^-1^\[[@B14]\]. Contrary to our findings, glucose disposal (Rd) was reduced with this level of protein intake. This discrepancy is likely due to differences in study populations and the experimental conditions under which glucose turnover was assessed (i.e., euglycemic hyperinsulinemic clamp vs. normal fasted) \[[@B14]\]. Also, the rigorous dietary control of the present study ensured adequate energy intake for weight maintenance throughout the study thereby minimizing the influence of energy needs on glucose disposal. Level of dietary protein can affect glucose utilization by: 1) influencing fasted and postprandial insulin secretion; and 2) providing amino acids which serve as substrates and mediators of hepatic gluconeogenesis \[[@B4],[@B15]\]. In the present study, insulin concentrations mirrored dietary carbohydrate intake, which was inversely related to dietary protein intake. Glucose disposal, however, did not correspond to plasma insulin as glucose Rd was greatest for MP compared to LP and HP diets. In addition, there was no effect of dietary protein on plasma glucose concentrations; although we recognize the small sample (n = 5) may have increased the possibility of committing Type II error. Nevertheless, these findings suggest that endogenous glucose utilization might be regulated by modifications in glucose production as well as changes in peripheral insulin sensitivity \[[@B4]\]. Layman et al. reported lower fasting and postprandial blood glucose concentrations with a greater insulin response for overweight women who consumed the RDA for protein compared to 1.5 g kg^-1^d^-1^following weight loss \[[@B3]\]. Our findings are consistent with those of Layman and suggest that a lower ratio of carbohydrate to protein in the diet is associated with euglycemia which may be better maintained by endogenous glucose production \[[@B3]\]. The contribution of amino acids to hepatic glucose production as gluconeogenic substrates and through the glucose-alanine cycle is well documented \[[@B16]-[@B20]\]. In the present study, glucose Ra was higher for MP vs. LP, suggesting an effect of protein intake on hepatic glucose production. The increased availability of carbohydrate with the consumption of lower dietary protein (i.e., RDA) contributes to higher rates of carbohydrate oxidation and a reduced need for hepatic glucose production. In contrast, when protein intake increased and approached the upper limit of the AMDR, a concomitant increase in protein oxidation should spare carbohydrate use as a fuel thereby reducing the need for endogenous glucose production \[[@B8]\]. Indeed, consistent with this proposed scenario, previously published data from this investigation showed greater carbohydrate and lower protein oxidation for the MP vs. HP diets and increased protein oxidation with increased protein consumption, which is consistent with the higher rate rates of glucose disposal observed for the MP diet \[[@B8],[@B21]\]. Greater carbohydrate uptake and subsequent oxidation likely increased metabolic demand for endogenous hepatic glucose production accounting for the differences noted in glucose Ra in the MP diet. Consistent with our hypothesis, Jungas et al. reported an increase in protein oxidation concomitant with a greater contribution of amino acids to hepatic gluconeogenesis with modest increases in dietary protein \[[@B16]\]. Therefore, we suggest, and our data support, that prolonged consumption of a MP diet, provides a continuous supply of hepatic gluconeogenic precursors that serve to maintain glucose turnover in a fasted state. Our findings further suggest that a ceiling exists for which dietary protein imparts no additional benefit to the regulation of glucose turnover and may, in fact be excessive to the extent where protein is readily oxidized. In summary, this investigation demonstrated that glucose turnover is influenced by level of dietary protein routinely consumed by a group of endurance-trained men. A novel aspect of this work is that chronic consumption of dietary protein above 1.8 g kg^-1^d^-1^did not appear to provide any additional benefit towards the regulation of blood glucose. While our findings must be interpreted cautiously due to the specific population studied (i.e., endurance-trained men), small sample size, and state of energy balance (i.e., eucaloric) during which the experimental diets were implemented, the concept is nonetheless intriguing. That is, when carbohydrate intake is within 55-70% of the total energy consumed and adequate to support glycogen replenishment (7.4 g carbohydrate kg^-1^d^-1^), dietary protein at a level that exceeds the RDA but is well within the AMDR may contribute to maintenance of blood glucose by serving as gluconeogenic substrate. Competing interests =================== Nancy R. Rodriguez has received honorarium for participation in the speaker bureau for the NCBA and serves on the Protein Advisory Board for the NCBA. Remaining author(s) declare that they have no competing interests. Authors\' contributions ======================= SMP participated in manuscript preparation, CSS, MAP, PCG, DRB, and BTB participated in data collection, statistical analysis, and manuscript preparation. NRR served as the principal investigator and contributed to study design, data collection, and manuscript preparation. All authors read and approved the final manuscript. Acknowledgements ================ This work was supported in part by a grant from the National Cattleman\'s Beef Association, The University of Connecticut Agricultural Experiment Station (HATCH), and The University of Connecticut Research Foundation.

--- abstract: 'In this note we present some remarks on big Cohen-Macaulay algebras and almost Cohen-Macaulay algebras via closure operations on the ideals and the modules. Our methods for doing these are inspired by the notion of the tight closure and the dagger closure and by the ideas of Northcott on dropping of the Noetherian assumption of certain homological properties.' address: - 'School of Mathematics, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5746, Tehran, Iran.' - 'Dinabandhu Andrews College, Kolkata 700084, India' author: - Mohsen Asgharzadeh - 'Rajsekhar Bhattacharyya $^\ast$' title: 'Applications of closure operations on big Cohen-Macaulay Algebras' --- Introduction ============ Throughout this paper all rings are commutative, associative, with identity, and all modules are unital. We always denote a commutative Noetherian ring by $R$ and an $R$-algebra (not necessarily Noetherian) by $A$. The *perfect closure* of a reduced ring $A$ of prime characteristic $p$ is defined by adjoining all the higher $p$-power roots of all the elements of $A$, to $A$ itself. We denote it by $A^\infty$. Observe the definition of coherent ring and non-Noetherian regular ring in Section 2. In Section 2, we show that the Frobenius map is flat over a coherent regular ring which is of prime characteristic. In view of [@E page 36], one may ask for a generalization of Tight Closure via *Colon-Capturing* with respect to some non-Noetherian Cohen-Macaulay rings. Let $R$ be a Noetherian local F-coherent domain which is either excellent or homomorphic image of a Gorenstein local ring. If ${\operatorname{p.grade}}_A({\frak{a}},M)$ is the *polynomial grade* of an ideal ${\frak{a}}$ on an $A$-module $M$ (see Section 2 for the definition) then by applying a version of colon-capturing for $R^{\infty}$, in Theorem \[main\] of Section 3, we show that ${\operatorname{ht}}({\frak{a}})={\operatorname{p.grade}}_{R^{\infty}}({\frak{a}}, R^{\infty})$ for every ideal ${\frak{a}}$ of $R^{\infty}$. On regular rings, this result follows easily by using a result of Kunz (which is true only for regular rings), see e.g. [@AT Theorem 4.5]. Following [@Sh], a ring $R$ is called *F-coherent* if $R^{\infty}$ is a coherent ring. In particular, Theorem \[main\] provides an evidence for Shimomoto’s question: Does the perfect closure of an F-coherent domain coincide with the perfect closure of some regular Noetherian rings? The *Dagger closure* was introduced by Hochster and Huneke in [@HH]. It has an interesting connection with the theory of vector bundles, see e.g. [@BS] and the theory of *tight closure*, see e.g. [@HH] and [@HH2]. Let $I$ be an ideal of $R$ and let $R^{+}$ be its integral closure in an algebraic closure of its fraction field. We recall that an element $x\in R$ is in $I^{\dag}$, the dagger closure of $I$, if there are elements $\epsilon_n\in R^{+}$ of arbitrarily small order such that $\epsilon_nx\in IR^{+}$. By the main result of [@HH], the tight closure of an ideal coincides with the dagger closure, where $R$ is complete and of prime characteristic $p$. In Section 4, we extend that notion to the submodules of finitely generated modules over $R$ to prove that if a complete local domain is contained in an almost Cohen-Macaulay domain then there exists a balanced big Cohen-Macaulay module over it (see Corollary \[main2\]). In [@Ho], Hochster showed the existence of a big Cohen-Macaulay algebra from the existence of an almost Cohen-Macaulay algebra in dimension 3. Corollary \[main2\] extends this result, by proving the existence of big Cohen-Macaulay modules from the existence of almost Cohen-Macaulay algebras in any dimension $d$. In [@S1], certain weakly almost Cohen-Macaulay $R^+$-algebra is constructed and it has been asked whether it is almost Cohen-Macaulay or not. In Section 5, we obtain that such a weakly almost Cohen-Macaulay $R^+$-algebra will be almost Cohen-Macaulay if and only if it maps to some big Cohen-Macaulay $R^+$-algebra. For more details see Remark 5.4. Preliminary Notations ===================== We begin this section by exploring the following definitions. Let $A$ be an algebra equipped with a map $v:A\to{{\mathbb R}}\cup \{\infty\}$ satisfying $(1)$ $v(ab)=v(a)+v(b)$ for all $a,b \in A$; $(2)$ $v(a+b) \ge \min\{v(a),v(b)\}$ for all $a,b \in A$ and $(3)$ $v(a)=\infty$ if and only if $a=0$. The map $v$ is called the *value map* on $A$. Moreover, if $v(a) \ge 0$ for every $a \in T$ and $v(a) > 0$ for every non-unit $a \in A$, then we say that $v$ is *normalized*. If $A$ is equipped with a normalized value map, then by [@AS Proposition 3.1], one has $\bigcap_{n=1}^{\infty} {\frak{a}}^n=0$ where ${\frak{a}}$ is proper and finitely generated ideal of $A$. Let $A$ be of prime characteristic $p$ and $I$ be an ideal of $A$. Set $A^0$ to be the complement of the set of all minimal primes of $A$ and $I^{[q]}$ to be the ideal generated by $q=p^e$-th powers of all elements of $I$. Then the tight closure $I^\ast$ of $I$ is the set of $x\in A$ such that there exists $c \in A^0$ such that $cx^q\in I^{[q]}$ for $q\gg 0$. We also recall the following definitions: a ring is called coherent if each of its finitely generated ideal is finitely presented and a ring is called *regular* if each of its finitely generated ideal is of finite projective dimension. \[sh1\] Let $A$ be a coherent regular ring of prime characteristic $p$. Then the following statements hold. 1. The Frobenius map is flat. 2. If $A$ is equipped with a normalized value map, then all finitely generated ideals of $A$ are tightly closed. $\mathrm{(i)}$: This proof is inspired by a famous result of Kunz [@BH Corollary 8.2.8], which characterizes Noetherian regular rings of prime characteristic in the term of Frobenius map. First recall that the assignment $a\mapsto a^p$ defines the Frobenius map $F:A\to A$ which is a ring homomorphism. By $F(A)$, we mean $A$ as a group equipped with left and right scalar multiplication from $A$ given by $$a.r\star b = ab^pr, \ \ where \ \ a,b\in A \ \ and \ \ r\in F(A),$$ see also [@BH Section 8.2]. We show that for all $i > 0$, ${\operatorname{Tor}}^A_i(A/{\frak{a}}, F(A))=0$ for all finitely generated ideals ${\frak{a}}\subset A$. Note that $A/{\frak{a}}$ has a free resolution $(F_\bullet,d_\bullet)$ consisting of finitely generated modules, since $A$ is coherent. Such a resolution is bounded, because $A$ is regular. Then $(F_\bullet,d_\bullet)\otimes_A F(A)=(F_\bullet,d_\bullet^p)$. Consider the ideal $I_{t}((a_{ij}))$ generated by the $t\times t$ minors of a matrix $(a_{ij})$ and recall the definition of Koszul grade, which is denoted by ${\operatorname{K.grade}}$. One can show that it is unique up to the radical, see [@BH Proposition 2.2 (vi)]. Let $r_i$ be the expected rank of $d_\bullet$, see [@BH Section 9.1]. Clearly, $r_i$ is the expected rank of $d_\bullet^p$. Now, all these facts together imply, $${\operatorname{K.grade}}_A(I_{r_i}(d_i), A)={\operatorname{K.grade}}_A(I_{r_i}(d_i^p ),A).$$ In view of [@BH Theorem 9.1.6], which is a beautiful theorem of Buchsbaum-Eisenbud-Northcott, we find that $(F_\bullet,d_\bullet^p)$ is exact and so ${\operatorname{Tor}}^A_i(A/{\frak{a}}, F(A))=0$. $\mathrm{(ii)}$: This proof is inspired by [@Sh Lemma 4.1]. Let ${\frak{a}}$ be a proper and finitely generated ideal of $A$. Suppose that ${\frak{a}}^\ast\neq{\frak{a}}$. Take $x\in {\frak{a}}^\ast\setminus {\frak{a}}$. From the definition and from part $(i)$ of the proof, it follows that there exists an element $c \in A^0$ such that $c\in( {\frak{a}}^{[q]}:_Ax^q)=({\frak{a}}:_Ax)^{[q]}$ for $q\gg 0$. We recall that $\bigcap_{n=1}^{\infty} {\frak{b}}^n=0$ for any proper and finitely generated ideal of $A$, since $A$ is equipped with a normalized value map. Here $({\frak{a}}:_Ax)$ is proper, since $x\notin {\frak{a}}$ and it is also finitely generated, since $A$ is coherent. These facts together imply $c\in\bigcap ({\frak{a}}:_Ax)^{[q]}\subseteq\bigcap ({\frak{a}}:_Ax)^q=0$ and thus we arrive at a contradiction. It is to be noted that the finitely generated assumption of the previous result is really needed. \[exam\] Let $(R,{\frak{m}})$ be a Noetherian regular local ring of prime characteristic $p$ which is not a field. Let $R^\infty$ be its perfect closure. In view of [@A Theorem 1.2], $R^\infty$ is coherent and of finite global dimension. This is well-known that, $R^\infty$ is equipped with a normalized value map. To construct such a value map, consider a discreet valuation valuation ring $(V,{\frak{n}})$, which birationally dominates $R$, i.e., $R\subseteq V$, ${\frak{n}}\cap R={\frak{m}}$ and both $R$ and $V$ have the same field of fractions. We know that the above situation exists. Let $v$ be a value map of $V$ and take $y\in R$ such that $v(y)=\ell\in \mathbb{N}\setminus\{0\}$. Let $r\in R^\infty$. Then $r^{p^n}\in R$ for some $n$. The assignment $r\mapsto v(r^{p^n})/p^n$ defines a normalized value map on $R^\infty$. Consider the ideal ${\frak{a}}:=\{x\in R^\infty:v(x)>\ell/p\}$. Here, we show that ${\frak{a}}^\ast\neq {\frak{a}}$. To see this, let $x\in R^\infty$ be the p-th root of $y\in R$. Here $v(x)=\ell/p$. Take $c\in R^\infty$ with $v(c)>0$. Clearly, $v(c^{1/q}x)>\ell/p$ and so $c^{1/q}x\in {\frak{a}}.$ Thus $cx^q=\prod_q c^{1/q}x\in{\frak{a}}^{[q]}$ for $q\gg 0$. Therefore, $x\in {\frak{a}}^\ast\setminus {\frak{a}}$. By Lemma \[sh1\], ${\frak{a}}$ can not be finitely generated. Here, we show (directly) that ${\frak{a}}$ is not finitely generated. The proof of this fact goes along the same line of that of [@A Proposition 6.8], which gives a similar result over the absolute integral closure of $R$. We leave the details to the reader. Cohen-Macaulayness of Minimal Perfect Algebras ============================================== We begin this section with the following lemma. \[sh\] Let $(R,{\frak{m}})$ be a Noetherian local F-coherent domain which is either excellent or homomorphic image of a Gorenstein local ring. Then $R^{\infty}$ is balanced big Cohen-Macaulay. This is proved in [@Sh Theorem 3.10] when $R$ is a homomorphic image of a Gorenstein ring. The argument of [@Sh Theorem 3.10] based on *Almost Ring Theory*. Assume that $R$ is excellent. For each n, set $R_n:=\{x\in R^\infty|x^{p^n}\in R\}$. The assignment $x\mapsto x^{p^n}$ shows that $R\simeq R_n$, which implies that $R_n$ is excellent. We recall that over excellent domains of prime characteristic one can use the colon capturing property of tight closure theory, see e.g. [@HH2 Theorem 1.7.4]. Let $\underline{x}:=x_1,\ldots,x_d$ be a system of parameters for $R$, where $d:=\dim R$ and let $r\in R^{\infty}$ be such that $rx_{i+1}=\sum_{j=1}^i r_jx_j$ for some $r_j\in R^{\infty}$. Then $r,r_j\in R_n$ for $n\gg 0$. So $r\in((x_1,\ldots, x_i)R_n :_{R_n} x_{i+1})$. Thus from Lemma \[sh1\], $$\begin{array}{ll} ((x_1,\ldots, x_i)R^{\infty} :_{R^{\infty}} x_{i+1})&=\bigcup_n((x_1,\ldots, x_i)R_n :_{R_n} x_{i+1})\\ &\subseteq \bigcup_n((x_1,\ldots, x_i)R_n)^\ast\\ &\subseteq ((x_1,\ldots, x_{i})R^\infty)^\ast\\ &=(x_1,\ldots, x_{i})R^\infty. \end{array}$$ Clearly, ${\frak{m}}R^{\infty}\neq R^{\infty}$. So, any system of parameters of $R$ is regular sequence on $R^{\infty}$, i.e., $R^{\infty}$ is balanced big Cohen-Macaulay. It is to be noted that in the case of non-Noetherian rings, tight closure may behave nicely, since from the above proof we find that it exhibits the colon capturing property. We recall the following definitions. Let ${\frak{a}}$ be an ideal of a ring $A$ and $M$ be an $A$-module. A finite sequence $\underline{x}:=x_{1},\ldots,x_{r}$ of elements of $A$ is called $M$-sequence if $x_i$ is a nonzero-divisor on $M/(x_1,\ldots, x_{i-1})M$ for $i=1,\ldots,r$ and $M/\underline{x}M\neq0$. The classical grade of ${\frak{a}}$ on $M$, denoted by ${\operatorname{c.grade}}_A({\frak{a}},M)$, is defined by the supremum length of maximal $M$-sequences in ${\frak{a}}$. The polynomial grade of ${\frak{a}}$ on $M$ is defined by $${\operatorname{p.grade}}_A({\frak{a}},M):=\underset{m\rightarrow\infty}{\lim}{\operatorname{c.grade}}_{A[t_1, \ldots,t_m]}({\frak{a}}A[t_1, \ldots,t_m],A[t_1,\ldots,t_m]\otimes_A M)$$ and we will use the following well-known properties of the polynomial grade. \[pro\] (see e.g. [@AT]) Let ${\frak{a}}$ be an ideal of a ring $A$ and $M$ an $A$-module. Then the following statements hold. 1. If ${\frak{a}}$ is finitely generated, then$${\operatorname{p.grade}}_A({\frak{a}},M)=\inf\{{\operatorname{p.grade}}_{A_{{\frak{p}}}}({\frak{p}}A_{{\frak{p}}},M_{{\frak{p}}})|{\frak{p}}\in {\operatorname{V}}({\frak{a}})\cap{\operatorname{Supp}}_A M\}.$$ 2. Let $\Sigma$ be the family of all finitely generated ideals ${\frak{b}}\subseteq{\frak{a}}$. Then$${\operatorname{p.grade}}_A({\frak{a}},M)=\sup\{{\operatorname{p.grade}}_A({\frak{b}},M):{\frak{b}}\in\Sigma\}.$$ 3. ${\operatorname{p.grade}}_A({\frak{a}},M)\leq{\operatorname{ht}}_{M}({\frak{a}}).$ Now, we are ready to prove the following: \[main\] Let $R$ be a Noetherian local F-coherent domain which is either excellent or homomorphic image of a Gorenstein local ring. Then ${\operatorname{ht}}({\frak{a}})={\operatorname{p.grade}}_{R^{\infty}}({\frak{a}}, R^{\infty})$ for all ideal ${\frak{a}}$ of $R^{\infty}$. Let $\underline{x}:=x_1,\ldots,x_d$ be a system of parameters for $R$, where $d:=\dim R$. By Lemma \[sh\], $\underline{x}$ is regular sequence on $R^{\infty}$. So $$d\leq{\operatorname{p.grade}}(\underline{x}R^{\infty},R^{\infty})\leq{\operatorname{p.grade}}({\frak{m}}_{R^{\infty}},R^{\infty})\leq{\operatorname{ht}}({\frak{m}}_{R^{\infty}})=d.$$This shows that ${\operatorname{p.grade}}({\frak{m}}_{R^{\infty}},R^{\infty})={\operatorname{ht}}({\frak{m}}_{R^{\infty}})$ for the maximal ideal ${\frak{m}}_{R^{\infty}}$ of $R^{\infty}$. At first, we assume that ${\frak{a}}$ is finitely generated and let $P$ be a prime ideal of $R^{\infty}$ such that $P\supseteq {\frak{a}}$. Set ${\frak{p}}:=P\cap R$. Take $x\in(R_{{\frak{p}}})^{\infty}$. Then $x^{p^n}\in R_{{\frak{p}}}$ for some $n$, where $p$ is the characteristic of $R$. Thus $x^{p^n}=a/b$ for some $a\in R$ and $b \in R\setminus{\frak{p}}$. Consider $\frac{a^{1/p^n}}{b^{1/p^n}}$ as an element of $R^{\infty}_P$. Let $m\geq n$. Then $\frac{a^{1/p^n}}{b^{1/p^n}}=(\frac{a^{1/p^{m-n}}}{b^{1/p^{m-n}}})^{1/p^m}$. Keep it in the mind that $R$ is of prime characteristic. If we assume that $a/b=c/d$ then $\frac{a^{1/p^n}}{b^{1/p^n}}=\frac{c^{1/p^n}}{d^{1/p^n}}$. Putting these facts together, we see that the assignment $x\mapsto \frac{a^{1/p^n}}{b^{1/p^n}}$ is independent of the presentation of $x$ and of the choice of $n$. So, it defines a ring homomorphism $\varphi: (R_{{\frak{p}}})^{\infty} \to R^{\infty}_P$. Clearly, $\ker \varphi =0$. Let $x\in R^{\infty}_P$. Then $x=\alpha /\beta$, where $\alpha\in R^{\infty}$ and $\beta\in R^{\infty}\setminus P$. Take $n$ to be such that $a:=\alpha^{p^n}\in R$ and $b:=\beta^{p^n}\in R\setminus {\frak{p}}$. Set $c:=a/b\in R_{{\frak{p}}}$. Consider $\gamma:=c^{1/p^n}\in (R_{{\frak{p}}})^{\infty}$. Then $\varphi(\gamma)=x$, and thus $\varphi$ is an isomorphism. We recall that $R_{{\frak{p}}}$ is F-coherent. Clearly, $R_{{\frak{p}}}$ is either excellent or homomorphic image of a Gorenstein local ring. By the case of maximal ideals, $${\operatorname{p.grade}}(PR^{\infty}_P,R^{\infty}_P)={\operatorname{p.grade}}({\frak{m}}_{(R_{{\frak{p}}})^{\infty}},(R_{{\frak{p}}})^{\infty})={\operatorname{ht}}({\frak{p}})={\operatorname{ht}}(P).$$ This fact along with Lemma \[pro\] yields that $$\begin{array}{ll} {\operatorname{p.grade}}({\frak{a}},R^{\infty})&=\inf\{{\operatorname{p.grade}}(PR^{\infty}_P,R^{\infty}_P)|P\in {\operatorname{V}}({\frak{a}})\}\\ &=\inf\{{\operatorname{ht}}(P)|P\in {\operatorname{V}}({\frak{a}})\}\\&={\operatorname{ht}}({\frak{a}}), \end{array}$$ which shows that ${\operatorname{p.grade}}({\frak{a}},R^{\infty})={\operatorname{ht}}({\frak{a}})$ for every finitely generated ideal ${\frak{a}}$ of $R^{\infty}$. Finally we assume that ${\frak{a}}$ is an arbitrary ideal of $R^{\infty}$ and let $\Sigma$ be the family of all finitely generated ideals ${\frak{b}}\subseteq{\frak{a}}$. We bring the following claim: Claim: One has ${\operatorname{ht}}({\frak{a}})=\sup\{{\operatorname{ht}}({\frak{b}}):{\frak{b}}\in \Sigma\}$. To see this, let $P\in {\operatorname{Spec}}(R^{\infty})$ be such that ${\operatorname{ht}}(P)={\operatorname{ht}}({\frak{a}})$ and set ${\frak{p}}:=P\cap R$ and we already have that $R^{\infty}_P=(R_{{\frak{p}}})^{\infty}$. Set $n:={\operatorname{ht}}({\frak{p}})={\operatorname{ht}}(P)={\operatorname{ht}}({\frak{a}}\cap R)$. Due to [@BH Theorem A.2], there exists a sequence $\underline{x}:=x_1,\ldots,x_n$ of elements of ${\frak{a}}\cap R$ such that ${\operatorname{ht}}(x_1,\ldots,x_i)R=i$ for all $1\leq i \leq n$. Since $R$ is catenary, $\underline{x}$ is part of a system of parameters for $R$. By Lemma \[sh\], $\underline{x}$ is a regular sequence on $R^{\infty}$. So $${\operatorname{ht}}(P)\geq {\operatorname{ht}}(\underline{x}R^{\infty})\geq{\operatorname{p.grade}}(\underline{x}R^{\infty},R^{\infty})=n= {\operatorname{ht}}({\frak{p}})={\operatorname{ht}}(P),$$ which shows that ${\operatorname{ht}}(\underline{x}R^{\infty})={\operatorname{ht}}({\frak{a}})$. This completes the proof of the claim. From the results of finitely generated ideals, we have that ${\operatorname{p.grade}}({\frak{b}},R^{\infty})={\operatorname{ht}}({\frak{b}})$ for all ${\frak{b}}\in\Sigma$. Thus from Lemma \[pro\] and from the above claim we see that $$\begin{array}{ll} {\operatorname{p.grade}}({\frak{a}},R^{\infty})&=\sup\{{\operatorname{p.grade}}({\frak{b}},R^{\infty}):{\frak{b}}\in\Sigma\}\\ &=\sup\{{\operatorname{ht}}({\frak{b}}):{\frak{b}}\in \Sigma\}\\&={\operatorname{ht}}({\frak{a}}),\\ \end{array}$$ and this is precisely what we wish to prove. Let $M$ be an $A$-module. Recall that a prime ideal ${\frak{p}}$ is weakly associated to $M$ if ${\frak{p}}$ is minimal over $(0 :_{A} m)$ for some $m\in M $. Adopt the assumption of Theorem \[main\] and let ${\frak{a}}$ be an ideal of $R^{\infty}$ which is generated by ${\operatorname{ht}}({\frak{a}})$ elements. Then all the weakly associated prime ideals of $R^{\infty}/ {\frak{a}}$ have the same height. See [@AT Corollary 4.6] and its proof. \[rem\] $\mathrm{(i)}$: Concerning the proof of Theorem \[main\], we can ask the following question which has a positive answer for several classes of commutative rings such as valuation domains. Let $A$ be a commutative ring and ${\frak{a}}$ an ideal of $A$. Let $\Sigma$ be the family of all finitely generated ideals ${\frak{b}}\subseteq{\frak{a}}$. Is ${\operatorname{ht}}({\frak{a}})=\sup\{{\operatorname{ht}}({\frak{b}}):{\frak{b}}\in \Sigma\}$? $\mathrm{(ii)}$: Let A be a ring with the property that ${\operatorname{p.grade}}_A({\frak{m}};A) = {\operatorname{ht}}({\frak{m}})$ for all maximal ideals ${\frak{m}}$ of $A$. One may ask whether ${\operatorname{p.grade}}_A({\frak{a}};A) = {\operatorname{ht}}({\frak{a}})$ holds for all ideals ${\frak{a}}$ of $A$. In view of [@AT Example 3.11], this is not true in general. Dagger Closure and Big Cohen-Macaulay algebras ============================================== In this section we extend the notion of dagger closure to the submodules of a finitely generated module over a Noetherian local domain $(R,{\frak{m}})$ and we present Corollary \[main2\]. \[def:almost closure of an ideal\] Let $A$ be a local algebra with a normalized valuation $v:A\rightarrow {{\mathbb R}}\cup\{\infty\}$ and $M$ be an $A$-module. Consider a submodule $N\subset M$. We say $x\in N^{v}_M$ if for every $\epsilon> 0$, there exists $a\in A$ such that $v(a)< \epsilon$ and $ax\in N$. \[almcm\] Let $A$ be an algebra over a Noetherian local domain $(R,{\frak{m}})$ of $\dim d$. Assume that $A$ is equipped with a normalized value map $v : A\to {{\mathbb R}}\cup\{\infty\}$. From [@RSS], we recall that $A$ is called almost Cohen-Macaulay if for $i=1,\ldots, d$, each element of $((x_{1},\ldots, x_{i-1})A:_{A}x_{i})/(x_{1},\ldots,x_{i-1})A$ is annihilated by elements of sufficiently small order with respect to $v$ for all system of parameters $x_1,\ldots, x_d$ of $A$. \[def\] Let $(R,{\frak{m}})$ be a Noetherian local domain and let $A$ be a local domain containing $R$ with a normalized valuation $v:A\rightarrow {{\mathbb R}}\cup\{\infty\}$. For any finitely generated $R$-module $M$ and for its submodule $N$ we define submodule $N_{M}^{\bold{v}}$ such that $x\in N_{M}^{\bold{v}}$ if $x\otimes 1 \in {\operatorname{im}}(N\otimes A\to M\otimes A)_{M\otimes A}^{v}$. Let $A$ be a perfect domain and $\frak a$ be a nonzero radical ideal of $A$. Then $\frak a^v=A$. To see this, let $x$ be a nonzero element of $\frak a$. Since $v(x^{1/n})=v(x)/n$ and $x^{1/n}\in \frak a$, the conclusion follows. \[pr\] Let $(R,{\frak{m}})$ be a Noetherian local domain and let $A$ be a local domain containing $R$ with a normalized valuation $v:A\rightarrow {{\mathbb R}}\cup\{\infty\}$. Let $M$, $M'$ be finitely generated $R$-modules. Consider the submodules $N$, $W$ of $M$. Then the following statements are true: 1. $N^{\bold{v}}_M$ is a submodule of $M$ containing $N$. 2. $(N^{\bold{v}}_M)^{\bold{v}}_M= N^{\bold{v}}_M$. 3. If $N\subset W\subset M$, then $N^{\bold{v}}_M\subset W^{\bold{v}}_M$. 4. Let $f:M\to M'$ be a homomorphism. Then $f(N^{\bold{v}}_M)\subset f(N)^{\bold{v}}_{M'}$. 5. If $N^{\bold{v}}_M= N$, then $0^{\bold{v}}_{M/N}= 0$. 6. We have $0^\bold{v}_R=0$ and ${\frak{m}}^\bold{v}_R={\frak{m}}$. In addition to, if $A$ is almost Cohen-Macaulay, then the following is true: 1. Let $x_1, \ldots , x_{k+1}$ be a partial system of parameters for $R$, and let $J = (x_1, \ldots , x_k)R$. Suppose that there exists a surjective homomorphism $f:M\to R/J$ such that $f(u) = \bar{x}_{k+1}$, where $\bar{x}$ is the image of $x$ in $R/J$. Then $(Ru)^{\bold{v}}_M\cap \ker f \subset (Ju)^{\bold{v}}_M$. The proof is straightforward and we leave it to the reader. In [@Ho], Hochster showed the existence of a big Cohen-Macaulay algebra from the existence of an almost Cohen-Macaulay algebra in dimension 3. The following Corollary extends this result, by proving the existence of big Cohen-Macaulay modules from the existence of almost Cohen-Macaulay algebras in any dimension $d$. \[main2\] For a complete Noetherian local domain, if it is contained in an almost Cohen-Macaulay domain, then there exists a balanced big Cohen-Macaulay module over it. Due to [@D Theorem 3.16], we know that there exists a list of seven axioms for a closure operation defined for finitely generated modules over complete local domains. By the main result of [@D], one can see that a closure operation satisfying those axioms implies the existence of a balanced big Cohen-Macaulay module over the base ring. In view of Proposition \[pr\], we see that the closure operation defined in Definition \[def\] satisfies all the seven axioms of [@D Theorem 3.16]. This completes the proof. The above result can be used to prove [@RSS Proposition 1.3] by a completely different argument, since the existence of almost Cohen-Macaulay domain impiles the existence of big Cohen-Macaulay module. Concluding Remarks ================== For Noetherian local domain $R$ of $\dim d$, the above results can be extended to an almost Cohen-Macaulay $R^{+}$-algebra where $R^{+}$ be its integral closure in an algebraic closure of its fraction field. Fixed a local $R^{+}$-algebra $A$ and let $M$ be an $A$-module. Consider a submodule $N\subset M$. In view of Definition \[def:almost closure of an ideal\], define $ N^{v}_M$ via a normalized valuation $v:R^{+}\rightarrow {{\mathbb R}}\cup\{\infty\}$. For a finitely generated $R$-module $M$ and its submodule $N$ we define submodule $N_{M}^{\bold{v}}$ such that $x\in N_{M}^{\bold{v}}$ if $x\otimes 1 \in {\operatorname{im}}(N\otimes A\to M\otimes A)_{M\otimes A}^{v}$. From [@S1], we recall that $A$ is almost Cohen-Macaulay if for every system of parameters $x_1,\ldots, x_d$, $((x_1,\ldots, x_{i-1})A:_Ax_i)/(x_1,\ldots, x_{i-1})A$ is almost zero $R^{+}$-module for $i=1,\ldots,d$ and $A/{\frak{m}}A$ is not almost zero. Let $(R,{\frak{m}})$ be a Noetherian local domain and let $R^{+}$ be equipped with a normalized valuation $v:R^{+}\rightarrow {{\mathbb R}}\cup\{\infty\}$. Consider a local $R^{+}$-algebra $A$ and for every $I\subset R$, we define $I^{\bold{v}}$ as above. Under this situation, closure operation satisfies all the properties given in Proposition \[pr\] if and only if $A$ is an almost Cohen-Macaulay $R^{+}$-algebra where $R^{+}$ is contained in it as a subdomain. We show $0^{\bold{v}}= 0$ implies $R^{+}\to A$ is injective. To see this, take $0\neq a\in R^{+}$ such that its image in $A$ is zero. Since $a$ is integral over $R$, there exists a minimal monic expression $a^n+ r_1a^{n-1}+\cdots +r_n= 0$, where each $r_i\in R$ with $r_n\neq 0$. Take the image of the expression in $A$ which gives that the image of $r_n$ is zero in $A$. So $r_n\in 0^{\bold{v}}= 0$. This gives $r_n= 0$. So we arrive at a contradiction and $a$ is zero in $R^{+}$. By using straightforward modification of the proof of Corollary \[main2\], we get the rest of the claim. The proof of the converse is left it to the reader. The following result provides an example of an almost Cohen-Macaulay $R^{+}$-algebra where $R^{+}$ is contained in it as a subdomain. We recall that an $R$-algebra $T$ is called a *seed*, if it maps to a big Cohen-Macaulay $R$-algebra (see [@D1]). \[rem\] Let $(R,{\frak{m}})$ be a Noetherian complete local domain in mixed characteristic $p>0$, with a system of parameters $p, x_2,\ldots, x_d$. Let $B$ be as [@S1 Theorem 5.3]. Then the following are equivalent. 1. $B/{\frak{m}}B$ is not almost zero when viewed as $R^{+}$-module. 2. $p^{\epsilon}\notin (p, x_2,\ldots, x_d)B$ for some rational number $\epsilon>0$. $\mathrm{(i)}\Rightarrow\mathrm{(ii)}$: Clearly ${\frak{m}}B$ does not contain elements of $R^{+}$ of arbitrary small order. If $p^{\epsilon}\in (p, x_2,\ldots, x_d)B$ for every rational number $\epsilon$ then $p^{1/k}\in (p, x_2,\ldots, x_d)B$ for every positive integer $k$. Since $v(p)< \infty$, $p^{1/k}$ are the elements of $R^{+}$ of arbitrarily small order and ${\frak{m}}B$ contains all of them. This is a contradiction. $\mathrm{(ii)}\Rightarrow\mathrm{(i)}$: From [@S1 Corollary 6.1] it follows that $R^{+}$ is a seed and using similar argument of [@D1 Example 5.2] we find that $R^{+}$ is actually a minimal seed. Thus $R^{+}$ can be thought as a subdomain of $B$. Let $\{x_{\lambda}\}= B-R^{+}$. Take $C= R^{+}[\{X_{\lambda}\}]$ where $X_{\lambda}$’s are the indeterminates. One can extend the valuation $R\to {{\mathbb Z}}\cup \{\infty\}$ to $C\to {{\mathbb R}}\cup \{\infty\}$ such that $v$ is non negative on $C$ and positive on non-units of $C$. Also, we choose values of $X_{\lambda_i}$’s greater than some $N> 0$. For $B= C/JC$, we have $y\in JC$ implies $v(y)> N> 0$, and since ${\frak{m}}$ is also finitely generated same is true for ${\frak{m}}C$. Thus $C/(J+{\frak{m}})C$ is not almost zero viewing as $C$-module. Since $B/{\frak{m}}B= C/(J+{\frak{m}})C$, we find that $B/{\frak{m}}B$ is not almost zero viewing as $C$-module. Thus $B/{\frak{m}}B$ is not almost zero viewing as $R^{+}$-module. In [@S1], it has been asked that whether the $R^+$-algebra $B$ which satisfies conditions of Theorem 5.3 (there) is almost Cohen-Macaulay or not (i.e $B/mB$ is almost zero or not). From Corollary 5.2 and Proposition \[rem\], we get the following: Let $B$ be a weakly almost Cohen-Macaulay $R^+$-algebra satisfies Theorem 5.3 of [@S1]. Then $B$ is almost Cohen-Macaulay $R^+$-algebra (i.e. $B/mB$ is almost zero) if and only if it maps to big Cohen-Macaulay $R^+$-algebra. It is to be noted that here $R^+$ is contained in $B$ as a subdomain. We would like to thank K. Shimomoto for his comments on the earlier version of this paper. We also thank the referee for careful reading of the paper and for the valuable suggestions. [99]{} M. Asgharzadeh, *Homological properties of the perfect and absolute integral closure of Noetherian domains*, Math. Annalen [**348**]{} (2010), 237–-263. M. Asgharzadeh and M. Tousi, *On the notion of Cohen-Macaulayness for non-Noetherian rings*, J. Algebra [**[322]{}**]{} (2009), 2297–2320. M. Asgharzadeh and K. Shimomoto, *Almost Cohen-Macaulay and almost regular algebras via almost flat extensions*, to appear in J. Commutative Algebra. W. Bruns and J. Herzog, *Cohen-Macaulay rings*, Cambridge University Press [**[39]{}**]{}, Cambridge, (1998). H. Brenner and A. Stabler, *Dagger closure and solid closure in graded dimension two*, Preprint (2011), Arxiv math.AG/1104.3748. G. Dietz, *A characterization of closure operations that induce big Cohen-Macaulay modules*, Proc. AMS [**[138]{}**]{} (2010), 3849–3862. G. Dietz, *Big Cohen-Macaulay algebras and seeds*, Trans. Amer. Math. Soc. [**[359]{}**]{}, (2007), 5959–-5989. J. Elliott, *Prequantales and applications to semistar operations and module systems*, arXiv:1101.2462 \[math AC\]. M. Hochster, *Big Cohen-Macaulay algebras in dimension three via Heitmann’s theorem*, J. Algebra [**[254]{}**]{} (2002), 395–408. M. Hochster and C. Huneke, *Tight closure and elements of small order in integral extensions*, J. Pure and Applied Algebra [**[71]{}**]{} (1991), 233-247. M. Hochster and C. Huneke, *Tight closure in equal characteristic zero*, Preprint. P. Roberts, A. Singh and V. Srinivas, *Annihilators of local cohomology in characteristic zero*, Illinois J. Math. [**[51]{}**]{} (2007), 237-254. K. Shimomoto, *F-coherent rings with applications to tight closure theory*, Journal of Algebra [**[338]{}**]{}, (2011), 24–34. K. Shimomoto, *Almost Cohen-Macaulay algebras in mixed characteristic via Fontaine rings*, to appear in Illinois J. Math.

District Madhubani Madhubani District is a district of Bihar state, India, and Madhubani town is the administrative headquarters of this district. Madhubani district is a part of Darbhanga Division. Geography of Madhubani Madhubani district is bounded on North side by Hill region of Nepal, on South side by Darbhanga District, on east side by Supaul District and west side by Sitamarhi District. Madhubani district occupies a total of 3501 sq. kms. Main Rives : Kamla, Jeevachh, Koshi, Kareh, Gehuan, Supen, Trishula, Balan, Bhutahi Balan, and Adhwara Group are the main rivers. Latitude of Madhubani city : 25º-59' to 26º-39' EastLongitude of Madhubani city : 85º-43' to 86º-42' North. About Madhubani District The district of Madhubani was carved out of the old Darbhanga district in the year 1972 as a result of reorganisation of the districts in the State. Tharu tribe and Bhar were the early inhabitants of this region. Videha kingdom also included a huge portion of Madhubani District. Sub Division of Madhubani District In Madhubani District there 5 sub division Madhubani Jaynagar Benipatti Jhanjharpur Phulparas Tourist Place in Madhubani District Saurath Kapileswarsthan Uchaitha Bhawanipur Railways Station in Madhubani District Jhanjharpur Railway Station Sakri Junction Railway Station Madhubani Railway Station Laukaha Bazar Railway Station Economy of Madhubani District Madhubani District exports fish, mangoes, sugar-cane , handloom cloth, makhana (Water berries), litchi, paddy, and brass metal articles to various cities insides and outside the state. Economy of Madhubani District is basically dependent on agriculture. Major crops grown in the district are Wheat, Sugarcane and Pulses. Rearing of cattle is an important subsidiary occupation of the district. The district is well stocked with cattle Major Crops of Madhubani District Paddy, Wheat, Sugarcane, Paan, Pulses, Makhana are the main crops of this district.

Crafted from durable saffiano leather, MICHAEL Michael Kors’ Selma messenger bag is given a new season update with a cool bicolour exterior. Small yet spacious, it will effortlessly carry all of your everyday essentials in style. Sling over your shoulder or wear across the body using the adjustable shoulder strap. Add classic style to your day-to-night wardrobe with the Selma messenger bag from MICHAEL Michael Kors. The textured saffiano leather exterior is crafted into a structured silhouette with minimal gold tone hardware. Wear across the body for an effortlessly cool look you can wear with tailoring and smart casual wear. Crafted from durable saffiano leather, the MICHAEL Michael Kors Selma Messenger Bag is the perfect everyday sidekick. Updated with pyramid studs in the brand’s signature polished gold-tone metal, this small yet spacious design will lend a little designer luxe to your look. Sling over your shoulder or wear across the body using the adjustable shoulder strap. Crafted from glossy textured leather, MICHAEL Michael Kors’ Selma messenger bag is sure to be a long-standing addition to every style lover’s accessories collection. Small yet spacious, it will effortlessly carry all of your everyday essentials in style. Sling over your shoulder or wear across the body using the adjustable shoulder strap. The Lugano Messenger - 48781 is part of the Tumi® Voyageur Collection. Designed to provide just the right amount of organization, the Lugano Messenger is the ideal size and shape to take with you everywhere. Zip entry into main compartment with a flapover is sure to keep your necessities safe. Zippered pocket on lining keeps your small items secure. With multiple slip-in pockets on the lining, fishing for your keys and cellphone are things of the past. Durable webbing shoulder strap is adjustable for a perfect fit. Measurements: ; Bottom Width: 9 1 2 in ; Depth: 3 in ; Height: 9 in ; Strap Length: 61 in ; Strap Drop: 27 1 2 in ; Weight: 1 lb Add classic style to your day-to-night wardrobe with the Selma messenger bag from MICHAEL Michael Kors. The textured saffiano leather exterior is crafted into a structured silhouette with minimal gold tone hardware. Wear across the body for an effortlessly cool look you can wear with tailoring and smart casual wear.

Moi has posted quite a bit about autism. Studies indicate that the incidence of autism is growing in the population. In order for children with autism to reach their full potential there must be early diagnosis and treatment. Alice Park of Time reported in the article, U.S. Autism Rates Jump 30% From 2012 http://time.com/#40524/u-s-autism-rates-jump-30-from-2012/ In Archives of Pediatrics and Adolescent Medicine study: Kids with autism more likely to be bullied moi wrote: Science Daily reported in the article, Study Details Bullying Involvement for Adolescents With Autism Spectrum Disorder: A study based on information collected from 920 parents suggests an estimated 46.3 percent of adolescents with an autism spectrum disorder were the victims of bullying, according to a report published Online First by Archives of Pediatrics & Adolescent Medicine, a JAMA Network publication….http://www.sciencedaily.com/releases/2012/09/120903221126.htm There are signs that a particular child may be vulnerable to bullying. In School bullying: Office of Juvenile Justice and Delinquency report, moi wrote: The Department of Justice’s Office of Juvenile Justice and Delinquency has issued the report, Bullying in Schools: An Overview by Ken Seeley, Martin L. Tombari, Laurie J. Bennett, and Jason B. Dunkle. Among the study’s findings are: • Bullying is a complex social and emotional phenomenon that plays out differently on an individual level. • Bullying does not directly cause truancy. • School engagement protects victims from truancy and low academic achievement. • When schools provide a safe learning environment in which adults model positive behavior, they can mitigate the negative effects of bullying. • Any interventions to address bullying or victimization should be intentional, student-focused engagement strategies that fit the context of the school where they are used. The report makes the following recommendations: • Increase student engagement. • Model caring behavior for students. • Offer mentoring programs. • Provide students with opportunities for service learning as a means of improving school engagement. • Address the difficult transition between elementary and middle school (from a single classroom teacher to teams of teachers with periods and class changes in a large school) (Lohaus et al., 2004). • Start prevention programs early. • Resist the temptation to use prefabricated curriculums that are not aligned to local conditions. Increase Student Engagement Bullied children who remain engaged in school attend class more frequently and achieve more. Challenging academics, extracurricular activities, understanding teachers and coaches, and a focus on the future help keep victimized children engaged in their education (Bausell, 2011). Schools, administrations, and districts that wish to stave off the negative effects of bullying must redouble their efforts to engage each student in school. Typical school engagement strategies include (Karcher, 2005): • Providing a caring adult for every student through an advisory program or similar arrangement. • Carefully monitoring attendance, calling home each time a student is absent, and allowing students the ability to make up missed work with support from a teacher. • Adopting and implementing the National School Climate Standards from the National School Climate Council (2010). • Promoting and fostering parent and community engagement, including afterschool and summer programs. • Providing school-based mentorship options for students. http://www.ojjdp.gov/pubs/234205.pdf A widely publicized case of two Maryland teenagers charged with assault for bullying a classmate with autism—a classmate who later strongly defended them—illustrates the complexities that schools face with youth whose disabilities are based in social interactions. Autism spectrum disorder, characterized by social impairment and communication difficulties, leaves some youths less able to recognize teasing or bullying when it occurs, said Ellen F. Murray, a clinical manager at the Center for Autism and Related Disorders in Alexandria, Va. “They may not even understand teasing if it’s happening right in front of them, much less if it’s behind their back,” said Ms. Murray. “A lot of our kids would definitely not pick up on those social cues and understand the perspective of another student.” With those challenges in mind, experts say that one way for schools to address bullying of students with autism is to take a step back and examine the entire school environment. And, while social-skills training is commonly a part of the individualized education program, or IEP, for students with autism, such instruction should not be limited just to them, experts say…. Fostering Connections Schools are using a variety of approaches and individual programs to improve social interactions between students with developmental disabilities such as autism and their typically developing peers. Peer Adovcacy The Parent Advocacy Coalition for Educational Rights Center, or PACER, based in Bloomington, Minn., has several bullying-prevention resources for schools, including a toolkit to help start a peer-advocacy program. Such programs use the power of peer influence, and students can often spot problem behavior before adults do. Positive Behavioral Supports This schoolwide intervention framework supported by the U.S. Department of Education, offers schools a way to organize and monitor behavioral expectations for students and adults. Second Step This program, used in more than 30,000 schools and aimed at students ages 4 to 14, includes in-school lessons on empathy, emotion management, and problem-solving. It also includes lessons for all students in how to recognize, respond to, and report bullying. Remaking Success Currently being studied in several schools, this program enlists paraprofessionals who often “shadow” students with disabilities as active coaches on the playground, bringing children together and creating opportunities for joint play. The program has shown some success in expanding the social networks of students. SOURCES: The National Bullying Prevention Center; StopBullying.gov; Autism Intervention Research Network on Behavioral Healthhttp://www.edweek.org/ew/articles/2014/05/07/30autism_ep.h33.html?tkn=SQXF7qgMjGrAX60B0LbyHDeFR8O3wkbWbRkr&intc=es The American Psychological Association (APA) has information about bullying. The APA has the following suggestions for teachers and administrators: Be knowledgeable and observant Teachers and administrators need to be aware that although bullying generally happens in areas such as the bathroom, playground, crowded hallways, and school buses as well as via cell phones and computers (where supervision is limited or absent), it must be taken seriously. Teachers and administrators should emphasize that telling is not tattling. If a teacher observes bullying in a classroom, he/she needs to immediately intervene to stop it, record the incident and inform the appropriate school administrators so the incident can be investigated. Having a joint meeting with the bullied student and the student who is bullying is not recommended — it is embarrassing and very intimidating for the student that is being bullied. Involve students and parents Students and parents need to be a part of the solution and involved in safety teams and antibullying task forces. Students can inform adults about what is really going on and also teach adults about new technologies that kids are using to bully. Parents, teachers, and school administrators can help students engage in positive behavior and teach them skills so that they know how to intervene when bullying occurs. Older students can serve as mentors and inform younger students about safe practices on the Internet. Set positive expectations about behavior for students and adults Schools and classrooms must offer students a safe learning environment. Teachers and coaches need to explicitly remind students that bullying is not accepted in school and such behaviors will have consequences. Creating an anti-bullying document and having both the student and the parents/guardians sign and return it to the school office helps students understand the seriousness of bullying. Also, for students who have a hard time adjusting or finding friends, teachers and administrators can facilitate friendships or provide “jobs” for the student to do during lunch and recess so that children do not feel isolated or in danger of becoming targets for bullying. http://www.apa.org/helpcenter/bullying.aspx Stop Bullying.gov has some great advice about bullying. According to the Stop Bullying.gov article, What You Can Do: What to Do If You’re Bullied There are things you can do if you are being bullied: • Look at the kid bullying you and tell him or her to stop in a calm, clear voice. You can also try to laugh it off. This works best if joking is easy for you. It could catch the kid bullying you off guard. • If speaking up seems too hard or not safe, walk away and stay away. Don’t fight back. Find an adult to stop the bullying on the spot. There are things you can do to stay safe in the future, too. • Talk to an adult you trust. Don’t keep your feelings inside. Telling someone can help you feel less alone. They can help you make a plan to stop the bullying. • Stay away from places where bullying happens. • Stay near adults and other kids. Most bullying happens when adults aren’t around.http://www.stopbullying.gov/kids/what-you-can-do Even though children are encouraged to report bullying, they often don’t. We must encourage children to report bullying. Resources: For more information on neurological disorders or research programs funded by the National Institute of Neurological Disorders and Stroke, contact the Institute’s Brain Resources and Information Network (BRAIN) at: BRAIN P.O. Box 5801 Bethesda, MD 20824 (800) 352 9424 http://www.ninds.nih.gov

Browse Hiring & Career Trends Articles When you’re searching for a job to embark upon your career, what do you look for? Prospects and quality of life are likely amongst the top factors in considering which city you end up in. Personal finance site, WalletHub, took these factors along with other relevant stats into consideration to create a list of the best and worst cities to begin ... Whether you’ve never interviewed for a real job or you’ve done it a dozen times, there is a point – usually at the end – when the interviewer asks if you have any questions for them. Typically, your response may be “no” as the interviewer has done a great job highlighting the tasks of the job, the pay rate, other benefits, ... In this day and age, college is often considered a necessary investment in one’s future. But, are some students – perhaps even attending the same colleges – making better investments than others? Unbelievably, the answer may be yes, depending on their chosen majors. According to PayScale’s list of college majors and coordinating salary potential, certain majors pay off much faster, with ... Some of us are night owls. Others, early birds. Apparently, based on your chronotype, you will be more naturally alert earlier or later in the day. And your type may dictate when and for how long you sleep. But while a natural variance in sleep patterns is natural, it appears that the early bird is indeed the more coveted of ... One of the main decisions college graduates face is where to plant their first roots upon graduation. Sure, finding a job is a factor in this decision-making process but, most post-grads ultimately want to end up in a spot that is ripe with diversity, your peers and has a good economic climate. Recently, the American Institute for Economic Research (AIER) ranked ... Self-improvement may seem unrelated to your career success. It probably doesn't even seem like it factors into your job or internship search or matters within interviews or at networking events. But, it’s probably a lot more related than you might think. How you conduct yourself in various situations, your personal knowledge, life skills, interests, friendships, self-awareness and confidence all play different ... If you’re interviewing for a job, you’ve probably gotten the “tell me about yourself” question. While everyone is an individual, there are certain characteristics being ascribed to Millenials—members of the generation born after 1980. Or rather, perceptions other generations have about Millenials. And unfortunately, not all of them are good. But, there’s a way to spin those “negative” attributes. Here, we ... Former and current college students with disabilities may not be aware of a program that allows student debt relief, and the Department of Education announced a new process to identify individuals eligible for the federal loan forgiveness program, called the Total and Permanent Disability (TPD) Federal Student Loan Discharge. The program was created to aid those who are permanently disabled and/or ... The Internet is a dangerous place for employees and potential employees. That’s because employers are using information they find about you online to make hiring and firing decisions. A recent article in the New York Times said 75 percent of recruiters are required to do online research of candidates and 70 percent have rejected candidates because of what they found. And ... The ink may not yet have dried on their diplomas, but many college grads have already begun the hardest jobs of their lives: finding one. Facing one of the worst hiring outlooks in recent history and forewarned of its impact on their job prospects, newly minted grads have brushed the stars from their eyes and buckled down for the long ... When you’re young and the world is seemingly your oyster, going to a job fair sounds like a no-brainer. A bunch of companies looking to hire? and all in the same place? As long as you bring enough copies of your resume and pass them out to everyone, you’re certain to get a callback. Right? Not necessarily. Without the right approach, ... Where are all of the jobs? This question has plagued job seekers in recent years, especially with companies cutting back on hiring due to the economy. The economy is better – in fact, 5.5 million jobs have been added since 2010, but there’s still improvement necessary. However, according to U.S. News, some industries seem to be resilient enough that they’re recession-proof. ... You think it doesn't matter what you wear to a job interview? You’re wrong. When you walk up to your interview and shake their hand, they already have an impression of you. You haven’t even said anything yet! True, there are other factors like timeliness, politeness, etc. But, for the sake of this article, let’s assume you’ve done everything else perfectly. ... For the unemployed, the holiday season can be especially stressful. Strained finances can make gift-giving something to dread. Potential employers are going AWOL in mid December, putting the brakes on even the most diligent job search. Even so, soon the holidays will be over and it's time to get your search back on track, even though it may take a week ... OFFICE PARTIES: Conquering the holiday office party doesn't just mean keeping track of how much you drink. Seasonal social events can be the best opportunity to network within your company, so you may want to consider veering away from the buffet line. "Whether you're the life of the party or full of social anxiety when it comes to holiday events, it's ... As a future job seeker, from time to time it’s helpful to get advice and feedback rather than acceptance or rejection. How? The informational interview, of course! During an informational interview, you’re able to ask for career, industry and job search advice from a given professional within the field. Such interviews will be useful throughout your career and can even help ... There’s more to student jobs than making money, if you plan it out correctly. While any part-time work can give you an edge, there are some jobs in particular that really boost your hiring potential. If you haven’t done so already, head to the employment office at your college and explore your options. According to U.S. News and World Report, the ... It’s 2009. Do you know where your next job is? Finding a new job is tough these days. New hires are in decline, unemployment is north of 8% so there’s plenty of competition and people who have jobs are making Herculean efforts to hang onto them. And, if you do manage to land a meeting with a potential employer, the contemporary ... 600,000 over three years. 273,000 deemed mission-critical. That's how many people the Partnership for Public Service projects the federal government will need to hire by 2012 to fill growing needs as well as replacing a baby-boomer workforce set to retire. These numbers and other hiring projections are listed just in time for some Labor Day reading in the third edition of ... As a college graduate or soon-to-be college graduate, there’s a bright new world ahead. There’s also a job search that can be somewhat daunting at times. Don’t get discouraged – you have the world at your fingertips! Follow the below suggestions to help your job search stay on the right track: Target your resume. As a general rule, you should never ...

Background ========== Prenylation is a stable lipid modification process involving covalent addition of either farnesyl (15-carbon) or geranylgeranyl (20-carbon) isoprenoids to conserved cysteine residues at or near the C-terminus of proteins \[[@B1]-[@B3]\]. It is believed that about 2% of eukaryotic cell proteins are modified by prenylation \[[@B2]\], which is accomplished by three distinct heterodimeric protein isoprenyltransferases. Protein with the carboxyl-terminal residue of the CaaX motif, where \"a\" refers to the aliphatic residue, is recognized either by farnesyltransferase (FTase) when \"X\" is methionine, glutamine, serine, alanine, or cysteine, or by geranylgeranytransferase type I (GGTase I) when \"X\" is leucine or isoleucine \[[@B1]-[@B3]\]. FTase and GGTase I are cytosolic enzymes utilizing farnesyl pyrophosphate and geranylgeranyl pyrophosphate as the isoprenyl donors, respectively \[[@B1]-[@B3]\]. The third isoprenyltransferase is geranylgeranytransferase type II (GGTase II), which transfers two geranylgeranyl groups from geranylgeranyl diphosphate to the carboxyl terminal cysteine residues of XCCXX, XXCXC, XXCCX, XXXCC, XCXXX or CCXXX motifs \[[@B4]\]. All three enzymes have been found in eukaryotes including protozoans, metazoans, fungi, and plants. In the plant kingdom, these enzymes have been reported in different species such as pea (*Pisum sativum*) \[[@B5],[@B6]\], tomato (*Solanum lycopersicum*) \[[@B7],[@B8]\], and *Arabidopsis thaliana*\[[@B9]-[@B13]\]. In Arabidopsis, FTase and GGTase I share a common α-subunit encoded by a single gene *PLP*(PLURIPETALA) \[[@B12]\], whereas the genes encoding the β-subunit of FTase and GGTase I are *ERA1 (ENHANCED RESPONSE TO ABA1)*\[[@B9],[@B10]\] and *GGB (GERANYLGERANYLTRANSFERASE BETA)*\[[@B11],[@B13]\], respectively. Following prenylation by FTase or GGTase I in cytoplasm, proteins are usually subject to further maturation processing in the endoplasmic reticulum (ER), including cleavage of the \'aaX\' residues by endoproteases and methylation of the newly created carboxyl terminal residue cysteine by isoprenylcycteine methyltransferase (ICMT) \[[@B1]-[@B3]\]. In Arabidopsis, two genes encoding CaaX endoprotease, AtSTE24 (At4 g01320) and AtFACE-2 (At2g36305 or *AtRCE1*), have been identified \[[@B14]-[@B16]\]. Similarly, two ICMT genes, AtSTE14A (At5g23320 or *AtICMTA*) and AtSTE14B (At5g08335 or *AtICMTB*), have also been characterized \[[@B17]-[@B19]\]. Using S-adenosyl-L-methionine as a methyl donor, AtSTE14A and AtSTE14B catalyze the methylation of biologically relevant isoprenylcysteine substrates, i.e. farnesylcysteine and geranylgeranylcysteine, but not geranylcysteine \[[@B17]-[@B19]\]. Biochemically, protein prenylation and subsequent mature processing steps increase its C-terminal hydrophobicity, which facilitate its attachment to membrane and, in some cases, promoting protein-protein interactions \[[@B1]-[@B3]\]. Physiologically, these protein lipid modifications including prenylation and subsequent methylation exert profound effects on diverse processes involving signal transduction and intracellular trafficking pathways \[[@B1]-[@B3]\]. In Arabidopsis, protein isoprenylation and its processing steps are involved in hormone metabolism and signaling, such as cytokinin biosynthesis, abscisic acid (ABA) and auxin signaling, meristem development, innate immunity, and other fundamental processes \[[@B4]\]. As protein function can be modulated by phosphorylation and dephosphorylation, it is believed that methylation of isoprenlated protein can be reversible by isoprenylcysteine methylesterase (ICME), and only this step can be reversible during protein prenylation and processing \[[@B1],[@B2]\]. Indirect evidence showed that those cell membranes that can methylate prenylated protein are also capable of demethylating prenylated amino acids N-acetyl-S-farnesyl-L-cysteine \[[@B20]\]. Recently, Deem et al. \[[@B21]\] identified an ICME coding gene At5g15860 in Arabidopsis. Two related Arabidopsis genes, At1g26120 and At3g02410, were also reported in their study. According to the latest version of TAIR9 (The Arabidopsis Information Resource) released at June 19, 2009, there are two At3g02410 splice variants, 1269 and 1062 bases, encoding two distinct protein products <http://www.arabidopsis.org>. The 1269 base At3g02410.1 transcript is predicted to encode a 422 amino acid polypeptide while the 1062 base At3g02410.2 transcript is predicted to encode a 353 amino acid polypeptide. Proteins encoded by both splice variants are different from the one reported by Deem et al \[[@B21]\] in which At3g02410 was predicted to encode a 373 amino acid with no predicted trans-membrane domain. The At1g26120 and At5g15860 data in TAIR9 is consistent with Deem et al \[[@B21]\], which highlights two At5g15860 splice variants encoding two distinct protein products and one single At1g26120 splice form <http://www.arabidopsis.org>. The ICME activity was reported in Arabidopsis membrane fractions \[[@B21]\], although the precise sub-cellular localization of this protein remains unknown. Overexpressing ICME in Arabidopsis resulted in an ABA hypersensitive phenotype in stomatal closure and seed germination, indicating ICME is a positive regulator of ABA signaling. Furthermore, the expression of this ICME gene can be induced by ABA after 24 hr treatment \[[@B22]\]. Despite these, knowledge about the protein\'s sub-cellular localization and expression patterns remains unavailable. Moreover, studies on this gene in response to other abiotic stresses have not been conducted. In the present study, the ICME and two ICME-like proteins, ICME-LIKE1 and ICME-LIKE2 encoded by respective At1g26120 and At3g02410, were characterized including their sub-cellular localization, tissue-specific expression patterns and responses to different abiotic stresses and ABA. The biological function of ICME-LIKE2 was explored by T-DNA knock out mutant. Results ======= Characterization and clustering analysis of *ICME*gene family in Arabidopsis ---------------------------------------------------------------------------- Since the gene product of At5g15860 was identified as ICME \[[@B21]\], we named the gene products of At1g26120 and At3g02410 as ICME-LIKE1 and ICME-LIKE2, respectively. To confirm the coding sequences deposited in public databases, the open reading frame (ORF) of these genes were obtained by RT-PCR. We successfully determined a 1431 base ORF for At1g26120, a 1269 base and a 1284 base ORFs for respective At3g02410 and At5g15860. The amplified PCR products were cloned into pGEMT-easy vector and sequenced. Sequencing results showed the ORF sequences of three genes are the same as those released by TAIR9. For At3g02410 and At5g15860, the two ORF sequences corresponded to At3g02410.1 <http://www.arabidopsis.org> and At5g15860.1 \[[@B21]\], the longer variants of the two genes. For this reason, in this study, we only focused our interests on the longer splice variants for both At3g02410 and At5g15860. The amino acid sequences were derived from these ORFs and multiple amino acid sequence alignment of the three proteins was performed using Clustal W2 program <http://www.ebi.ac.uk/Tools/es/cgi-bin/clustalw2>. Results revealed that these three proteins were highly similar: ICME-LIKE1 shared 59% and 61% amino acid identity with ICME-LIKE2 and ICME, respectively, while ICME-LIKE2 and ICME had 76% identity (figure [1A](#F1){ref-type="fig"}). PROSITE software analysis <http://www.expasy.ch/prosite> showed that all proteins contained a highly conserved catalytic triad: a serine, an aspartate and a histidine (figure [1A](#F1){ref-type="fig"}, indicated by \#) as well as substrate binding pocket domains, GGA and QSA (figure [1A](#F1){ref-type="fig"}, indicated by red boxes). Conserved domain search <http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi> showed that all three proteins belong to the esterase lipase superfamily (figure [1B](#F1){ref-type="fig"}), while ICME-LIKE2 and ICME contain carboxylesterases type-B serine active site with perfect pattern: F-\[GR\]-G-x (4)-\[LIVM\]-x-\[LIV\]-x-G-x-S-\[STAG\]-G <http://www.expasy.ch/prosite>. {#F1} Using these three proteins as search query, similar proteins with more than 50% identity from plant kingdom were retrieved from NCBI through Blastp \[[@B23]\] for the purpose of evaluating the evolutionary relationship among these proteins. Phylogenetic tree were constructed using several tree building programs, including Neighbor Joining (NJ), Minimum Evolution (ME) and Maximum Parsimony (MP), which are available at the MEGA4 website <http://www.megasoftware.net>. Clustering analysis showed that different methods yielded similar clustering patterns. The results obtained with NJ method were presented (figure [1C](#F1){ref-type="fig"}) and results obtained with ME and MP methods can be found in additional files [1](#S1){ref-type="supplementary-material"} and [2](#S2){ref-type="supplementary-material"}, respectively. Results showed that the ICME and two ICME-like proteins together with similar proteins, NP \_001132117 from *Zea mays*, BAF18320 and BAF20445 from *Oryza sativa*, CAO42055 from *Vitis vinifera*, and ABD96862 from *Cleome spinose*, could be classified into one group with 100% bootstrap support. The group is divergent from two other groups, including the previously reported 20 Arabidopsis Carboxylesterases (AtCXE) \[[@B24]\] and those that function as a suppressor of AvrBst-elicited resistance in Arabidopsis \[[@B25]\]. The analysis demonstrated that the ICME genes in Arabidopsis belong to a small gene family. ICMEs of Arabidopsis are targeted to ER and Golgi apparatus ----------------------------------------------------------- Trans-membrane domain was predicted using several online programs listed in Table [1](#T1){ref-type="table"}. ###### Programs used to predict trans-membrane domain of ICMEs of *Arabidopsis* ------------------------------------------------------------------------------------------------------------------------------------ *Programs and their websites* *Proteins* *No. of transmembrane domains* --------------------------------------------------------- ------------ ------------------------------------------------------------- DAS\ ICME-LIKE1 6 (loosing cutoff 1.7 ); 2 (strict cutoff 2.2) <http://www.sbc.su.se/~miklos/DAS/> ICME-LIKE2 4 (loosing cutoff 1.7 ); 4 (strict cutoff 2.2) ICME 4 (loosing cutoff 1.7 ); 2 (strict cutoff 2.2) HMMTOP\ ICME-LIKE1 2 (N-terminus: OUT) <http://www.enzim.hu/hmmtop/html/submit.html> ICME-LIKE2 4 (N-terminus: IN) ICME 4 (N-terminus: IN) SOSUI\ ICME-LIKE1 2 <http://bp.nuap.nagoya-u.ac.jp/sosui/sosui_submit.html> ICME-LIKE2 2 ICME NO TMpred\ ICME-LIKE1 4 (Inside to outside helices);5 (Outside to inside helices) <http://www.ch.embnet.org/software/TMPRED_form.html> ICME-LIKE2 5 (Inside to outside helices);5 (Outside to inside helices) ICME 5 (Inside to outside helices);7 (Outside to inside helices) TMHHM\ ICME-LIKE1 1 (N-terminus: IN) <http://www.cbs.dtu.dk/services/TMHMM-2.0/> ICME-LIKE2 1 (N-terminus: IN) ICME 1 (N-terminus: IN) ------------------------------------------------------------------------------------------------------------------------------------ As a result, except for SOSUI program that predicted ICME as a soluble protein, all other programs predicted that the three proteins all contain at least one trans-membrane domain (Table [1](#T1){ref-type="table"}). To provide experimental evidence of the sub-cellular localization of ICME and its homologs, a transient expression of GFP-fused ICME and its homologs into onion epidermal cells and *N. benthamiana* protoplasts that isolated from suspension cultured cells, was performed. Similar sub-cellular localization patterns of the ICME family were obtained in these two systems (the protoplast system results are presented in figure [2](#F2){ref-type="fig"} and the onion system results can be found in additional file [3](#S3){ref-type="supplementary-material"}). As shown in figures [2A](#F2){ref-type="fig"} and [2B](#F2){ref-type="fig"}, when co-expressing the free GFP gene with the ER or Golgi marker genes, the GFP fluorescence was spread throughout the cell (excluding vacuolar) with stronger signals in the nucleus (figures [2A](#F2){ref-type="fig"} and [2B](#F2){ref-type="fig"}, GFP channel), which was partially overlapped with the DesRed fluorescence emitted by the ER marker BiP-RFP (figure [2A](#F2){ref-type="fig"}, merged channel) and Golgi marker ST-mRFP (figure [2B](#F2){ref-type="fig"}, merged channel). When co-expressing the GFP fused ICME-LIKE1 with the ER and Golgi markers in protoplasts, besides small green punctates, the GFP fluorescence was predominantly restricted in the ER and Golgi apparatus, which was confirmed by co-localizing with the ER marker BiP-RFP (figure [2C](#F2){ref-type="fig"}, merged channel) and the Golgi marker ST-mRFP (figure [2D](#F2){ref-type="fig"}, merged channel). ICME-LIKE2 showed as an ER-resident protein (figure [2E](#F2){ref-type="fig"}) with partially localizing in the Golgi apparatus (figure [2F](#F2){ref-type="fig"}). Some fluorescent vesicles were observed surrounding the Golgi apparatus after GFP was fused to ICME-LIKE2 in some protoplasts (figure [2F](#F2){ref-type="fig"}, GFP channel). Similarly, ICME was predominantly localized in the ER and Golgi apparatus (figures [2G](#F2){ref-type="fig"} and [2H](#F2){ref-type="fig"}). {#F2} When the trans-membrane domain of the ICME family was predicted by using TMHHM program, both ICME and its homologs were found to contain one trans-membrane domain (Table [1](#T1){ref-type="table"}). For ICME, amino acids 102 to 124 were predicted as a trans-membrane helix. When this region was deleted and the mutant was fused to GFP followed by expression in protoplasts, the GFP fluorescence was still limited in ER and Golgi apparatus, which was confirmed by co-localizing with the ER and Golgi apparatus makers (figures [2I](#F2){ref-type="fig"} and [2J](#F2){ref-type="fig"}). Tissue-specific expression patterns of ICME gene family ------------------------------------------------------- To examine the tissue-specific expression of *ICME*and its homologs, total RNA was extracted from different tissues including roots, rosette leaves, cauline leaves, stems, flowers, and siliques of 4-5 weeks old plants, followed by further treatment with DNase to remove the possible trace genomic DNA. One microgram of DNA-free RNA was converted into cDNA and semi-quantitative RT-PCR or real-time quantitative RT-PCR (qPCR) was performed. Both semi-quantitative RT-PCR (figure [3A](#F3){ref-type="fig"}) and qPCR (figure [3B](#F3){ref-type="fig"}) results showed that all ICME genes are constitutively expressed in all examined tissues with differentiated expression levels (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). The steady-state messenger RNA (mRNA) level of *ICME*was low in the stems but high in the reproductive organs including flowers and siliques (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). For *ICME-LIKE1*, it showed the highest mRNA level in the leaves but the lowest in the stems (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). Overall, transcript abundance of the *ICME-LIKE2*gene was quite low; the mRNA level of *ICME-LIKE2*was much lower than that of *ICME*and *ICME-LIKE1*in all tested tissues (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}), which was hardly detectable, especially in the vegetative organs including roots, leaves and stems, with semi-quantitative RT-PCR of less PCR cycles (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). {#F3} Expression profiles of ICME gene family in response to abiotic stresses and ABA ------------------------------------------------------------------------------- Time-course expression profiles of the ICME gene family in response to different abiotic stresses including cold (4°C), heat (37°C), drought (dehydration), mannitol (400 mM), NaCl (200 mM), and ABA (50 μM) were determined using qPCR. Overall, cold treatment resulted in no significant expression change of the *ICME*family (figure [4A](#F4){ref-type="fig"}). The *ICME-LIKE1*expression was slightly up-regulated by cold treatment after 60 min. In contrast, the expression of *ICME-LIKE2*gene was slightly down-regulated by cold treatment after 15 min and recovered to the pre-treatment level after 60 min. Similar to the *ICME-LIKE2*gene, under cold treatment, the *ICME*gene was slightly down-regulated quickly and then up-regulated. {#F4} In contrast to the response to the cold treatment, the expression of the *ICME-LIKE1*gene was down-regulated during heat treatment (figure [4B](#F4){ref-type="fig"}), which could be applied to the *ICME-LIKE2*gene (figure [4B](#F4){ref-type="fig"}). However, upon heat treatment, transcript of *ICME*showed a quick and transient increase. After 60 min of heat treatment, the *ICME*expression reached the maximum (figure [4B](#F4){ref-type="fig"}). At 120 min of heat treatment, the *ICME*expression was recovered to near the pre-treatment levels. From the expression profile, it is obvious that *ICME*is a quick and early response gene during heat stress, indicating that ICME may play an important role in the response of plants to heat stress. When suffered from drought stress, both *ICME*and its homologs exhibited similar responses. Overall, the transcript abundance of these genes was not changed significantly except that at 15 min and 120 min of drought stress. The transcripts of *ICME-LIKE1*and *ICME-LIKE2*decreased at 15 min of treatment; whereas the transcripts of *ICME*and *ICME-LIKE2*increased at 120 min after treatment (figure [4C](#F4){ref-type="fig"}). As shown in figure [4D](#F4){ref-type="fig"}, in general, both *ICME*and its homologs were elevated by osmotic stress induced by mannitol treatment with differential levels of increase. Among them, the *ICME*gene showed the most pronounced up-regulation. At 12 hr of treatment, the expression of ICME reached the maximum with its transcript abundance being at least 10 times of that of the pre-treatment. At 3 hr of treatment, the expression of *ICME-LIKE1*was maximally induced and this induction was lasted for 21 hrs. The *ICME-LIKE2*gene was induced at 3 hr of treatment and was maximally induced at 12 hr of treatment. Upon NaCl treatment, the expression profile of *ICME*and its homologs was similar to that in response to mannitol treatment. As shown in figure [4E](#F4){ref-type="fig"}, both *ICME*and its homologs were up-regulated by NaCl treatment, with *ICME*showing the strongest up-regulation. Moreover, the transcript of *ICME*increased quickly. The expression of *ICME*started increase at 1 hr of treatment and reached the maximum at 3 hr. Similarly, after 3 hr treatment, the expression of *ICME-LIKE1*was maximally induced and this induction was lasted until 24 hr of treatment. In contrast, *ICME-LIKE2*was induced at 3 hr of treatment and the expression reached the maximum at 12 hr of treatment. As shown in figure [4F](#F4){ref-type="fig"}, the expression of both *ICME*and its homologs was increased in response to ABA. Among them, *ICME*and *ICME-LIKE2*showed the most and the least pronounced up-regulation by ABA, respectively. Interestingly, transcript abundance of *ICME-LIKE2*fluctuated during the course of ABA treatment, i.e, the transcript increased at 3 hr and backed to the pre-treatment level at 6 hr and then increased again at 24 hr after treatment. In contrast, the transcript of *ICME*showed a regular pattern; it increased at 3 hr and reached the maximum at 24 hr of ABA treatment. Identification of T-DNA insertion lines --------------------------------------- To explore the biological functions of the ICME family, T-DNA insertion mutant lines were obtained from the Arabidopsis Biological Resource Center (ABRC, Ohio State University, Columbus). For each gene, two different T-DNA insertion lines were analyzed. A homozygous T-DNA insertion line, SALK_008773, with a T-DNA inserted at the 3\' UTR of *ICME-LIKE1*was identified by genomic DNA PCR and sequencing. However, this insertion neither disrupts the expression nor causes down-expression of *ICME-LIKE1*. Another line, SALK_011036 (putatively with a T-DNA inserted at the 5^th^intron according to ABRC), was identified without any insertions at *ICME-LIKE1*, although the seeds could grow on Kanamycin containing MS medium and the transcript of Neomycin Phosphotransferase gene was also amplified by RT-PCR from total RNA extracted from this line. These results suggested that this line is a T-DNA insertion line with the T-DNA inserted at other unknown position. In contrast, the homozygous T-DNA insertion lines, SALK_043448 (called *icme-like2-1*here) and SALK_002648 (called *icme-like2-2*here) with a T-DNA inserted at the 8^th^and 10^th^intron of *ICME-LIKE2*, respectively, were identified by genomic DNA PCR and sequencing (additional file [4](#S4){ref-type="supplementary-material"}). The expression of *ICME-LIKE2*was disrupted by both insertions (figure [5](#F5){ref-type="fig"}). Similarly, the homozygous T-DNA insertion lines, SALK_010304 (also called *icme-1*\[[@B22]\]) and SALK_075701 (called *icme-2*here) with a T-DNA inserted at the 1^st^intron and 11^th^exon of *ICME*, respectively, were identified by genomic DNA PCR and sequencing (additional file [5](#S5){ref-type="supplementary-material"}). Gene expression analysis showed that no transcripts (full-length ORF) of *ICME*were detected in the two homozygous mutants (figure [5](#F5){ref-type="fig"}). {#F5} Overall, *icme-like2-1, icme-like2-2, icme-1 and icme-2*mutants are not distinguishable from wild-type plants in appearance under normal growth conditions (additional file [6](#S6){ref-type="supplementary-material"}). Moreover, all of them exhibited similar responses when subjected to drought and salt stresses. Disruption of ICME-LIKE2 expression leads to increased sensitivity to ABA but slightly decreased to salt and osmotic stresses in seed germination ------------------------------------------------------------------------------------------------------------------------------------------------- Seed germination of the wild type and *icme-like2*mutants in response to ABA, salt and osmotic stresses was examined. Both *icme-like2-1*and *icme-like2-2*showed similar responses to the treatments. As shown in figure [6](#F6){ref-type="fig"}, in the absence of ABA, no differences of germination were observed between wild type and *icme-like2-1*mutant. By contrast, disruption of *ICME-LIKE2*expression leads to an increased sensitivity to ABA in seed germination, and the ABA-sensitive phenotype was apparent at all concentrations of ABA tested. On the other hand, the wild-type and the *ICME-LIKE2*mutant showed no significant differences of cotyledon greening and seedling root growth (data not shown). In addition, in the low concentration of exogenous ABA, the difference was only observed in a short span during the early time of seed germination; whereas the differences were lasted for a much longer time in the high concentrations of ABA. {#F6} In contrast to respond to ABA, overall, the *icme-like2-1*mutant showed slightly decreased sensitivity to salt (figure [7](#F7){ref-type="fig"}) and osmotic (figure [8](#F8){ref-type="fig"}) stresses in seed germination compared to the wild type. But these differences are significant only under specific concentration and stage (labeled as \* in figures [7](#F7){ref-type="fig"} and [8](#F8){ref-type="fig"}), suggesting that ICME-LIKE2 exerts its role in specific conditions and developmental stage in response to environmental stimuli. Similarly, the wild-type and the *ICME-LIKE2*mutants showed no significant differences of cotyledon greening and seedling root growth in response to these stresses. {#F7} {#F8} Discussion ========== ICME is involved in the process of demethylating the prenylated proteins in eukaryotic cells. An ICME was recently reported in Arabidopsis and its related gene was isolated \[[@B21]\]. Membranes isolated from *S. cerevisiae*cells expressing the *ICME*gene contain specific enzyme activity for relevant prenylcysteine methylesters \[[@B21]\]. Overexpression of ICME resulted in an ABA hypersensitive phenotype in stomatal closure and seed germination \[[@B22]\]. Moreover, this gene was up-regulated by ABA in Arabidopsis seedlings \[[@B22]\]. These results indicate that the demethylation of prenylated proteins is involved in at least some aspects, if not all, of ABA responses and ICME is a positive regulator of ABA signaling. Structurally, both ICME and its homologs in this study belong to the esterase lipase superfamily containing two highly conserved regions: (1) the GXSXG motif containing the Ser nucleophile (figure [1A](#F1){ref-type="fig"}); and (2) the conserved catalytic triad possessing the nucleophile-acid-His-ordered sequence (Ser, Asp, and His) (figure [1A](#F1){ref-type="fig"}). Initially, we identified ICME as an acetylcholinesterase (AChE)-like protein with the attempt to clone the gene encoding AChE-like protein in *Planta*since the AChE-like activity was detected in maize seedlings \[[@B26]\]. Until now, it is still unclear whether ICME and its two homologs, ICME-LIKE1 and ICME-LIKE2, possess enzyme activity to hydrolyze acetylthiocholine. In 2005, an AChE (NP_001105800) with 394 amino acids in length from maize seedlings was identified and the related gene was cloned \[[@B27]\]. This AChE contains the same conserved catalytic core as in the animal AChE, possessing the enzyme activity of hydrolyzing acetylthiocholine and propyonylthiocholine, but not S-butyrylthiocholine. Moreover, its enzyme activity was totally inhibited by neostigmine bromide, a specific inhibitor of animal AChE \[[@B27]\]. However, the amino acid sequence of this AChE showed no apparent similarity with that of the animal enzyme. Based on these, the authors proposed that this AChE family is a novel family of enzymes in plant kingdom. Amino acid sequence alignment showed ICME and its homologs were exhibited very lower similarity with that of the maize AChE (Data not shown), suggesting that ICME and its homologs are not AChE-like proteins. In 2003, twenty carboxylesterases in Arabidopsis (AtCXE) were systemically mined from Arabidopsis genome, and the expression profile across a range of tissues was detected by RT-PCR \[[@B24]\]. One of AtCXEs, AtCXE12, was reported to possess enzyme activity for hydrolyzing the pro-herbicide methyl-2,4-dichlorophenoxyacetate to the phytotoxic acid 2,4-dichlorophenoxyacetic acid \[[@B28]\]. It remains unknown whether ICME and its homologs have such enzyme activity to hydrolyze pro-herbicide methyl-2,4-dichlorophenoxyacetate. Although all the 20 AtCXEs contains the conserved catalytic triad, amino acid sequence alignment showed that ICME and its homologs are divergent from those AtCXEs. Moreover, none of AtCXEs is larger than 400 amino acids in length but ICME and its homologs are larger than 400 amino acids in length. In addition, ICME and its homologs are lack of the conserved sequence surrounding the motif known as the oxyanion hole in AtCXEs. Phylogenetic analysis further showed that ICME and its homologs and AtCXEs are clustered into different groups, respectively (figure [1C](#F1){ref-type="fig"}). These indicate that ICME and its homologs may not possess the enzyme activity of AtCXEs. In 2007, another carboxylesterase, SOBER1 (At4g22300), was identified as suppressors of AvrBsT-elicited resistance in Arabidopsis \[[@B25]\]. SOBER1 and its homologs are also clustered into an independent group (figure [1C](#F1){ref-type="fig"}). Enzymes in this group are smaller than that of AtCXEs and ICME and its homologs are less than 300 amino acids in length. Besides the conserved catalytic triad, enzymes in this group contain another unique \"LHGLGD\" motif in the N-terminal region that is not present in the ICME and its homologs. In summary, bioinformatic analysis in this study and previous biochemical evidence \[[@B21]\] suggest that ICME and its homologs may comprise a novel small subfamily of carboxylesterase in plant kingdom, possibly with the prenylated protein as its specific substrate. Given the high degree of similarity among ICME, ICME-LIKE1, and ICME-LIKE2 in terms of sequence and subcellular localization (figure [2](#F2){ref-type="fig"} and additional file [3](#S3){ref-type="supplementary-material"}), it is reasonable to predict that ICME-LIKE1 and ICME-LIKE2 possess ICME activity. Direct biochemical evidence of ICME activity of the ICME-like proteins is necessary for better understanding their functions in plants in the future. Documented data suggested that protein prenylation and subsequent mature processing steps promote its attachment to membrane and, in some cases, protein-protein interaction by increasing its C-terminal hydrophobicity \[[@B1]-[@B3]\]. In other words, with high possibility, a maturely prenylated protein is a membrane protein or is associated with the membrane system. ICME is involved in demthylation of the prenylated proteins, the only reversible process during protein prenylation modification. These suggest that ICME is likely a membrane-resident protein. Previous biochemical analysis also showed that enzyme activity of ICME was detected in membrane fragment \[[@B20],[@B21]\]. In the current study, more precise sub-cellular localizations of ICME family were provided using GFP tagged proteins. Initially, we fused all ICME and its homologs in frame to the N-terminus of GFP. Except for ICME, we failed to detect any fluorescent signal for GFP tagged ICME-LIKE1 and ICME-LIKE2, suggesting that N-terminus fused GFP may be unstable. We then fused these two proteins to the C-terminus of GFP and successfully detected the fluorescence. The fluorescent signals clearly revealed that proteins of the ICME family are intramembrane proteins predominantly localizing at the ER and Golgi apparatus, which was confirmed by co-expression of ER and Golgi markers, BiP-RFP and ST-mRFP, respectively (figure [2](#F2){ref-type="fig"} and additional file [3](#S3){ref-type="supplementary-material"}). These results also suggest that many prenylated proteins, at least those that being in the processes of demthylation, are targeted to ER and Golgi apparatus. Subcellular proteomics of ER and Golgi apparatus may provide more information about protein prenylation and its mature process, which will be helpful to explore the biological functions of protein prenylation. When transiently expressing GFP-ICME-LIKE2, some green vesicles surrounding the Golgi apparatus were observed in some protoplasts (figure [2](#F2){ref-type="fig"}). At present, the significance of these vesicles is unclear. We speculated that (1) these vesicles were secreted from ER and being sorted to the Golgi apparatus for its post-translational modifications. Motif scanning showed that ICME-LIKE2 could be modified by glycosylation (at the 47^th^and 213^th^amino acids Asn) and other potential manners <http://myhits.isb-sib.ch/cgi-bin/motif_scan>; (2) these vesicles modified in the Golgi apparatus were being sorted to its final target, ER. Further cell biology experiments, especially pharmacogenetic analysis, are needed to reveal the mechanisms underlying these vesicles. Contrary results were obtained in predicting the trans-membrane domain of ICME by using different programs (Table [2](#T2){ref-type="table"}). Zero and five transmembrane domains were predicted for ICME with SOSUI and TMpred programs, respectively. Deleting the putative transmembrane helix, amino acids 102^nd^to 124^th^, did not block its ER-targeting. It can be concluded from this that ICME is an intramembrane protein containing at least two transmembrane domains and predominantly localizing in the ER and Golgi apparatus. ###### Primers used in this study *Name* *Sequence (5\' to 3\')* *Use* ------------ ------------------------------------------ ------------------------------ 1gRTF GCACCATTGTAGAGCAGGTCA Semi-quantitative 1gRTR ACCAATCGCTTCTTGATCGTC RT- PCR 3gRTF TACATACCGCCAACGAGTGAT Semi-quantitative 3gRTR GCTACAAGAACCGTATCGAAG RT- PCR 5gRTF TCAAAGCAAGTCCGGAGGAGT Semi-quantitative 5gRTR TTTGGTCAGCCCATCATTGTC RT- PCR TuRTF AGAACACTGTTGTAAGGCTCAAC Semi-quantitative TuRTR GAGCTTTACTGCCTCGAACATGG RT- PCR 5gNcoI F CGGCCATGGAAATGCATTCGCCTCTTCAGACTCA pICME-GFP construction 5gNcoI R TTGCCATGGCGAAAGGGCTAATCTCACGAG 1gBglII F GCCAGATCTATGCCGTCGCAGATTCTCCAAAT pGFP-ICME-LIKE1 construction 1gSpeI R GTGACTAGTTAGAACGGACTGACCCAGTGAGCCAACTT 3gBglII F GTCTAGATCTATGCAGTTGTCTCCGGAACG pGFP-ICME-LIKE2 construction 3gSpeI R TTAACTAGTCAAAAAGGGCTGACCCTGCCAGCCAGTT 5gΔTM F1 GAAATGCATTCGCCTCTTCAG pICMEΔTM-GFP construction 5gΔTM R1 CGGACTTGCTTTGAGAAAAATTTTGTCATCCATCGATAGC 5gΔTM F2 GCTATCGATGGATGACAAAATTTTTCTCAAAGCAAGTCCG 5gΔTM R2 AAGGCATGCTACAATGATATC 1gqRTF CTCACATCATCTTCCACCTAAATC Real-time quantitative 1gqRTR AAATCGAGAGAGAAGGGTCGT PCR 3gqRTF CCGATGTCTGAAAACAGAGAGG Real-time quantitative 3gqRTR CCGGTGAAGATAATCTGTTGG PCR 5gqRTF AGGATCCCTTACGAGGAGGT Real-time quantitative 5gqRTR AGCCAACGAGTCTTTGGTCAG PCR TuqRTF GTGCTGAAGGTGGAGACGAT Real-time quantitative TuqRTR AACACGAAGACCGAACGAAT PCR Actin8qRTF TTACCCGACGGACAAGTGATC Real-time quantitative Actin8qRTR ATGATGGCTGGAAAAGGACTTC PCR P2 `tcacttccataatcggggtctg` T-DNA screening LBa1 `TggTTCACgTAgTgggCCATCg` T-DNA screening So far, the molecular information about the *ICME*family is unavailable except that the expression of *ICME*was up-regulated in Arabidopsis seedlings by ABA after 24 hrs. There is also a lack of information about the expression profiles for *ICME-LIKE1*and *ICME-LIKE2*in the public database. Study here showed that the members of the *ICME*family are expressed across a range of tissues with differential expression level (figure [3](#F3){ref-type="fig"}), indicating that ICME and its homologs may have broad functions in Arabidopsis. On the other hand, this also suggests the existence of functional redundancy among the ICME family. The base transcript of *ICME-LIKE2*is quite low, indicating it is a low abundance gene. The low detection sensitive of northern blotting may explain why there is no public microarray data available. It is also possible that the expression of *ICME-LIKE2*is indistinguishable from *ICME*due to their high similarity, leading to lack of expression information on *ICME-LIKE2*in the public microarray data. Lacking of the expression information on *ICME-LIKE1*in the public microarray data is unexpected since its base transcript abundance is similar to that of *ICME*(figure [3](#F3){ref-type="fig"}). Moreover, the transcript increased in response to cold, salt, osmotic stresses and ABA treatment (figure4). The most possible explanation for this is that the expression of *ICME-LIKE1*is indistinguishable from *ICME*because of their high similarity. By time-course assays, study here not only confirmed the previous data that *ICME*was up-regulated by ABA treatment after 24 hr \[[@B22]\], but also provided that *ICME*is also a stress-regulated gene, which is consistent with the public micoarray data <https://www.genevestigator.com/gv/directlink.jsp?geneIDs=AT5G15860>. In addition, *ICME* was dramatically up-regulated by other abiotic stresses, including heat, mannitol, and salt treatment, suggesting that ICME might be involved in stress response. Indeed, prenylated proteins have been implicated in the processes in response to heat stress \[[@B29]\]. Although study here showed that disruption the expression of ICME (figure [5](#F5){ref-type="fig"}) caused no different phenotypes between wild type and mutant plants under normal and drought and salt stress conditions (additional file [6](#S6){ref-type="supplementary-material"} and data not shown), whether the ICME activity is required for tolerating heat stress is to be confirmed with *icme*mutants, *icme*and *icme-like2*double mutants and transgenic plants bearing over-expression of ICME. By now, the biological functions of the ICME family are largely unclear; the only confirmed function is that the over-expression of ICME caused an ABA hypersensitive phenotype in stomatal closure and seed germination while *icme-1*mutant exhibited an ABA insensitive phenotype \[[@B22]\]. This is different from our data using ICME-LIKE2 mutants. Knocking out the expression of ICME-LIKE2 resulted in increased sensitivity to ABA in seed germination (figure [6](#F6){ref-type="fig"}). These suggest that ICME and ICME-LIKE2 may have different roles in seed germination in response to ABA. However, except that the disruption of *ICME-LIKE2*expression leads to increased sensitivity to ABA and slightly decreased to salt and osmotic stresses in seed germination, no significant differences were observed between wild type and mutant plants in terms of other physiological functions tested. Similarly, no significant differences were observed between wild type and ICME mutants in other biological process in previous study \[[@B22]\], which has been confirmed in the current study (additional file [6](#S6){ref-type="supplementary-material"}). This may be due to the existence of functional redundancy among the ICME family. Firstly, the expression of the ICME family is universal; secondly, the sub-cellular localizations of the ICME family are similar; thirdly, the expression patterns of the ICME family in response to abiotic stresses and ABA is similar; and finally, the members of the ICME family share high identity in amino acid and contain the conserved functional domain. The biological process of ICME-LIKE2 is worth further detailed study. Some important facts about ICME-LIKE2 include (1) it is a low abundance gene (figures [3](#F3){ref-type="fig"} and [4](#F4){ref-type="fig"}); (2) its transcript abundance is induced by abiotic stresses and ABA (figure [4](#F4){ref-type="fig"}); (3) it forms some vesicles around ER (figure [2](#F2){ref-type="fig"}); and (4) null mutants of ICME-LIKE2 are available (figure [5](#F5){ref-type="fig"}). Based on these, it can be predicted that ICME-LIKE1 and ICME-LIKE2 are involved in ABA signaling and may also be involved in other stress responses. To better understand the biological functions of the ICME family, future works will be to identify null or knock-down mutant of *icme-like1*and construct double and triple mutants of the ICME family. Conclusions =========== In this paper, the extended characterizations, sub-cellular localizations, expression profiles across different tissues and in response to abiotic stress and ABA of ICME and its homologs as well as their physiological functions are reported. These studies confirmed that there is a small ICME family with specific structural characterizations in Arabidopsis. All members of the family have similar sub-cellular localizations predominantly localizing at the ER and Golgi apparatus. The genes of the *ICME*family are expressed across a broad range of tissues. Upon stress stimuli and ABA treatment, most of the expressions of the *IMCE*family are up-regulated. Single mutants of icme and icme-like2 do not show significant effects in plant growth, development and responses to environmental stimuli. However, disruption of the *ICME-LIKE2*expression leads to increased sensitivity to ABA and slightly decreased sensitivity to salt and osmotic stresses in seed germination. Double and triple mutants of the *ICME*family may be better option to explore their functions in future. The ABA and abiotic stress regulated genes reported here are potentially useful resources for transgenic crops against drought and other stresses. Methods ======= Plant growth and treatments --------------------------- Arabidopsis thaliana ecotype Columbia was used throughout the current study. Mutant seeds *icme-like1-1*(SALK_008773), *icme-like1-2*(SALK_011036), *icme-like2-1*(SALK_043448), *icme-like2-2*(SALK_002648), *icme-1*(SALK_010304), and *icme -2*(SALK_075701) were obtained from the Arabidopsis Biological Resource Center (ABRC, Ohio State University, Columbus). Seeds were surface-sterilized and sown on solid agar plates containing 1× Murashige and Skoog (MS) salts, 1% (w/v) sucrose, 0.8% agar adjusted to pH5.7. After stratified at 4°C for 3 days, they were transferred to a growth chamber at 22°C under a 16-h light/8-h dark photoperiod at 130 μEm^-2^sec^-1^. Seven-day-old seedlings were used for different treatments: for salt, osmotic, and ABA treatment, seedlings sowed on filters (which were put on 1× MS agar media) were transferred to MS liquid media containing 200 mM NaCl, 400 mM mannitol, or 50 μM ABA for different time indicated. For cold and heat treatments, the plates were transferred to 4°C freezer or 37°C growth chamber. For dehydration test, seedlings were transferred to Petri dish covers and left at growth chamber for different length of times. After treatment, seedlings were collected in liquid nitrogen and stored at -80°C for RNA extraction. Verification of the T-DNA insertion mutants ------------------------------------------- Homozygous mutant was identified by PCR from genomic DNA using gene-specific primers (Table [2](#T2){ref-type="table"}) and T-DNA left border primers LBa1, and analyzed further by DNA sequencing to confirm the insertion of the T-DNA in the gene. Plasmid construction -------------------- ORFs encoding the full-length ICME-LIKE1, ICME-LIKE2, and ICME were amplified by PCR with the specific primer pairs listed in Table [1](#T1){ref-type="table"}. The PCR products were inserted in-frame to the C-terminus (for ICME-LIKE1 and ICME-LIKE2) or N-terminus (for ICME) of the GFP gene in plasmid pAVA121 \[[@B30]\]. This plasmid encodes an enhanced free GFP under the guide of 35 S promoter of *Cauliflower mosaic virus*and the NOS terminator, designated as pGFP here. The PCR products of ICME-LIKE1 and ICME-LIKE2 amplified with primer pairs 1gBglII F/1gSpeI R and 3gBglII F/3gSpeI R, respectively, were digested with BglII and SpeI and ligated to pGFP digested with BglII and XbaI to create pGFP-ICME-LIKE1 and pGFP-ICME-LIKE2, respectively. Similarly, PCR product of ICME from primer pair 5gNcoI F/5gNcoI R was digested with NcoI and inserted to pGFP, which was predigested with NcoI and followed by further dephosphorylation with shrimp alkaline phosphatase (Promega, USA). Constructs with correct orientation were selected by restriction assays and designated as pICME-GFP. Based on pICME-GFP, the putative transmembrane domain (TM), amino acids 102 to 124, was deleted to create plasmid pICMEΔTM-GFP by overlapping PCR. Briefly, the first fragment was generated with primer pair 5gΔTMF1/5gΔTMR1; while the second fragment was synthesized with primer pair 5gΔTMF2/5gΔTMR2 (primer 5gΔTMF2 is complementary exactly to the primer 5gΔTMR1 in nucleotide sequence). Next, overlapping PCR was performed with primer pair 5gΔTMF1/5gΔTMR2 using the mixture of the first and the second fragments as the PCR template. Following deletion, the final PCR product was digested with NsiI and NheI and subcloned into pICME-GFP digested with the same set of restriction enzymes to replace the corresponding fragment of wild type cDNA. All the final constructs were verified by DNA sequencing. Protoplast isolation, transformation, and Confocal Microscopy ------------------------------------------------------------- Protoplasts of N. benthamiana were isolated from suspension cell lines and co-transformed with plasmids bearing free GFP or GFP tagged ICME or its homologs and plasmids BiP-RFP or ST-mRFP \[[@B31]\], which are widely used as the ER and Golgi apparatus markers, respectively) as described earlier \[[@B32]\]. Confocal microscope images were taken using a confocal laser microscope MRC1024 under a ×63 water objective. DesRed images were captured in the 560- to 615-nm range after excitation at 543 nm with a HeNe laser beam. The GFP images were captured in the 505- to 530-nm range after excitation at 488 nm with an argon laser beam. Particle bombardment -------------------- Onion epidermal cells were co-bombarded with 2.5 μg of plasmids bearing free GFP, GFP tagged ICME or its homologs and plasmids BiP-RFP or ST-mRFP \[[@B30]\]. All the plasmids were coated onto 1-μm gold particles and delivered into onion epidermal cells at a pressure of 900 psi by PDS 1000/He particle delivery system (BioRad, U.S.A). After bombardment, onion slices of 2 × 2 cm were placed on a plate containing 1× MS salts, 30 g/L of sucrose, 1.5% agar, pH = 5.7. After at least 24 hr, the epidermis was removed from the onion slice and observed using a Confocal Laser Scanning Microscope. Total RNA isolation, Semi-Quantitative RT-PCR and Real-Time Quantitative RT-PCR ------------------------------------------------------------------------------- Total RNA was isolated from a broad range of tissues of 4-5 weeks old plants and seedlings of various treatments using RNeasy Mini Kit (QIAGEN) and further treated with DNase using the TURBO DNA-free Kit (Ambion) according to the manufacturer\'s manual. About 800 ng DNA-free total RNA was converted to cDNA using Oligo-dT (20) primer and Superscript II reverse transcriptase (Invitrogen) according to the manufacturer. Briefly, after incubation at 50°C for 1 h followed by 85°C for 5 min, 1 μl of RNase H was added and incubated for 20 min at 37°C. The cDNA was used as a PCR template for both Semi-Quantitative RT-PCR and Real-Time Quantitative RT-PCR. For Semi-Quantitative RT-PCR, β-tubulin was used as an internal control. Different PCR cycles (28, 30, and 35) were used for β-tubulin amplification to calculate the cDNA amount for gene-specific amplification. A total of 30 or 35 PCR cycles were used for ICMEs amplification. The PCR program used was as follows: pre-soaking in 94°C for 5 min, followed by different cycles of 94°C for 30 sec, 58°C for 30 sec and 72°C for 45 sec. A final incubation at 72°C for 7 min was included to complete product synthesis. PCR products were separated on a 1% agarose gel stained with ethidium bromide. For Real-Time Quantitative RT-PCR, PCR amplification was performed in a 20 μl reaction system using SYBR Green PCR Master Mix (Applied Biosystems) with programs recommended by the manufacturer (2 min at 50°C, 10 min at 95°C and 40 cycles of 95°C for 15 sec and 60°C for 1 min). Three independent replicates were performed for each sample. The comparative CT method was used to determine the relative amount of gene expression, with the expression of tubulin (for tissue expression patterns) or *Actin8*gene (for expression profiles responding to biotic stimuli) used as an internal control. The PCR was carried out in an ABI StepOne Real-Time PCR System (Applied Biosystems). All primers used in this study are listed in Table [2](#T2){ref-type="table"}. Seed germination and early seedling development assays ------------------------------------------------------ ### Seed Germination Plants of all genotypes were grown in the same conditions, and seeds were collected at the same time. For each comparison, seeds were planted on the same plate containing MS medium (0.5× MS salts, 1% Suc, and 0.8% agar) without or with different concentrations of ABA, NaCl or mannitol as indicated. Plates were stratified at 4°C in the dark for 3 d and transferred to 22°C with a 16-h-light/8-h-dark cycle. The percentage of seed germination was scored at the indicated times. Germination was defined as an obvious emergence of the radicle through the seed coat. ### Cotyledon greening To study the effect of ABA and other osmotic agents on cotyledon greening, seeds were sown on MS medium as described above. Three days after stratification, germinated seeds were transferred to medium containing different concentrations of ABA or other osmotic agents (NaCl and mannitol) as indicated. The percentage of cotyledon greening was recorded at 7 d after the end of stratification. Cotyledon greening is defined as obvious cotyledon expansion and turning green. ### Seedling root growth To study the effect of ABA and or other osmotic agents on seedling root growth, seeds were sown on MS plates vertically in growth chamber. Five-day-old seedlings were transferred to medium containing different concentrations of ABA or other osmotic agents for another 5 days and root growth was measured after the transfer. Drought, salt treatment and determination of transpiration rate --------------------------------------------------------------- Drought tolerance test was examined in soil, 7-day-old seedlings were transplanted from MS plates to the soil for another 2 weeks under normal growth conditions. Plants were then subjected to progressive drought test by withholding water for specified times or rosette leaves of similar developmental stages (third to fifth true rosette leaves) were detached and placed abaxial side up on open Petri dishes and weighed at different time intervals at room temperature to determine transpiration rate. For salt treatment, 3-week-old plants were watered with salt solution with increased concentration from 50 mM to 200 mM every four days. To minimize experimental variations, the same numbers of plants were grown on the same tray. The entire test was repeated for a minimum of three times. Authors\' contributions ======================= PL performed bioinformatics analysis, sub-cellular localization, germination experiments, identified T-DNA mutants (ICME-LIKE1 and ICME-LIKE2 genes) and drafted the manuscript. WL conducted real-time PCR, identified T-DNA mutants (ICME gene) and participated in drafting the manuscript. HW performed the Phylogenetic tree construction with Minimum Evolution and Maximum Parsimony methods and aided in data analysis. WM conceived the study, assisted in designing the experiment, interpretation of the data, and finalizing the manuscript. All authors approved of the manuscript. Supplementary Material ====================== ###### Additional file 1 **Phylogenetic tree was constructed by Minimum Evolution method using MEGA4 program**. Phylogenetic relationships of ICME, ICME-like proteins and their homologs from *Zea mays, Oryza sativa, Vitis vinifera*, and *Cleome spinosa*as well as carboxylesterases from *Arabidopsis*. ###### Click here for file ###### Additional file 2 **Phylogenetic tree was constructed by Maximum Parsimony method using MEGA4 program**. Phylogenetic relationships of ICME, ICME-like proteins and their homologs from *Zea mays, Oryza sativa, Vitis vinifera*, and *Cleome spinosa*as well as carboxylesterases from *Arabidopsis*. ###### Click here for file ###### Additional file 3 **Sub-cellular localization of GFP-tagged ICME and its homologs**. Onion epidermal cells were co-transformed with free GFP, GFP-ICME-LIKE1, GFP -ICME-LIKE2, ICME-GFP and ER marker BiP-RFP (A, C and E) or Golgi apparatus marker ST-mRFP (B, D and F), respectively. For each combination shown on the right, images of GFP fluorescence, DesRed fluorescence, brightfield, and the merged were taken using a Zeiss confocal laser microscope LSM510 and were displayed from left to right, respectively. ###### Click here for file ###### Additional file 4 **Identification of T-DNA insertion mutant lines of *ICME-LIKE2*gene**. (A) Gene structure of the *ICME*(thick lines indicate exon and thin lines indicate intron) and the locations of the T-DNA insertion in the icme-1(SALK_043448) and icme-2 (SALK_002648) lines are shown. Primers used to screen are shown as arrows. (B) Homozygous T-DNA insertion lines were identified by Genomic-PCR. *icme-like2-1*was identified by two primer pairs: (1) LBa1 and gene-specific forward primer 3gRTF for confirming T-DNA insertion and (2) 3gRTIF and 3gRTR for confirming homozygous T-DNA insertion. *icme-like2-2*was identified by two primer pairs: (1) LBa1 and gene-specific reverse primer 3gRTR for confirming T-DNA insertion and (2) 3gRTF and 3gRTR for confirming homozygous T-DNA insertion. (C) The flanking sequence of the T-DNA insertion lines. The position of the T-DNA insertion was confirmed by DNA sequence analysis of the resultant PCR products. Sequences underlined referred to the left border of LB, while the italic ones referred to the genomic sequences. The bold ones indicated the additional sequences due to T-DNA insertion. ###### Click here for file ###### Additional file 5 **Identification of T-DNA insertion mutant lines of *ICME*gene**. (A) Gene structure of the *ICME*(thick lines indicate exon and thin lines indicate intron) and the locations of the T-DNA insertion in the icme-1(SALK_010304) and icme-2 (SALK_075701) lines are shown. Primers used to screen are shown as arrows. **(B)**Homozygous T-DNA insertion lines were identified by Genomic-PCR. *icme-1*was identified by two primer pairs: (1) LBa1 and gene-specific forward primer 5gNcoIF for confirming T-DNA insertion and (2) 5gNcoIF and 5gRTR for confirming homozygous T-DNA insertion. *icme-2*was identified by two primer pairs: (1) LBa1 and gene-specific forward primer P2 for confirming T-DNA insertion and (2) P2 and 5gRTR for confirming homozygous T-DNA insertion. **(C)**The flanking sequence of the T-DNA insertion lines. The position of the T-DNA insertion was confirmed by DNA sequence analysis of the resultant PCR products. Sequences underlined referred to the left border of LB, while the italic ones referred to the genomic sequence. The bold ones indicated the additional sequences due to T-DNA insertion. ###### Click here for file ###### Additional file 6 **Phenotypes, drought treatment and transpiration rates of wild type and mutants**. The up panels of (**A)**and (**B)**were 21-day-old plants under normal growth condition of different genotypes. The down panels of (**A**) and (**B)**were drought treated plants. For drought treatment, 21-day-old plants under normal growth condition of different genotypes were withheld water for 14 days. **(C)**Transpiration rates. Rosette leaves of the same developmental stages were excised from 21-old-day plants and weighed at various time points after detachment. Each data point represents the mean of duplicate measurements. Error bars represent SD (*n*= 3 each). ###### Click here for file Acknowledgements ================ The study was financially supported by Murdoch University internal post-doctoral fellowship. Hangzhou Normal University provided supplementary funds to the study. We thank the Arabidopsis Biological Resource Center (ABRC) and SALK Institute for providing T-DNA insertion lines. The authors would like to extend their thanks to the two journal appointed reviewers who have given constructive comments and suggestion to improve the manuscript.

/* * FreeRTOS * Copyright (C) 2020 Amazon.com, Inc. or its affiliates. All Rights Reserved. * * Permission is hereby granted, free of charge, to any person obtaining a copy of * this software and associated documentation files (the "Software"), to deal in * the Software without restriction, including without limitation the rights to * use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of * the Software, and to permit persons to whom the Software is furnished to do so, * subject to the following conditions: * * The above copyright notice and this permission notice shall be included in all * copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS * FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR * COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER * IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN * CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. * * http://aws.amazon.com/freertos * http://www.FreeRTOS.org */ /** * @file aws_iot_network_config.h * @brief Configuration file which enables different network types. */ #ifndef AWS_IOT_NETWORK_CONFIG_H_ #define AWS_IOT_NETWORK_CONFIG_H_ /** * @brief Configuration flag used to specify all supported network types by the board. * * The configuration is fixed per board and should never be changed. * More than one network interfaces can be enabled by using 'OR' operation with flags for * each network types supported. Flags for all supported network types can be found * in "aws_iot_network.h" */ #define configSUPPORTED_NETWORKS ( AWSIOT_NETWORK_TYPE_WIFI ) /** * @brief Configuration flag which is used to enable one or more network interfaces for a board. * * The configuration can be changed any time to keep one or more network enabled or disabled. * More than one network interfaces can be enabled by using 'OR' operation with flags for * each network types supported. Flags for all supported network types can be found * in "aws_iot_network.h" * */ #define configENABLED_NETWORKS ( AWSIOT_NETWORK_TYPE_WIFI ) #endif /* CONFIG_FILES_AWS_IOT_NETWORK_CONFIG_H_ */

Unique Features - Support for @BIOS- Support for Q-Flash- Support for Xpress BIOS Rescue- Support for Download Center- Support for Xpress Install- Support for Xpress Recovery2- Support for EasyTune- Support for Smart 6- Support for Auto Green- Support for Cloud OC- Support for 3TB+ Unlock- Support for TouchBIOS- Support for Q-Share Bundle Software - Norton Internet Security (OEM version) Form Factor- Micro ATX Form Factor; 24.4cm x 20.5cm Please do not forget to check with our site as often as possible in order to stay updated on the latest drivers, software and games. Note: Try to set a system restore point before installing a device driver. It will help you restore system if installed driver not complete.

Desensitization at the interface. Normal brain function requires the faithful transmission and integration of information on a timescale of milliseconds, and this rapid signaling is mediated by cell membrane receptors that are ligand-gated ion channels. Fast excitatory transmission occurs when synaptically released glutamate opens channels in neighboring neurons, but these channels desensitize rapidly during sustained high-frequency firing. Recent structural data have begun to provide important insights into the molecular mechanisms that underlie channel activation and desensitization.

--- abstract: 'We construct random triangles via uniform sampling of certain families of lines in the plane. Two examples are given.  The word uniform turns out to be vague; two competing models are examined.  Everything we write is well-known to experts.  Which model is more appropriate?  Our hope is to engage a larger audience in answering this question.' author: - Steven Finch date: 'February 8, 2018' title: Three Random Intercepts of a Segment --- Let $\ell$ denote a planar random line with slope $\tan(\omega)$ and $x$-intercept $\xi$, where $\omega\sim\,$Uniform$[0,\pi]$ and $\xi\sim \,$Uniform$[-1,1]$ are independent. Let $\ell_{1}$, $\ell_{2}$, $\ell_{3}$ be independent copies of $\ell$. The three lines determine a compact triangle $\Delta$ almost surely. The probability density function for the maximum angle in $\Delta$ is [@Grffths] $$f(\alpha)=\left\{ \begin{array} [c]{lll}6(3\alpha-\pi)/\pi^{2} & & \text{if }\pi/3\leq\alpha<\pi/2,\\ 6(\pi-\alpha)/\pi^{2} & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise}\end{array} \right.$$ and hence the probability that $\Delta$ is obtuse is $3/4$. A variation on the preceding is to require $\omega\sim\,$Uniform$[\pi /4,3\pi/4]$, that is, the lines $\ell_{1}$, $\ell_{2}$, $\ell_{3}$ each have $\left\vert \text{slope}\right\vert $ exceeding $1$. The maximum angle density here is [@Finch1; @BjxHys]$$f(\alpha)=\left\{ \begin{array} [c]{lll}24(\pi-\alpha)(2\alpha-\pi)/\pi^{3} & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise.}\end{array} \right.$$ The random triangle $\Delta$ is almost surely obtuse. Gates [@Gates94] examined the same two problems, for triangles generated by uniform random lines, but adopted a different probability model than the preceding. He did not elaborate on the quoted phrase, but referred to an earlier paper [@Gates93], where it is apparent that the density for $\omega$ should be proportional to $\sin (\omega)$. On the one hand, his model is *standard* in the sense that the measure is invariant under rigid motions [@KndlMrn; @Santalo]. On the other hand, it possesses a feature that vertical lines are weighted more than horizontal lines. This curious tradeoff raises an interesting question: which model is more appropriate when constructing random triangles? For the unrestricted case ($0\leq\omega<\pi$), the inclination angle density is $$g(\omega)=\frac{1}{2}\sin(\omega)$$ and the maximum angle density is consequently [@Gates94] $$f(\alpha)=\left\{ \begin{array} [c]{lll}\dfrac{3}{4}\left[ (3\alpha-\pi)\cos(\alpha)+2\sin(\alpha)-2\sin (2\alpha)+\sin(3\alpha)\right] & & \text{if }\pi/3\leq\alpha<\pi/2,\\ \dfrac{1}{4}\left[ 3(\pi-\alpha)\cos(\alpha)+3\sin(\alpha)-2\sin (2\alpha)\right] & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise.}\end{array} \right.$$ It follows that$$\mathbb{P}\left\{ \Delta\text{ is obtuse}\right\} =2-\frac{3\pi}{8}=0.8219...$$ which is larger than $3/4$.  For the restricted case ($\pi/4\leq\omega \leq3\pi/4$), the inclination angle density is $$g(\omega)=\frac{1}{\sqrt{2}}\sin(\omega)$$ and the maximum angle density is [@Gates94]$$f(\alpha)=\left\{ \begin{array} [c]{lll}\dfrac{1}{2}\left[ \cos(\alpha)+\sin(\alpha)+\cos(2\alpha)-2\sin (2\alpha)\right] & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise.}\end{array} \right.$$ The expressions for $f$ when $\omega$ enjoys constant weighting are simpler than those for $f$ when $\omega$ enjoys sinusoidal weighting.  This statement alone does not imply that the first model is preferable to the second model; there are other issues to consider too. To generate random triangles according to [@Gates94] is only slightly more complicated than according to [@Grffths; @Finch1]: if $U\sim\,$Uniform$[0,1]$, then by the inverse CDF method, $$\omega=\arccos\left( 1-2U\right)$$ gives inclination angles for the unrestricted case and$$\omega=\arccos\left( (1-2U)/\sqrt{2}\right)$$ gives inclination angles for the restricted case.   The most compelling argument for sinusoidal weighting is its theoretical consistency with the Poisson line process [@Miles64; @Solmn].  Let us focus on the unrestricted case.  By Example 20 of [@Baddly1], the inclination angles $\omega_{j}$ of the lines relative to the $x$-axis are independent and identically distributed with density $\sin(\omega)/2$ on $[0,\pi]$.  In words, acute angles $\approx0^{\circ}$ and obtuse angles $\approx180^{\circ}$ are less likely than near-right angles $\approx90^{\circ }$.  Vertical rain wets more than slanted rain [@Serra]. We quote [@Baddly1]: > ... although the lines of the line process have uniformly distributed orientations in some sense, the angles of incidence with any fixed axis are not uniformly distributed... the probability of ‘catching’ a random line in a given sampling interval of the $x$-axis depends on the orientation of the line... and, further, [@Baddly2]: > This is a classic paradox. If you consider the random lines which **intersect a given, fixed line**, then these random lines have angles which are non-uniformly distributed with probability density proportional to the sine of the incidence angle. If you consider the random lines which **intersect a given circle** then these random lines have uniformly-distributed orientation angles. In each case the **bold text** describes a selection or sampling operation, and sampling operations introduce bias. We sketch a proof of this theorem in Appendix 1.  Proofs of the four density formulas for $f$ are not provided here; in the following section, we choose instead to examine only a special scenario for illustration’s sake. Diagonal Line ============= Let us examine the restricted case ($\pi/4\leq\omega\leq3\pi/4$), initially with constant weighting and subsequently with sinusoidal weighting.  We follow [@BjxHys] closely.  Let $\omega_{1}=\pi/4$, $\omega_{2}$, $\omega_{3}$ be the inclination angles of the three lines, hence the first line is fixed as the diagonal $y=x$. Clearly $\omega_{1}<\omega_{2}$ and $\omega_{1}<\omega_{3}$ almost surely.  The angles $\omega_{2}$, $\omega_{3}$ are independent and identically distributed, thus $\mathbb{P}\left\{ \omega_{2}<\omega_{3}\right\} =1/2$.  The triangle formed by the three lines has angles $\omega_{2}-\omega_{1}$, $\omega_{3}-\omega_{2}$, $\pi-\omega _{3}+\omega_{1}$.  Since $\pi/2=\pi-3\pi/4+\pi/4\leq\pi-\omega_{3}+\omega _{1}$, the maximum angle is obviously $\alpha=5\pi/4-\omega_{3}$.  We have$$\begin{aligned} \mathbb{P}(\alpha & <a)=\mathbb{P}\left\{ \begin{array} [c]{ccc}5\pi/4-\omega_{3}<a & \mid & \omega_{2}<\omega_{3}\end{array} \right\} \\ & =\frac{\mathbb{P}\left\{ \begin{array} [c]{cc}\omega_{3}>5\pi/4-a, & \omega_{2}<\omega_{3}\end{array} \right\} }{\mathbb{P}\left\{ \omega_{2}<\omega_{3}\right\} }\\ & =2\,\mathbb{P}\left\{ \omega_{3}>\max\left( \begin{array} [c]{cc}\omega_{2}, & 5\pi/4-a \end{array} \right) \right\} \\ & =2\left[ {\displaystyle\int\limits_{\pi/4}^{5\pi/4-a}} \,{\displaystyle\int\limits_{5\pi/4-a}^{3\pi/4}} g(\omega_{3})g(\omega_{2})d\omega_{3}d\omega_{2}+{\displaystyle\int\limits_{5\pi/4-a}^{3\pi/4}} \,{\displaystyle\int\limits_{\omega_{2}}^{3\pi/4}} g(\omega_{3})g(\omega_{2})d\omega_{3}d\omega_{2}\right] .\end{aligned}$$ For $g(\omega)=2/\pi$, evaluating the double integrals yields$$\mathbb{P}(\alpha<a)=\frac{(2a-\pi)(3\pi-2a)}{\pi^{2}}$$ and, upon differentiation, $$\begin{array} [c]{ccc}f(\alpha)=\dfrac{8(\pi-\alpha)}{\pi^{2}}, & & \dfrac{\pi}{2}\leq\alpha\leq \pi. \end{array}$$ For $g(\omega)=\sin(\omega)/\sqrt{2}$, evaluating the double integrals yields$$\mathbb{P}(\alpha<a)=\dfrac{1}{4}\left[ 2-2\cos(a)-2\sin(a)-\sin(2a)\right]$$ and, upon differentiation,$$\begin{array} [c]{ccc}f(\alpha)=\dfrac{1}{2}\left[ -\cos(\alpha)+\sin(\alpha)-\cos(2\alpha)\right] , & & \dfrac{\pi}{2}\leq\alpha\leq\pi. \end{array}$$ Moments are easily calculated; the mode is $\pi/2$ for the former and$$2\arctan\left[ \frac{1}{2}\left( -3+\sqrt{17}+\sqrt{2\left( 5-\sqrt {17}\right) }\right) \right] =1.7713...$$ for the latter.  Identical results apply when instead the third line is fixed as the anti-diagonal $y=-x$. On a personal note, I had intended this article to be a quick follow-up to my 2011 article on random tangents to a circle [@Finch2] .  Who would have suspected that random intercepts of a segment might be so much more hazardous than the preceding?  Uncovering Gates’ model [@Gates94; @Gates93] constituted a turning point in my writing.  This humble contribution is the uncertain outcome of several years of hesitation and delay. The R package *spatstat* [@BRT] has planar random process simulation capabilities.  I can generate Poisson lines in a sampling window via *rpoisline* and determine their inclination angles $\omega_{j}$ via *angles.psp* (with option *directed=FALSE*).  An elliptical window of eccentricity $\varepsilon\approx1$ is less likely to be hit by lines almost parallel to the major axis than by almost perpendicular lines.  In contrast, for a circular window ($\varepsilon=0$), all directions are equally likely.  Clarifying these observations more rigorously would be worthwhile and I welcome thoughts on how this should be done. Appendix 1 ========== The ordered pair $(\xi,\omega)$ offers one representation of a line $L$, involving the $x$-intercept $\xi$ and inclination angle $\omega$.  Another representation $(p,\theta)$ where $-\infty<p<\infty$ and $0\leq\theta<\pi$, called the Hesse normal form, involves the length $|p|$ of the perpendicular segment from $(0,0)$ to $L$ and the orientation angle $\theta$ of this segment.  In the definition of a Poisson line process, it is usually assumed that $\theta\sim\,$Uniform$[0,\pi]$.  From$$x\cos(\theta)+y\sin(\theta)=p$$ we see that$$\begin{array} [c]{ccc}p=\left\{ \begin{array} [c]{lll}-\xi\sin(\omega) & & \text{if }\omega<\pi/2,\\ \xi\sin(\omega) & & \text{if }\omega\geq\pi/2 \end{array} \right. , & & \theta=\left\{ \begin{array} [c]{lll}\omega+\pi/2 & & \text{if }\omega<\pi/2,\\ \omega-\pi/2 & & \text{if }\omega\geq\pi/2 \end{array} \right. \end{array}$$ since $\cos(\omega\pm\pi/2)=\mp\sin(\omega)$.  At first glance, it would seem that $\omega\sim\,$Uniform$[0,\pi]$ immediately because $\theta\sim \,$Uniform$[0,\pi]$.  In fact, the $2\times2$ Jacobian determinant of the transformation $(\xi,\omega)\mapsto(p,\theta)$ is $\mp\sin(\omega)$, which implies that the density of $\omega$ is $\sin(\omega)/2$.  Reason for the factor of $2$: both $(\xi,\omega)$ and $(-\xi,\pi-\omega)$ are mapped to the same $(p,\theta)$.  Details of the proof in a more general setting appear in [@Solmn; @Wlfwtz; @Morton]. Appendix 2 ========== We present R simulation output results (ten histograms in blue) graphed against density expressions found herein (six curves in red).  The first four plots correspond to the first four expressions for $f$, given without proof.  The next two plots correspond to those associated with the diagonal line $y=x$ scenario.  Analysis of other scenarios involving the vertical line $x=0$ or the horizontal line $y=0$ are left to the reader. [j1234.eps]{} [j5-10.eps]{} Appendix 3 ========== Given a convex region $C$ in the plane, a width is the distance between a pair of parallel $C$-supporting lines.  Fix an inclination angle $0\leq\omega<\pi$ relative to the $x$-axis.  A measure of all lines of angle $\omega$ hitting a $C$-window is proportional to the corresponding width.  For example, if $C$ is the square $[-1,1]\times\lbrack-1,1]$, we obtain a bimodal inclination angle density [@Finch3]$$\frac{1}{4}\max\left\{ \sqrt{1+\sin(2\omega)},\sqrt{1-\sin(2\omega)}\right\}$$ with modes at $\pi/4$ and $3\pi/4$.  It is easier to obtain the $\sin (\omega)/2$ density for the interval $[-1,1]$, but harder to examine $2\times2\sqrt{1-\varepsilon^{2}}$ rectangles of eccentricity $0<\varepsilon <1$. [99]{} D. Griffiths, Uniform distributions and random triangles, *Math. Gazette*. 67 (1983) 38–42. S. R. Finch, Problem 1895, *Math. Mag.* 85 (2012) 151. E. Bojaxhiu and E. Hysnelaj, Solution of problem 1895: The probability density function of the maximum angle, *Math. Mag.* 86 (2013) 152–153. J. Gates, Shape distributions for planar triangles by dual construction, *Adv. Appl. Probab.* 26 (1994) 324–333; MR1272714 (95b:60012). J. Gates, Some dual problems of geometric probability in the plane, *Combin. Probab. Comput.* 2 (1993) 11–23; MR1234786 (95g:60018). M. G. Kendall and P. A. P. Moran, *Geometrical Probability*, Hafner, 1963, pp. 1–23; MR0174068 (30 \#4275). L. A. Santaló, *Integral Geometry and Geometric Probability*, Addison-Wesley, 1976, pp. 27–30; MR0433364 (55 \#6340). R. E. Miles, Random polygons determined by random lines in a plane, *Proc. Nat. Acad. Sci. U.S.A.* 52 (1964) 901–907; MR0168000 (29 \#5265). H. Solomon, *Geometric Probability*, SIAM, 1978, pp. 25–30, 39–55; MR0488215 (58 \#7777). A. J. Baddeley, A crash course in stochastic geometry, $3^{\text{rd}}$ *Séminaire Européen de Statistique on Stochastic Geometry, Theory and Applications*, Toulouse, 1996, ed. O. Barndorff-Nielsen, W. Kendall and M. N. M. van Lieshout, Chapman & Hall/CRC, 1999, pp. 1–35; MR1673110; http://school.maths.uwa.edu.au/adrian/reprints/chapter1.ps. J. Serra, Random tesselations, ch. XXV, *Courses on Mathematical Morphology*, http://cmm.ensmp.fr/serra/cours/. A. J. Baddeley and E. Rubak, Planar Poisson line process & angles of inclination, http://math.stackexchange.com/questions/2609173/planar-poisson-line-process-angles-of-inclination/. S. R. Finch, Three random tangents to a circle, arXiv:1101.3931. A. Baddeley, E. Rubak and R. Turner, *Spatial Point Patterns: Methodology and Applications with R*, Chapman and Hall/CRC Press, 2015; http://spatstat.org/. J. Wolfowitz, The distribution of plane angles of contact, *Quart. Appl. Math.* 7 (1949) 117–120; MR0028551 (10,464g). R. R. A. Morton, The expected number and angle of intersections between random curves in a plane, *J. Appl. Probab.* 3 (1966) 559–562; MR0203756 (34 \#3604). S. R. Finch, Width distributions for convex regular polyhedra, arXiv:1110.0671. \[c\][lll]{} & Steven Finch &\ & MIT Sloan School of Management &\ & Cambridge, MA, USA &\ & *steven\[email protected]* &

Show HN: Bookmarklet that sends highlighted text to your phone - lambtron http://www.andy-jiang.com/textme ====== tonydolore Very cool. Which service are you using to send out the sms? ~~~ lambtron Twilio :)

et h = 3/161 - -313/483. Sort -1/4, -4/7, h, 0.3 in increasing order. -4/7, -1/4, 0.3, h Let h = -2044 - -2021. Put 1, -3, h in descending order. 1, -3, h Suppose -5*x = 3*x + 24. Sort x, -7, -2 in ascending order. -7, x, -2 Suppose -c = 2*c + r + 9, 0 = 5*c + 5*r + 15. Suppose d + p - 4 + 3 = 0, -3*d + 5*p - 5 = 0. Let b = d - -3. Sort c, 1, b in descending order. b, 1, c Suppose s = 6 - 3. Let o = -34 + 19. Let v be 4/(-30) + 88/o. Sort s, v, -1 in increasing order. v, -1, s Suppose -17*f + 544 = 306. Put 15, -1/4, f in descending order. 15, f, -1/4 Let r be 44/(-14) - ((-17 - -11) + 3). Put 10, 0.5, 3/8, r in decreasing order. 10, 0.5, 3/8, r Let q be ((-10)/4)/(7/42*-3). Sort 37, -1, q, 4. -1, 4, q, 37 Let f(z) = 12*z**2 - 14*z + 13. Let s be f(1). Sort s, -4, -2, -3 in descending order. s, -2, -3, -4 Let i be 3 - ((3 - -2) + -1). Put -6, i, -13 in decreasing order. i, -6, -13 Let v = -0.1 + -0.1. Let k = -4.35 - -0.35. Let p = -5 - k. Sort v, -0.3, p in descending order. v, -0.3, p Suppose -2*s - 3*w = 13, -4*s - 3*w + 13 = 30. Put s, -4, 1, 0 in increasing order. -4, s, 0, 1 Suppose -727 + 730 = -3*j. Put 7, j, 5 in descending order. 7, 5, j Let t be (-3 + 3 + -12)/(-3). Sort t, 3, 10, 2 in ascending order. 2, 3, t, 10 Let d = -0.04 + -3.96. Let m = -1.568 + 1.168. Put 0.1, d, 1, m in increasing order. d, m, 0.1, 1 Let i = 5.58 + -5.88. Put 0.43, -2/7, i in ascending order. i, -2/7, 0.43 Let q be (-80)/(-14) + 2/7. Suppose 5*c - f + q - 1 = 0, -10 = -c - 2*f. Suppose 4*g - 6*g - 6 = c. Sort g, 3, 0 in decreasing order. 3, 0, g Let z = 50 + -54.8. Let m = 0.4 - z. Let q = m + -5. Sort 0.4, 3, q in descending order. 3, 0.4, q Let u be 4/(-12) + 16/3. Suppose -2*h - 2*r + u + 5 = 0, -19 = h - 5*r. Let n be -1 - (-2 - -1 - h). Sort 3, 5, n in decreasing order. 5, 3, n Let x = -2.05 - -0.05. Sort -1/5, x, -84 in decreasing order. -1/5, x, -84 Let m be (-72)/(-20) - (-6)/15. Let q = 2 - m. Let x = -0.05 - 0.05. Sort x, q, 2 in descending order. 2, x, q Let l(a) = -9*a**2 - 5*a. Let o be l(-1). Let p be ((-12)/8)/(1/o). Put p, -5, 5 in ascending order. -5, 5, p Suppose 14*f = 35 - 7. Sort 3, -145, 1, f in descending order. 3, f, 1, -145 Let r = 3.05 - 0.05. Suppose -10*f = -5*f - 25. Let l = -7.16 - -7.66. Sort f, l, r in decreasing order. f, r, l Suppose -11*w - 7 = -8*w + 5*h, w + 5*h = -9. Let r = 14 + -10. Put r, -5, w in ascending order. -5, w, r Suppose -10*t + 5*c = -12*t - 10, 5*c = -4*t - 10. Put -16, 8, t, 4 in descending order. 8, 4, t, -16 Let r(z) = z**2 + 11*z + 15. Let b be r(-9). Suppose -7*t + 4*w = -4*t - 16, 20 = -t - 5*w. Suppose -12 = 4*s - s. Put b, s, t in descending order. t, b, s Let v = -8 + 10. Suppose -7 = -v*c - 1. Suppose 4*o + 12 = -0*o. Put c, 12, o in decreasing order. 12, c, o Let k be (162/(-216))/((135/24)/5). Sort k, 4/3, 0.16, -0.4 in decreasing order. 4/3, 0.16, -0.4, k Let p be (-3*(-1)/9*18)/(-2). Put 0.4, -5, p, 2 in ascending order. -5, p, 0.4, 2 Let m(y) = -y**2 - 7*y - 5. Let w = -5 + 3. Let i be m(w). Sort 3, -2, i, 4 in increasing order. -2, 3, 4, i Let m = -477 - -479. Put 3, -250, m in descending order. 3, m, -250 Let s = 7 + -4. Let k be 2/s*(3 - 6). Let r = 0.3 - 0.1. Sort k, r, -1/4 in decreasing order. r, -1/4, k Let n be -2*(-1)/(-2) - 2. Let m = -1 - n. Let k = 899 + -902. Put m, 4, k in descending order. 4, m, k Let u = -1 + 3. Let s = -438 + 1316/3. Put u, -6, s in increasing order. -6, s, u Let d be 12/(-756)*7*3. Let q = 57/2 - 29. Put d, 3, q in decreasing order. 3, d, q Let h be 0 + -1 + 3 + 3. Let k be (1 - h) + -5*(-12)/20. Sort k, -4, 0, 4 in descending order. 4, 0, k, -4 Let p(v) = -3*v - 11. Let n be p(-8). Let k = 1 - n. Put -4, k, -1 in descending order. -1, -4, k Suppose -67 = 3*u + 113. Let o = u - -58. Put -9, o, 1 in ascending order. -9, o, 1 Let t = 24 - -24. Let z = t + -47.86. Put z, 2/5, -4/5 in descending order. 2/5, z, -4/5 Let y = -1063.992 - -1060. Let q = -0.072 - y. Let m = 0.08 + q. Sort 2/7, -4, m in ascending order. -4, 2/7, m Let n(i) = -i**2 - 3*i + 4. Let o be n(-3). Suppose 10 = o*v + 2. Suppose -v*y = -2*b - 6, 4*b = -5*y + 3*y + 18. Put 1, 5, b in descending order. 5, b, 1 Let r = -32 - -27. Let p = -0.08 + -3.92. Put p, r, -1/4, 2/9 in ascending order. r, p, -1/4, 2/9 Suppose 1 - 13 = -6*j. Let i(g) = g**3 + 7*g**2 + 5*g - 5. Let w be i(-6). Sort j, -4, w. -4, w, j Let q = 2 + -1. Let k = 3860 + -3857. Put q, k, 22 in descending order. 22, k, q Let v = -7.592 + -3.903. Let i = -1.285 - v. Let t = i - 0.21. Put t, 1/3, -3 in increasing order. -3, 1/3, t Let s = 16/5113 - -1717088/281215. Let n = -31/5 + s. Suppose 22 = 4*y - 2*j, -j - 2*j = 4*y - 7. Put n, 5, y in ascending order. n, y, 5 Let s = -60 + 40. Let r be 17/(-5) + 12/s. Let c(z) = -z**3 - 5*z**2 + 6*z + 3. Let n be c(-6). Put n, 1, r in decreasing order. n, 1, r Let n = 1/50 + -3/25. Let f = -81 + 1703/21. Let w = -6/13 - -80/117. Sort f, n, w in decreasing order. w, f, n Let j = -64 + 64.4. Let l = -2.93 - 0.07. Let o = -3/2 - -2. Put o, j, l in decreasing order. o, j, l Let d be (-6 - (0 - 1))*-1. Suppose -3*n + 4*o - 13 = 0, -n + 5*o - 26 + 7 = 0. Sort 19, n, d, -3. -3, n, d, 19 Let x be 47/94 + 5/6. Put x, -3/4, 1/6, -3/70 in decreasing order. x, 1/6, -3/70, -3/4 Let m(i) = -i**3 - 4*i**2 + 5*i + 6. Let k be m(0). Let w = 11 - 8. Suppose 3*x - w*v = -27, -k = -v - v. Sort x, 3, -3 in ascending order. x, -3, 3 Let z = -14 + 19. Put 4, 2, z, 3 in descending order. z, 4, 3, 2 Let b(m) = -m - 9. Let l be b(-5). Let v = -8 - l. Put 0.4, v, -0.3 in ascending order. v, -0.3, 0.4 Suppose 4*j + 4 = 2*x, -5*j + x = -4*x + 10. Let c be (-3)/(1 - -2)*j. Sort -5, c, -3. -5, -3, c Let c(g) = 2*g + 11. Let h be c(-16). Let j = h + 28. Put -2/15, j, 2/19 in increasing order. -2/15, 2/19, j Suppose 99 = 5*z - 4*m, -3*m - 2 = -5*z + 101. Let d = -32 + z. Suppose 4*v + 1 - 17 = 0. Sort -2, v, d in increasing order. d, -2, v Let r = -5 - -4.97. Let q = -433 + 434. Sort q, r, -5. -5, r, q Let w = -20243/9 - -2249. Sort 14, -0.3, w. -0.3, w, 14 Suppose 21*h + 6 = 23*h. Sort h, 5, -5 in increasing order. -5, h, 5 Let i be (-3)/((-29)/((-232)/(-96))). Sort 4.7, 2/15, i in increasing order. 2/15, i, 4.7 Let h(m) = -m**2 + 5*m - 4. Let o be h(5). Let n be -368 - -381 - 2*4. Suppose -r - 4*a = 8, 0*a = -5*r + 3*a + 29. Put r, o, n in ascending order. o, r, n Let z be (-1 + 3)/(-4 - -6). Let d(k) = -8*k**2 - 2*k + 3. Let y be d(z). Sort -3, y, -2, 4 in descending order. 4, -2, -3, y Let p be 104/(-30) + 5*1. Let s = 37/30 - p. Sort -5, -0.1, s, 0.5 in increasing order. -5, s, -0.1, 0.5 Let c = 17.6 + 0.4. Let m = -17.5 + c. Let q = -13/18 + 2/9. Put q, -2, m in decreasing order. m, q, -2 Let n = -15 + 16. Let q be 161/(-392) + (-1)/(-24)*3. Sort 2/11, q, 1/9, n in decreasing order. n, 2/11, 1/9, q Let d = -8 + 0. Let c = 5.3 + 2.7. Let b = d + c. Sort 4, 2, b in increasing order. b, 2, 4 Let q = -239 + 243. Sort 5, -16, q in descending order. 5, q, -16 Suppose -21*x + 8*x - 52 = 0. Put 3, 5, -2, x in decreasing order. 5, 3, -2, x Let d = 0.069 + -0.269. Put 3/8, d, -4, -19 in descending order. 3/8, d, -4, -19 Suppose 0 = 2*n + 2*t - 8, -2*n - 4*t - 29 = -3*n. Suppose -4*z = -7*z + n. Sort 6, 0, z in increasing order. 0, z, 6 Suppose c - 3 = -n - 2*c, -9 = -n + 3*c. Suppose n = -t + 7. Sort t, -2, -1 in decreasing order. t, -1, -2 Suppose 9 = 3*x - 6*x. Let o = x - -8. Suppose -2*c + 0*c - o*s - 14 = 0, 4*c + 5*s = -18. Sort c, 1, 2 in descending order. 2, 1, c Suppose w + 20 = 5*w. Let b(c) = -4*c - 3. Let l be b(3). Let v = -11 - l. Sort v, 1, w in increasing order. 1, v, w Let p(x) = 18*x + 17. Let h be p(-1). Sort h, -22, 1, 5. -22, h, 1, 5 Let f be 6/52*(10 - 338/39). Sort -5, 2/5, 0.5, f in descending order. 0.5, 2/5, f, -5 Let z = 1 - 0.8. Let a = 59 - 58.5. Let p = 2 + -2.5. Sort p, a, z in ascending order. p, z, a Let s(v) = -v**2 - 8*v + 131. Let c be s(8). Sort 5, -4, -1, c. -4, -1, c, 5 Let n = 46 - 14. Let y be 3 - n/12 - 1. Sort 1, 5, 1/2, y in descending order. 5, 1, 1/2, y Suppose 2*z = -2*z + 4*x - 16, z + 4 = -5*x. Let g = -8.79 - 0.21. Let n = g - -9.5. Put z, 1, n in decreasing order. 1, n, z Let c(v) be the first derivative of -v**3/3 + 3*v**2/2 + 8*v + 7. Let f be c(4). Let o be (6/8)/(2/8).

Learn and grow with award-winning support and a thriving community behind you. You don't have to go it alone. Master the inbound methodology and get the most out of your tools with HubSpot's legendary customer support team and a community of thousands of marketing and sales pros just like you.

Hromivka Hromivka is a place name in Ukraine which can refer to the following villages: Hromivka, Crimea Hromivka, Kherson Oblast Hromivka, Khmelnytskyi Oblast Hromivka, Zaporizhia Oblast

Anonymous asked: Hello, I just wanted to ask what you use, to give your pictures that vhs effect, and how you make the 'subtitles' Anyways, really like your blog!

FILED NOT FOR PUBLICATION FEB 16 2017 UNITED STATES COURT OF APPEALS MOLLY C. DWYER, CLERK U.S. COURT OF APPEALS FOR THE NINTH CIRCUIT FRED KENNETH MACDONALD, No. 15-56429 Plaintiff-Appellant, D.C. No. 3:11-cv-01088-BEN-KSC v. UNITED STATES OF AMERICA; et al., MEMORANDUM* Defendants-Appellees. Appeal from the United States District Court for the Southern District of California Roger T. Benitez, District Judge, Presiding Submitted February 13, 2017** Pasadena, California Before: D.W. NELSON, TALLMAN, and N.R. SMITH, Circuit Judges. Appellant Fred Kenneth MacDonald (“MacDonald”) appeals the district court’s denial of his Federal Rule of Civil Procedure 60(b) motion to reopen his case, vacate his voluntary dismissal without prejudice, and enter a new dismissal * This disposition is not appropriate for publication and is not precedent except as provided by Ninth Circuit Rule 36-3. ** The panel unanimously concludes this case is suitable for decision without oral argument. See Fed. R. App. P. 34(a)(2). with prejudice. A district court’s denial of a Rule 60(b) motion is a final, appealable order. Griffin v. Gomez, 741 F.3d 10, 25 (9th Cir. 2014). We have jurisdiction under 28 U.S.C. § 1291. We review the district court’s denial of a Rule 60(b) motion for an abuse of discretion, Lemoge v. United States, 587 F.3d 1188, 1191–92 (9th Cir. 2009), and we affirm. The district court did not abuse its discretion in denying MacDonald’s Rule 60(b) motion because MacDonald failed to establish grounds for relief. See Latshaw v. Trainer Wortham & Co., 452 F.3d 1097, 1100 (9th Cir. 2006) (allowing reversal of a Rule 60(b) order only if the district court “does not apply the correct law, rests its decision on a clearly erroneous finding of a material fact, or applies the correct legal standard in a manner that results in an abuse of discretion.” (quoting Engleson v. Burlington N. R.R. Co., 972 F.2d 1038, 1043 (9th Cir. 1992))). We do not reach MacDonald’s arguments concerning the merits of the underlying case because “[a]n appeal from a denial of a Rule 60(b) motion brings up only the denial of the motion for review, not the merits of the underlying judgment.” Molloy v. Wilson, 878 F.2d 313, 315 (9th Cir. 1989); see also Floyd v. Laws, 929 F.2d 1390, 1400 (9th Cir. 1991). The parties shall bear their own costs on appeal. 2 AFFIRMED. 3 

Phenotypic heterogeneity in families with age-related macular degeneration. To evaluate the ophthalmic phenotype in families with three or more individuals who have age-related maculopathy. Eight families were identified at academic centers in Massachusetts and North Carolina. Macular findings were graded based on a modification of the grading system used in the Age-Related Eye Disease Study (AREDS). All families had at least three members with stage 3 (extensive drusen change) or higher maculopathy in at least one eye, and six families had at least two members with advanced maculopathy (stage 4, geographic atrophy of the retinal pigment epithelium, or stage 5, exudative maculopathy). Both stages 4 and 5 maculopathy were observed among different individuals in four families. Individuals with stage 3 maculopathy were members of families with more advanced maculopathy (six families) and were of similar age as more severely affected family members but tended to be older than those with stage 2. The phenotypic appearance of the macula in families with multiple affected individuals is heterogeneous and representative of the spectrum of macular findings typically associated with age-related maculopathy.

Reactions of children to maxillary infiltration and mandibular block injections. The purpose of this study was to assess children's reactions to the administration of local anesthetic injection in the mandible and in the maxilla, and to study their sensation of pain after each type of injection. Twenty-six children between the ages of 4 to 6 (mean age 5.3+/-0.7 years), and 34 children aged between 7 to 10 (mean age 8.1+/-1.1 years,) who were undergoing dental treatment in a pediatric dental clinic, were selected for this study. A random crossover design was used. Each patient was randomly assigned to receive either maxillary infiltration or mandibular block on the first visit, and the remaining local anesthesia on the second visit. During the injection, the modified Behavioral Pain Scale, was used. It comprised the following parameters: a) facial display, b) arm/leg movements, c) torso movements, and d) crying. Immediately after administering the local anesthesia, children were asked to rate their feeling according to the Facial Affective Scale. The children in each group responded positively to both techniques revealing that there was no difference in either one. Subjective and objective evaluation disclosed no difference when mandibular block was administered during the first or second visit. Regarding the objective evaluation, in all parameters, more children reacted positively during administration of mandibular block than during maxillary infiltration. a) mandibular block and maxillary infiltration are similarly accepted by children when first administered, and b) children may feel inconvenience or pain and react by crying, yet may report a positive feeling in general.

Q: JSON formatter in your least favorite language Just joking guys, Brainfuck is an awesome, challenging language. I've tested the following code with bf-x86 compiler and rather big JSON file. I believe code is fully functional on a valid (!) JSON input. That's my second JSON formatter and my first code in Brainfuck. I know nothing about best practices and code style, though I've tried to do my best in both parts. Points of interest: code style and formatting value of comments value of used algorithms and preferable alternatives The heart of a program is a reading loop with a switch statement: #!/usr/bin/brainduck This program is a JSON formatter It takes a valid(!) JSON input and outputs formatted JSON Memory layout used: 0 input 1 input copy 2 switch flag 3 input copy for switch 4 indent 5 indent copy 6 indent copy Zero separated strings 7 zero 8 placeholder ? zero ? JSON specific chars ? zero ? "while inside string" memory Zero separated strings Filling placeholder " " (two spaces) >>>>>>> > >++[-<++++++++++++++++>]< > >++[-<++++++++++++++++>]< >zero Filling JSON specific chars after placeholder > 0a \n ++++++++++ > 20 space >[-]++[-<++++++++++++++++>]< >zero Back to cell 0 <[<]<[<]<<<<<<< Initial input , while input [ Input in cell 0 already Zeroing memory in cells 1 2 3 >[-]>[-]>[-]<<< Copying input to cells 1 3 [- >+< >>>+<<< ] switch flag = on >>+ > The Switch switch cell 3 \t ---------[ \n -[ \r ---[ space -------------------[ " --[ comma ----------[ : --------------[ ( square bracket ---------------------------------[ ) square bracket --[ { ------------------------------[ } -- default [[-]<- in each switch case <.> outputs current char >] case '}' <[- Newline >>>>>>[>]>. Back to cell 2 [<]<[<]<<<<< Decrementing indent >>- Copying indent [->+>+<<] Placeholders >>[->>[.>]<[<]<] Copying indent back <[-<+>] Back to cell 2 <<< Closing brace <.> ]>] case '{' <[- Opening brace <.> Newline >>>>>>[>]>. Back to cell 2 [<]<[<]<<<<< Incrementing indent >>+ Copying indent [->+>+<<] Placeholders >>[->>[.>]<[<]<] Copying indent back <[-<+>] Back to cell 2 <<< ]>] case closing square bracket <[- Newline >>>>>>[>]>. Back to cell 2 [<]<[<]<<<<< Decrementing indent >>- Copying indent [->+>+<<] Placeholder >>[->>[.>]<[<]<] Copying indent back <[-<+>] Back to cell 2 <<< Closing bracket <.> ]>] case opening square bracket <[- Opening bracket <.> Newline >>>>>>[>]>. Back to cell 2 [<]<[<]<<<<< Incrementing indent >>+ Copying indent [->+>+<<] Placeholders >>[->>[.>]<[<]<] Copying indent back <[-<+>] Back to cell 2 <<< ]>] case ':' <[- Colon <.> Space >>>>>>[>]>>. Back to cell 2 [<]<[<]<<<<< ]>] case comma <[- Comma <.> Newline >>>>>>[>]>. Back to cell 2 [<]<[<]<<<<< Copying indent >>[->+>+<<] Placeholder >>[->>[.>]<[<]<] Copying indent back <[-<+>] Back to cell 2 <<< ]>] case '"' <[- Quotation mark <.> Going to string memory after JSON chars >>>>>>[>]>[>]> Memory layout: 0 string loop flag 1 switch flag 2 string input 3 escape flag 4 temp Zeroing memory [-]>[-]>[-]>[-]>[-]<<<< string loop flag = on + while string loop flag [ Echo string char >>,. if escape flag >>[-]+<[ escape flag = off [-] >-< ] else >[- switch cell 2 <<<+> " ----------------------------------[ \ ---------------------------------------------------------- default [<->[-]] case '\' <[- escape flag = on >>+<< ]>] case '"' <[- Unescaped quote ends string string loop flag = off <-> ]> >> ]<<<< ] Back to switch cell <<[<]<[<]<<<<< ]>] Skipping original formatting case space <[-]>] case '\r' <[-]>] case '\n' <[-]>] case '\t' <[-]> Back to cell 0 <<< Next char , ] Code minification produces 923 bytes long program. With help of Brainfuck shebang or compiler it can be pretty usable console application: $ cat example.json {"foo":"bar","baz":["\"rogue\" {s}tring",1,2,3.2e1]],"t":true,"f":false,"n":null} $ $ ./pretty-json < example.json { "foo": "bar", "baz": [ "\"rogue\" {s}tring", [ 1, 2, 3.2e1 ] ], "t": true, "f": false, "n": null } Well, good luck, you guys! A: Your code is impressingly well structured and easy to follow, thanks to its comprehensive documentation. The first thing I noticed that I would do differently is when initializing the space character. Your code reads: > 20 space >[-]++[-<++++++++++++++++>]< You can leave out the [-] since the memory is zeroed out when the process starts. There are some instances where adjacent <> or >< can be eliminated, but that job should be left to the compiler, since these are well-known optimization techniques. Having code that expresses its intention clearly is more important than doing the compiler's job. Back to cell 0 <[<]<[<]<<<<<<< Since there are exactly 2 JSON-specific characters, I would have replaced the first [<] with the simpler <<. This applies to the other situations as well where the code skips over this zero-terminated string. When I saw the placeholder string, I thought about storing the indentation string as a plain number instead. I don't know whether this would make the code simpler overall. Did you try that? Representing the indentation string as a number would additionally prevent it from consisting of characters other than spaces and tabs. Having other characters could produce malformed JSON. Instead of naming it "placeholder", a more accurate name would be "indentation string", but that could easily be confused with the "indent", which then would have to be named "indentation depth". Memory cells 5 and 6 both contain the "indent copy". This could be documented a little more detailed, to prevent confusion. It would be nice to know at which points in time each of these cells contains valid data. In the two switch blocks you rely on the VM allowing numeric underflow, which is not guaranteed. I would have preferred code that deals with this situation in the most portable manner, but that would have been much more complicated, I guess. in each switch case <.> outputs current char This line confused me since it embeds code into a string that otherwise looks like a comment. You didn't state in your description that you intended to participate in the Underhanded Brainfuck Contest, and the rest of your code doesn't look that way. Or does it? That's hard to tell. Newline >>>>>>[>]>. Back to cell 2 [<]<[<]<<<<< I would have combined these two lines into a single line to keep the data pointer on cell 2 consistently, thereby making the comment in the second line redundant. As I already mentioned above, I would replace the first [<] with a simple <, to make it symmetric with the single > in the line above. I like the shortcut you took for skipping the string escapes, even if that means that the code does not mirror each syntactical rules of the JSON format on its own. The gain in code simplicity is worth more in this case. Overall, it's a really good example of careful program design, memory management, algorithms, design patterns and efficiency.

Ce lundi, le tribunal administratif de Nice a ordonné au maire Christian Estrosi d'autoriser, dans les cinq jours, l'ouverture d'une mosquée financée par l'Arabie saoudite à laquelle l'élu s'oppose farouchement. La justice, qui avait été saisie ce vendredi en référé par l'association culturelle et cultuelle En Nour, gestionnaire de la mosquée, a considéré que « la condition d'urgence était remplie du fait de la capacité insuffisante des salles de prière musulmanes à Nice » et « de la période de ramadan » qui a débuté lundi. Elle estime par ailleurs que le refus du maire de Nice d'autoriser l'ouverture porte « une atteinte grave et manifestement illégale à la liberté de culte ». Le tribunal relève en outre que la commission d'accessibilité et la commission de sécurité communales avaient émis des avis favorables à l'ouverture au public des locaux et que le maire de Nice « ne s'opposait pas à l'ouverture de la salle de culte pour des motifs relatifs au respect de la législation », mais « compte tenu de ses doutes sur l'origine du financement des travaux et de sa crainte de prêches dangereux » : cela constitue, pour le juge, « un détournement de procédure ». « Je ne ferai courir aucun risque à ma ville » Christian Estrosi a indiqué dans un communiqué avoir « décidé de se pourvoir immédiatement en cassation auprès du Conseil d'État ». « En tout état de cause, je ne ferai courir aucun risque à ma ville et nous n'exécuterons une décision de justice que lorsqu'elle sera devenue définitive », indique-t-il. Un tel recours n'est toutefois pas suspensif. « C'est extraordinaire et en même temps c'était prévisible », s'est de son côté félicité l'ancien conseiller municipal Razak Fetnan, proche des dirigeants de la mosquée : « Il y avait un enjeu de justice et en même temps de reconnaissance des Français de confession musulmane. » En avril, Christian Estrosi avait fait adopter par son conseil municipal des délibérations l'autorisant notamment à attaquer devant la justice administrative le préfet des Alpes-Maritimes, à qui il reprochait de refuser de prendre un arrêté portant déclaration d'utilité publique (DUP) pour un projet de crèche qu'il souhaitait implanter à la place de l'édifice religieux. Le préfet avait toutefois demandé la mise en place, avant le 1er août, d'une direction collégiale à la tête de l'association cultuelle devant gérer la mosquée et le transfert à cette association, via un legs, de la propriété des locaux qui appartiennent au ministre saoudien des Cultes.

Introduction {#s1} ============ The Mediterranean basin is ranked first among regions in the export of fresh market citrus fruits (FAO, [@B33]). This region has some adverse biotic and abiotic conditions that affect citrus cultivation. The rootstock is a key element for citrus production because it can confer tolerance to these constraints. The graft-transmissible disease tristeza, caused by the *Citrus tristeza virus* (CTV), is one of the most important limiting factors and has a strong economic impact that necessitates dramatic changes in citrus production (Cambra et al., [@B15]; Moreno et al., [@B77]). The damage brought by CTV is caused by the scion-rootstock combination, the CTV strain, and the environmental conditions (Ballester-Olmos et al., [@B6]). Most agricultural lands in the Mediterranean basin have two soil limiting conditions: alkalinity and, to a lesser extent, salinity. Soil alkalinity was traditionally managed using sour orange (SO) or *Citrus aurantium* L. as rootstock. Nevertheless, SO is very sensitive to Quick Decline disease caused by CTV. This limiting condition has forced the use of alternative rootstocks despite the highly desirable agronomic traits that SO induces to citrus trees. Among the main rootstocks, Cleopatra mandarin (*C. reshni* Hort. ex Tan.) and *C. macrophylla* W. (CM) are tolerant to calcareous soils, although CM is sensitive to severe CTV strains (Cambra et al., [@B15]). One of the main rootstocks used worldwide is Carrizo citrange (CC) \[*C. sinensis* (L.) Osb. × *Poncirus trifoliata* (L.) Raf.\] which is tolerant to CTV but sensitive to iron chlorosis in alkaline soils (Castle et al., [@B17]). Citrus is among the most salt-sensitive perennial crops (Maas, [@B72]). The tolerance of citrus trees to soil salinity depends greatly on the rootstock ability to restrict ion transport to the scion and this is a heritable trait (Walker, [@B118]). Cleopatra mandarin and CM are suited for saline soils because they restrict ion transport to the aerial part, whereas CC is sensitive to this condition as it quickly accumulates the ions and reaches toxic concentrations (Gomez-Cadenas et al., [@B43]). CC is considered a good rootstock for inducing high yield, big fruit size and high fruit quality to the grafted variety. CM induces vigor to citrus trees, early bearing, very high yield, and has an excellent adaptation to calcareous and saline soils. However, this rootstock is sensitive to cold temperatures, moderately sensitive to CTV, and reduces fruit quality. Therefore, CC and CM, used as citrus rootstocks, have complementary characteristics. Rootstock breeding programs are carried out by sexual or somatic hybridization. The recovery of rootstock hybrids by sexual hybridization is hampered by citrus reproductive biology (apomixis) and the high heterozygosity of the citrus genomes. Most citrus genotypes are apomictic, except for citrons (*C. medica* L.), pummelos (*C. maxima* (L.) Osb.), clementines (*C. clementina* Hort. ex Tan.), and some mandarin hybrids. The seeds of non-apomictic genotypes generally contain only one sexual embryo, whereas the seeds of apomictic genotypes generally contain one sexual embryo and one or more nucellar embryos. The development of nucellar embryos in citrus apomictic genotypes can be initiated before fertilization, and the competition between the zygotic and nucellar embryos often results in the failure of the zygotic embryos (Wakana and Uemoto, [@B117]; Koltunow, [@B67]). In addition, the high heterozygosity level of citrus species (Herrero et al., [@B60]; Ollitrault et al., [@B90]; Barkley et al., [@B7]) produces a wide segregation pattern of parental traits in the progenies. The probability of having individuals that combine all the desired traits is usually very low. Therefore, a large number of individuals in these progenies need to be evaluated to find and select those that combine the desirable characteristics of the two parents. In contrast, somatic hybridization by protoplast fusion allows combining the genomes of both parents in only one genotype regardless of their level of heterozygosity, adding their dominant complementary characters (Ollitrault et al., [@B93]) and to overcome the sexual incompatibility between parents. This methodology is used worldwide for rootstock breeding (Grosser et al., [@B51]; Ollitrault et al., [@B88]; Dambier et al., [@B28]; Grosser and Gmitter, [@B48]). Somatic hybridization in citrus is performed by the fusion of protoplasts derived from leaf mesophyll with protoplasts derived from embryogenic callus. In citrus, it has not yet been possible to regenerate plants from leaf protoplasts. Protoplasts isolated from embryogenic callus or leaf protoplasts that incorporate the mitochondrial genome from callus protoplasts are the only ones that have the ability to produce embryos and subsequently, plants (Kobayashi et al., [@B66]; Grosser and Gmitter, [@B47]; Guo et al., [@B56]). Therefore, it is necessary to have different callus lines of rootstock genotypes with favorable traits for the establishment of rootstock breeding programs based on somatic hybridization. Embryogenic callus can be easily obtained in apomictic mandarins and sweet oranges by *in vitro* ovule culture (Rangan et al., [@B100]; Ollitrault et al., [@B86]; Perez et al., [@B99]). However, it can be very difficult or has never been achieved in other genotypes that are essential for rootstock breeding such as SO, *P. trifoliata*, and the interspecific hybrids citranges and citrumelos (*C. paradisi* Macf. × *P. trifoliata*). Selective agents are not needed to select citrus somatic hybrids after somatic hybridizations. Instead, potential hybrids are identified among all the regenerated plants by ploidy and genetic composition analyses. The genetic analysis is often performed using a small number of molecular markers (Guo et al., [@B56]; Dambier et al., [@B28]; Grosser and Gmitter, [@B48]) that display the complementary allelic configuration of the parents disregarding their homogeneous distribution in the different linkage groups (LGs), hence impeding a detailed study of chromosome stability. Besides molecular analysis, a large number of plants is required for detailed physiological and agronomical evaluations of the somatic hybrids to determine their potential utility as new rootstocks (Dambier et al., [@B28]). Somatic hybrids go through a long juvenile phase, which often takes more than 6 years, delaying the production of seeds to obtain the plants needed to carry out the experiments (Krajewski and Rabe, [@B68]). This citrus juvenile phase is one of the main constraints in rootstock breeding programs. However, *in vitro* micropropagation allows the generation of a large number of clonal plants in a short time, avoiding the delay that juvenility would impose, which is a great advantage for rootstock breeding programs (Bordas et al., [@B11]). In this study, the genetic composition of two somatic hybrids, obtained by CM and CC protoplast fusion (Pensabene-Bellavia et al., [@B98]), was analyzed using single sequence repeats (SSR), single nucleotide polymorphism (SNP), and insertion or deletion (InDel) markers. Both somatic hybrids were morphologically described and their behavior was evaluated under salinity, iron deficiency, and CTV inoculation. The main objective of this study was to perform an early and detailed evaluation of the somatic hybrids to determine their potential utility as rootstocks for the Mediterranean citrus industry. Materials and methods {#s2} ===================== Plant material and greenhouse conditions ---------------------------------------- Diploid CC and CM and allotetraploid somatic hybrids SMC-58 and SMC-73 were used for the experiments. Diploid CC and CM seeds were collected from the Citrus Germplasm Bank of pathogen-free plants at the Instituto Valenciano de Investigaciones Agrarias (IVIA) (Navarro et al., [@B82]; Navarro, [@B81]) and somatic hybrids SMC-58 and SMC-73 were recovered by protoplast fusion isolated from CM embryogenic callus and CC leaf mesophyll leaves (Pensabene-Bellavia et al., [@B98]). The somatic hybrids were micropropagated by Agromillora Research S.L. using the methodology described by Bordas et al. ([@B11]). The seeds of CC and CM were germinated in a greenhouse using a sterile substrate composed of peat, coconut fiber, and perlite (50:25:20:5), supplemented with 1.38 g kg^−1^ of calcium superphosphate, and irrigated twice weekly with the Hoagland and Arnon ([@B61]) nutrient solution modified for citrus (5 mM Ca(NO~3~)~2~, 1.4 mM KNO~3~, 2 mM MgSO~4~, 0.6 mM H~3~PO~4~, 20 μM Fe-EDDHA, 7.6 μM ZnSO~4~·7H~2~O, 0.50 μM CuSO~4~·5H~2~O, 50 μM H~3~BO~3~, 0.50 μMMoO~3~, and 54 μM MnSO~4~·H~2~O). The pH of the nutrient solution was adjusted to 6.0 with 1 M of KOH or H~2~SO~4~. After eight weeks, homogeneous seedlings, which were selected based on size uniformity, were transplanted individually to opaque plastic 0.5 L pots filled with a substrate composed of peat, coconut fiber, sand, and perlite (40:25:25:10). Seedlings and micropropagated plants of similar size were then randomized over the experimental area. A row of plants, not included in the experiment, was placed around the perimeter as a border. Plants were grown under greenhouse conditions with supplementary light (250 μmol m^−2^ s^−1^, 400--700 nm) to extend the photoperiod to 16 h. The temperature ranges were 16--18°C at night and 26--28°C during the day. Relative humidity (RH) was maintained at around 80%. Genetic characterization ------------------------ Nuclear genomes were characterized using 23 SSR and 59 SNP markers selected from the 9 LG of the Clementine genetic map (Ollitrault et al., [@B91]; Tables [1](#T1){ref-type="table"}--[4](#T4){ref-type="table"}). Cytoplasmic genomes were characterized with 3 mitochondrial InDel markers, 5/*rrn*18-1 (Duminil et al., [@B30]), *nad*2/4-3, and *nad*7/1-2 (Froelicher et al., [@B37]), and 5 chloroplastic SSR markers: NTCP7, NTCP9 CCMP2, CCMP5 (Cheng et al., [@B20]), and CCMP6 (Bryan et al., [@B12]; Weising and Gardner, [@B121]; Table [4](#T4){ref-type="table"}). All the analyses were performed in the somatic hybrids, the parents (CM and CC), and the CM embryogenic callus used for protoplast fusion. For these characterizations, genomic DNA was isolated using the methodology described by Dellaporta et al. ([@B29]) with few modifications (0.5 M EDTA, pH 8.0, 1 M Tris-HCl, pH 8.0, 5 M NaCl, 2% MATAB, 1% PEG 6000 and 0.5% Na~2~SO~3~) and was performed using different DNA extractions from leaves of different branches of both somatic hybrids. ###### Molecular markers analyzed indicating the type of marker, locus name, linkage groups (LGs) 1 and 2 and location within LG in centimorgans (cM), bibliographic reference in the literature, and GeneBank accession. **Type** **Locus** **Location** **References** ---------- --------------------------------------------- -------------- ---------------- --------------------------- ---------- SNP [^\*^](#TN1){ref-type="table-fn"}CiC4827-01 1 20.5 Ollitrault et al., [@B92] ET072918 SNP CiC2110-01 1 28.8 Ollitrault et al., [@B92] ET099643 SSR CiBE5720 1 58.5 Ollitrault et al., [@B85] ET082224 SNP [^\*^](#TN1){ref-type="table-fn"}CiC4581-01 1 63.7 Ollitrault et al., [@B92] ET109034 SNP [^\*^](#TN1){ref-type="table-fn"}ACO-P353 1 80.4 Ollitrault et al., [@B91] JX630066 SNP ACO-C601 1 83.4 Ollitrault et al., [@B91] JX630065 SNP CiC0599-01 1 102.4 Ollitrault et al., [@B92] ET093125 SNP TSC-C80 1 111.6 García-Lor et al., [@B38] JX630084 SSR JK-taa15 1 119.7 Kijas et al., [@B65] none SNP [^\*^](#TN1){ref-type="table-fn"}F3H-M309 2 19.6 García-Lor et al., [@B38] JX630066 SNP [^\*^](#TN1){ref-type="table-fn"}F3H-C341 2 20.0 García-Lor et al., [@B38] JX630067 SNP [^\*^](#TN1){ref-type="table-fn"}F3H-P30 2 20.0 García-Lor et al., [@B38] JX630066 SNP [^\*^](#TN1){ref-type="table-fn"}PEPC-M316 2 32.6 García-Lor et al., [@B38] JX630067 SNP PEPC-C328 2 32.6 García-Lor et al., [@B38] JX630067 SSR mCrCIR07D05 2 75.6 Cuenca et al., [@B25] FR677574 SNP SOS1-M50 2 78.5 García-Lor et al., [@B38] JX630068 SNP [^\*^](#TN1){ref-type="table-fn"}CiC3712-01 2 93.9 Ollitrault et al., [@B92] ET079481 SNP CCC1-P727 2 110.9 García-Lor et al., [@B38] JX630069 SNP [^\*^](#TN1){ref-type="table-fn"}CCC1-M85 2 110.9 García-Lor et al., [@B38] JX630069 SSR JK-TAA41 2 131.8 Kijas et al., [@B65] none SNP [^\*^](#TN1){ref-type="table-fn"}PKF-C64 2 131.2 García-Lor et al., [@B38] JX630076 SNP TRPA-M593 2 132.3 García-Lor et al., [@B38] JX630070 SNP PKF-M186 2 133.5 García-Lor et al., [@B38] JX630076 *Non-polymorphic markers*. ###### Molecular markers analyzed indicating the type of marker, locus name, linkage groups (LGs) 3, 4, and 5 and location within LG in centimorgans (cM), bibliographic reference in the literature, and GeneBank accession. **Type** **Locus** **Location** **References** ---------- --------------------------------------------- -------------- ---------------- --------------------------- ------------ SNP INVA-M437 3 30.2 García-Lor et al., [@B38] JX630071 SNP MDH-M519 3 34.8 García-Lor et al., [@B38] JX630072 SNP [^\*^](#TN2){ref-type="table-fn"}MDH-MP69 3 34.8 García-Lor et al., [@B38] JX630072 SNP [^\*^](#TN2){ref-type="table-fn"}CiC4681-02 3 92.8 Ollitrault et al., [@B92] ET109640 SNP NCED3-M535 3 101.3 García-Lor et al., [@B38] JX630086 SNP CiC5796-12 3 109.9 Ollitrault et al., [@B92] ET0822752 SNP ATMR-M728 3 141.9 García-Lor et al., [@B38] JX630073 SNP ATMR-C372 3 141.9 García-Lor et al., [@B38] JX630073 SSR Ci08A10 3 144.9 Froelicher et al., [@B37] AJ567414 SNP CHS-M183 3 167.3 García-Lor et al., [@B38] JX630074 SNP [^\*^](#TN2){ref-type="table-fn"}CHS-P57 3 167.3 García-Lor et al., [@B38] JX630074 SNP [^\*^](#TN2){ref-type="table-fn"}CiC4240-04 4 7.1 Ollitrault et al., [@B92] ET106812 SNP CHI-M598 4 11.0 García-Lor et al., [@B38] JX630075 SSR mCrCIR07D06 4 16.3 Cuenca et al., [@B25] FR677581 SNP CiC2840-01 4 17.0 Ollitrault et al., [@B92] ET103429 SNP CiC3740-02 4 43.9 Ollitrault et al., [@B92] ET079647 SSR mCrCIR03G05 4 75.1 Cuenca et al., [@B25] FR677578.1 SNP [^\*^](#TN2){ref-type="table-fn"}CiC6213-07 4 85.5 Ollitrault et al., [@B92] ET085253 SNP CiC1380-05 5 17.2 Ollitrault et al., [@B92] ET072553 SNP CiC5788-16 5 41.5 Ollitrault et al., [@B92] ET082679 SNP [^\*^](#TN2){ref-type="table-fn"}CiC5842-02 5 77.3 Ollitrault et al., [@B92] ET083106 SNP [^\*^](#TN2){ref-type="table-fn"}NADK2-M285 5 86.0 García-Lor et al., [@B38] JX630077 SSR mCrCIR06A12 5 98.7 Froelicher et al., [@B37] AM489742 SNP DFR-M240 5 105.7 García-Lor et al., [@B38] JX630074 *Non-polymorphic markers*. ###### Molecular markers analyzed indicating the type of marker, locus name, linkage groups (LGs) 6 and 7 and location within LG in centimorgans (cM), bibliographic reference in the literature, and GeneBank accession. **Type** **Locus** **Location** **References** ---------- ---------------------------------------------- -------------- ---------------- --------------------------- ---------- SSR [^\*^](#TN3){ref-type="table-fn"}mCrCIR04H09 6 0.0 Ollitrault et al., [@B91] FR692370 SNP CiC4356-06 6 6.2 Ollitrault et al., [@B92] ET107540 SSR MEST132 6 26.9 Aleza et al., [@B3] DY276930 SSR CiBE4818 6 28.3 Ollitrault et al., [@B85] ET110604 SSR CiBE0733 6 42.2 Ollitrault et al., [@B85] ET094202 SNP [^\*^](#TN3){ref-type="table-fn"}CiC2128-01 6 61.2 Ollitrault et al., [@B92] ET111354 SSR mCrCIR02B11 6 69.2 Ollitrault et al., [@B91] FR692358 SNP PSY-M30 6 69.7 García-Lor et al., [@B38] JX630080 SNP PSY-C461 6 69.7 García-Lor et al., [@B38] JX630080 SNP CiC3056-02 6 70.5 Ollitrault et al., [@B92] ET075329 SSR [^\*^](#TN3){ref-type="table-fn"}CiBE6256 6 84.6 Ollitrault et al., [@B85] ET085615 SNP [^\*^](#TN3){ref-type="table-fn"}AocM290 6 85.9 Ollitrault et al., [@B92] JX630079 SNP AocC593 6 85.9 Ollitrault et al., [@B92] DY293375 SSR MEST123 6 93.0 Aleza et al., [@B3] DY276100 SSR CiBE5866 6 99.8 Ollitrault et al., [@B85] ET083232 SSR mCrCIR07E05 7 13.1 Froelicher et al., [@B37] AM489749 SNP [^\*^](#TN3){ref-type="table-fn"}CiC1444-03 7 13.6 Ollitrault et al., [@B92] ET073216 SNP DXS-M618 7 40.7 García-Lor et al., [@B38] JX630082 SNP DXS-C545 7 40.7 García-Lor et al., [@B38] JX630082 SNP FLS-P129 7 46.0 García-Lor et al., [@B38] JX630083 SSR [^\*^](#TN3){ref-type="table-fn"}mCrCIR03E06 7 75.1 Ollitrault et al., [@B91] FR692363 SSR Ci07C07 7 98.0 Froelicher et al., [@B37] AJ567409 *Non-polymorphic markers*. ###### Molecular markers analyzed indicating the type of marker, locus name, linkage groups (LGs) 8 and 9 and location within LG in centimorgans (cM), bibliographic reference in the literature, and GeneBank accession. **Type** **Locus** **Location** **References** ---------- ----------------------------------------------- --------------- --------------------------- --------------------------- ---------- SSR mCrCIR07B05 8 31.7 Froelicher et al., [@B37] AM489747 SSR CiBE0214 8 40.4 Ollitrault et al., [@B85] ET088913 SNP CiC5164-02 8 45.6 Ollitrault et al., [@B92] ET111943 SNP CiC1749-05 8 103 Ollitrault et al., [@B92] ET097636 SNP [^\*^](#TN4){ref-type="table-fn"}CiC4876-07 9 2.7 Ollitrault et al., [@B92] ET080580 SNP [^\*^](#TN4){ref-type="table-fn"}CiC5087-01 9 15.9 Ollitrault et al., [@B92] ET111514 SSR mCrCIR07F11 9 49.6 Kamiri et al., [@B64] FR677567 SNP CiC2518-02 9 53.5 Ollitrault et al., [@B92] ET101955 SSR Ci08C05 9 55.1 Froelicher et al., [@B37] AJ567415 SNP [^\*^](#TN4){ref-type="table-fn"}LCYB-P736 9 78.9 García-Lor et al., [@B38] JX630084 SNP LCYB-M480 9 78.9 García-Lor et al., [@B38] JX630084 SNP HYB-M62 9 102.3 García-Lor et al., [@B38] AF315289 SNP HYB-C433 9 102.3 García-Lor et al., [@B38] JX630087 Indel *nad*2/4-3 Mitocondrial Froelicher et al., [@B37] Indel *[^\*^](#TN4){ref-type="table-fn"} nad*7/1-2 Mitocondrial Froelicher et al., [@B37] Indel [^\*^](#TN4){ref-type="table-fn"} 5/*rrn*18-1 Mitocondrial Duminil et al., [@B30] cpSSR CCMP2 Chloroplastic Cheng et al., [@B21] cpSSR CCMP5 Chloroplastic Cheng et al., [@B21] cpSSR CCMP6 Chloroplastic Cheng et al., [@B21] cpSSR NTCP7 Chloroplastic Cheng et al., [@B21] cpSSR [^\*^](#TN4){ref-type="table-fn"} NTCP9 Chloroplastic Cheng et al., [@B21] *Non-polymorphic markers*. SSR markers ----------- PCR amplifications were performed using Thermocycler ep gradient S (Eppendorf®, Germany) in 10 μL final volume, containing 0.8 U of *Taq* DNA polymerase (Fermentas®, Germany), 10 ng of citrus template DNA, 0.2 mM wellRED (Sigma®, Germany) dye-labeled forward primer, 0.2 mM non-dye-labeled reverse primer, 0.2 mM each dNTP, and PCR reaction buffer 10X composed of 750 mM Tris-HCl, pH 9.0, 50 mM KCl, 200 mM (NH~4~)~2~SO~4~, 1.5 mM MgCl~2~, and 0.0001% BSA. The cycling program was set as follows: denaturation for 5 min at 94°C followed by 40 repeats of 30 s at 94°C, 1 min at the annealing temperature of each primer pair, 45 s at 72°C, and a final elongation step of 4 min at 72°C. Capillary electrophoresis was carried out using a CEQ™ 8,000 Genetic Analysis System (Beckman Coulter Inc., USA). The PCR products were initially denatured for 2 min at 90°C, injected for 30 s at 2 kV, and subsequently separated for 35 min at 6 kV. Alleles were sized based on a DNA size standard (400 bp). The GenomeLab™ GeXP v.10.0 genetic analysis software was used for data collection. Allele dosage was calculated using MAC-PR (microsatellite DNA allele counting-peak ratio) method (Esselink et al., [@B31]), validated in citrus by Cuenca et al. ([@B25]). SNP markers ----------- Genetic analysis of SNP markers was performed using KASPar technology by LGCgenomics (<http://www.lgcgenomics.com>). Primers were designed by LGCgenomic from each SNP locus flanking sequence (approximately 50 nt on each side of the SNP). The KASPar genotyping system is a competitive allele-specific dual Förster Resonance Energy Transfer (FRET)-based assay for SNP genotyping. A detailed description of specific conditions and reagents can be found in Cuppen ([@B26]). Identification of allele dosage in heterozygous somatic hybrids was carried out based on the relative allele signals described by Cuenca et al. ([@B24]) and Aleza et al. ([@B2]). Identification of the genetic structure of somatic hybrids and their parents ---------------------------------------------------------------------------- Allelic configurations of the somatic hybrids SMC-58 and SMC-73 and their parents, CM and CC, were determined using the SSR and SNP genotyping data. For markers showing different alleles for the parents (A~1~A~2~ + A~3~A~4~, and A~1~A~2~ + A~3~A~3~), the somatic hybrids genotype was directly annotated. In the case of parents sharing alleles for a given marker (A~1~A~2~ + A~2~A~2~ o A~1~A~2~ + A~2~A~3~), the allelic configuration of the somatic hybrids was based on the estimated allele dosage. Morphologic characterization ---------------------------- Plant morphology was evaluated on 9-month-old plants that were cultivated in the greenhouse under the above described conditions. Twelve plants of CC, CM, and the somatic hybrids (SMC-58 and SMC-73) were chosen for performing the evaluation. Measurements were taken on plant height, internodal length, and leaf number. Leaf greenness of 3 mature leaves was measured in each plant using a SPAD device (Minolta®, Japan) and the mean value of 5 readings was taken. The length (l) and width (w) of the main leaflet were also registered in the same leaves. Leaf index, representative of leaf shape, was calculated from l/w relations. Additionally, all the relevant International Plant Genetic Resources Institute (IPGRI) descriptors for each genotype were annotated (IPGRI, [@B63]). Iron chlorosis tolerance evaluation ----------------------------------- Twelve homogeneous plants of each genotype were trimmed to a single stem and transplanted to 0.5 L pots and then grouped into two groups based on substrate type. Control substrate was composed of peat and sand (2:3) with added 0.4% (w/v) Ca(H~2~PO~4~)~2~, whereas chlorosis-inducing substrate had additional 10% (v/v) of CaCO~3~ added to the mix. Plants were previously acclimated and were maintained for 4 weeks under the irrigation and climatic conditions previously described. Any new lateral branching shoots were detected and eliminated every 3 days to focus the growth in a single shoot. A plastic ring was placed on top of the stem to differentiate the newly developed biomass prior to the initiation of irrigation treatments. Plants growing on normal substrate were irrigated with the solution previously described, which contained 20 μM Fe-EDDHA, and were chosen as the control treatment (Ct). Plants growing on the chlorosis-inducing substrate were irrigated with a similar solution than Ct treatment but deficient in iron (2 μM Fe-EDDHA) and containing carbonates (10 mM NaHCO~3~). These conditions were considered the chlorosis-inducing treatment (Ch). Plants were randomized over the experimental area with a guard row and irrigated twice weekly for 10 weeks. After treatments, the new shoot was taken from each plant, rinsed with deionized water, and separated into leaves and stems. They were then fresh-weighed individually and dried in a forced draft oven at 70°C for 48 h until constant dry weight (DW) was obtained. Plant growth was measured using the shoot (leaf and stem) DW and iron content analysis was performed using leaves. The chlorophyll content in leaves was monitored by measuring changes in leaf greenness with a SPAD chlorophyll meter (Minolta, Japan). Two fully expanded leaves per plant were marked with labels and five readings were taken per leaf, avoiding the midrib, at the initial and final days of the trial period. Leaf greenness index was calculated as the ratio of final/initial SPAD readings. Values below 1 indicate greenness descent over the trial period (Castle et al., [@B17]). The iron concentration was measured from dry tissues (0.5 g) that were burnt in a muffle furnace for 12 h at 550°C. Iron was extracted with 2% nitric acid (Hiperpur, Panreac) in an ultrasonic bath (Fungilab®, Spain) for 30 min at 40°C and the concentration was measured using atomic absorption spectrometry in an ASS Analyst200 (Perkin Elmer®, USA). Salinity tolerance evaluation ----------------------------- Forty homogeneous plants of each genotype trimmed to a single stem were selected and divided into groups that were irrigated with the basal nutrient solution described above. Either 0 (control, Ct) or 40 mM NaCl (salt-treated, +S) was added to each group. Pots were irrigated with 400 mL of solution per pot every 3 days. Excess solution was drained out of the pot to avoid salt accumulation in the substrate. A plastic ring was placed at the top of the stems to differentiate the newly developed biomass before irrigation treatments were initiated. Leaf gas exchange parameters were registered weekly using a portable infra-red gas analyzer LCpro+ (ADC Bioscientific Ltd., UK). Net CO~2~ assimilation (*A*~CO2~) and transpiration (*E*) rates were monitored between 10 a.m. and 2 p.m. The measurements were taken in two mid-stem leaves of 9 plants per treatment and genotype by taking 3 consecutive measurements on each leaf. Photosynthetically active radiation (PAR) at the leaf surface was adjusted to 1,000 μmol m^−2^ s^−1^, which exceeds the saturating value for citrus, and atmospheric CO~2~ concentration was not manipulated. Relative humidity and temperature in the greenhouse were recorded during each measurement event and were maintained by the conditions previously described. Dry weight of new leaves, leaf abscission percentage, and leaf burned area percentage were evaluated on leaves after 20 days of salt treatment and 5 mid-stem leaves, roots, and stems were sampled for analysis. Plant organs were rinsed with deionized water and 10% (w/v) Tween 20 (Sigma-Aldrich Co., Germany) and dried in a forced draft oven at 65°C for 48 h until reaching constant DW. Dried samples were crushed separately in a hammer-mill and were stored at room temperature to determine iron concentration in different organs. Chloride (Cl^−^) was determined by silver ion titration using a Corning 926 chloridometer (Corning®) as described by Gilliam ([@B41]). Sodium (Na^+^) and potassium (K^+^) concentration were determined by inductively coupled plasma atomic emission spectroscopy (ICP-AOES iCAP 6000, Thermo Scientific). Samples (0.5 g) were pre-digested overnight with 2% HNO~3~ and 0.1% (w/v) Triton-X 100 (Sigma-Aldrich Co.) prior to processing on a digestion block at 120°C. The digestion tubes were then removed and cooled at room temperature. 2.0 mL of a 70% ultra-trace-metal-grade HClO~4~ was then added to the sample and heated at 220°C until white fumes were produced. Digest was diluted to a 25 mL with ultrapure water (Campbell and Plank, [@B16]) and filtered in n° 1 Whatman paper. CTV tolerance evaluation ------------------------ Six plants of CC, CM, SMC-58, and SMC-73 were inoculated by bark grafting with CTV T388 strain (+CTV), which is a very aggressive strain to CM (Moreno et al., [@B78]; Ballester-Olmos et al., [@B6]). The inoculum was obtained from the IVIA citrus virus and virus-like collection. After 25 days, plants were pruned leaving 5 cm above the inoculum to induce a new shooting. Control treatment (Ct) was applied to 3 plants that were not inoculated with the virus. The plants were cultivated under the above-described greenhouse conditions for 12 months. Plant size and the weight of roots and aerial parts were registered, and CTV symptoms were evaluated in leaves and stem wood. Statistical analysis -------------------- Data were subjected to analysis of variance (ANOVA). Means were separated using Duncan\'s multiple range test at *P* \< 0.05 with the Statgraphics Plus, version 5.1 (Statistical Graphics, Englewood Cliffs) software. Results {#s3} ======= Genetic characterization ------------------------ Genetic analysis of the CM callus used for protoplast fusion did not show any differences when compared to the tree of the IVIA Citrus Germplasm Bank for the 34 SSR markers analyzed (Pensabene-Bellavia, [@B97]). Somatic hybrids SMC-58 and SMC-73 and their parents (CC and CM) were analyzed using 90 markers (82 from the nuclear genome and 8 from the cytoplasmic genome). Fifty-nine of the markers analyzed in nuclear genome were SNPs, whereas 23 were SSRs. All of them were distributed on the 9 LGs of the reference genetic citrus map (Ollitrault et al., [@B91]) with a coverage between 5 and 15 markers per LG. Thirty six of the fifty-nine SNPs analyzed were polymorphic between parents, whereas polymorphism was found in 20 of the 23 SSRs analyzed (Tables [1](#T1){ref-type="table"}--[4](#T4){ref-type="table"}). The LG 1 was analyzed with 7 polymorphic markers, consisting of 5 SNPs and 2 SSRs (Table [5](#T5){ref-type="table"}). Somatic hybrids SMC-58 and SMC-73 displayed allelic configurations that correspond with the addition of both genome parents as seen with the JK-TAA15 SSR marker (Figure [1A](#F1){ref-type="fig"}) or the ACO-C601 SNP marker (Figure [1B](#F1){ref-type="fig"}). The LG 2 was analyzed using 5 SNP markers and 2 SSRs that were polymorphic between parents. The addition of the alleles from both parents was observed in the two somatic hybrids for all the analyzed markers, except for the JK-TAA41 SSR marker (Figure [2A](#F2){ref-type="fig"}) that showed the loss of the 142 nt allele from CC in both somatic hybrids. The LG 3 was analyzed using 6 SNPs and 1 SSR marker that were polymorphic between parents. Somatic hybrids combined all the alleles from each parent, except for Ci08A10 SSR marker (Figure [2B](#F2){ref-type="fig"}) that lost the 156 nt allele from CC in both somatic hybrids. The LG 4 was analyzed using 3 SNPs and 2 SSR markers (Table [6](#T6){ref-type="table"}) and both somatic hybrids combined all the parental alleles. Figure [3A](#F3){ref-type="fig"} shows results obtained for Ci07D06 SSR marker as an example. The LG 5 was analyzed using 3 SNPs and 1 SSR marker and results did not show allelic losses in these loci. The LG 6 was analyzed using 5 SNPs and 6 SSR markers. Somatic hybrids showed allelic losses in 5 of the 6 SSR markers analyzed (CiBE4818, CiBE0733, mCrCIR02B11, MEST123, and CiBE5866). The origin of lost alleles was CM, except for the locus CiBE0733 that lost the CC allele. Three of these losses were shared between the somatic hybrids, whereas 1 and 2 of them affected SMC-58 and SMC-73, respectively. Besides, on 3 of the 5 SNP markers (CiC4356-06, PSY-C461, and AocC593), the SMC-58 somatic hybrid lost the T allele from CM, whereas these differences were not observed in SMC-73 (Table [6](#T6){ref-type="table"}). Figures [3B and C](#F3){ref-type="fig"} are examples of the results obtained for the PSY-C461 and AocC593 SNP markers, displaying the T allele lost in the SMC-58 somatic hybrid. The LG 7 was analyzed with 3 SNPs and 2 SSR markers. The 239 nt allele from CM was lost on Ci07C07 SSR locus in both somatic hybrids. On the LG 8, 2 SNPs and 2 SSR markers were analyzed, whereas on the LG 9, 4 SNPs and 2 SSR markers were used. In both LGs, the hybrids displayed allelic configurations that correspond with the addition of both genome parents (Table [7](#T7){ref-type="table"}). ###### Genetic analysis using SNP and SSR nuclear markers located on LGs 1, 2, and 3 performed on SMC-58 and SMC-73 somatic hybrids that were obtained by protoplast fusion between *C. macrophylla* (CM) and Carrizo citrange (CC). **Locus** **LG** **CC** **CM** **SMC-58** **SMC-73** ------------- -------- ----------------------------------------- -------- ------------ ------------ ----- ----- ----- ----- ----- ----- ----- ----- CiC2110-01 1 *[^*y*^](#TN5){ref-type="table-fn"}*C A A A C A A A C A A A CiBE5720 *[^*z*^](#TN6){ref-type="table-fn"}*308 329 308 320 308 329 308 320 308 329 308 320 ACO-C601 G G A G G G A G G G A G CiC0599-01 G A G G G A G G G A G G TSC-C80 G G G T G G G T G G G T JK-TAA15 143 165 168 143 165 168 143 165 168 PEPC-C328 A A A G A A A G A A A G mCrCIR07D05 2 189 195 189 195 189 195 SOS1-M50 A G A A A G A A A G A A CCC1-P727 C T C C C T C C C T C C JK-TAA41 142 154 132 154 142 154 132 154 142 154 132 154 TRPA-M593 C G C C C G C C C G C C PKF-M186 T T C T T T C T T T C T INVA-M437 C T C C C T C C C T C C MDH-M519 3 C T C C C T C C C T C C NCED3-M535 G T T T G T T T G T T T CiC5796-12 A A C C A A C C A A C C ATMR-M728 T T G G T T G G T T G G ATMR-C372 A A A G A A A G A A A G Ci08A10 156 154 156 154 156 154 CHS-M183 C C G G C C G G C C G G *SNP alleles: A, adenine; C, cytosine; T, thymine; G, guanine*. *SSR allele: Numbers are the allele size in nucleotides. Lost alleles are marked in gray*. {#F1} {#F2} ###### Genetic analysis using SNP and SSR nuclear markers located on LGs 4, 5, and 6 performed on SMC-58 and SMC-73 somatic hybrids that were obtained by protoplast fusion between *C. macrophylla* (CM) and Carrizo citrange (CC). **Locus** **LG** **CC** **CM** **SMC-58** **SMC-73** ------------- -------- ----------------------------------------- -------- ------------ ------------ ----- ----- ----- ----- ----- ----- ----- ----- CHI-M598 4 *[^*y*^](#TN7){ref-type="table-fn"}*C C G C C C G C C C G C mCrCIR07D06 *[^*z*^](#TN8){ref-type="table-fn"}*162 188 167 172 162 188 167 172 162 188 167 172 CiC2840-01 T T C C T T C C T T C C CiC3740-02 G C G G G C G G G C G G mCrCIR03G05 213 219 199 213 219 199 213 219 199 CiC1380-05 5 T T C C T T C C T T C C CiC5788-16 G A A A G A A A G A A A mCrCIR06A12 92 103 86 92 103 86 92 103 86 DFR-M240 C G C C C G C C C G C C CiC4356-06 6 C C C T C C C T C C C T MEST132 231 244 244 231 244 244 231 244 244 CiBE4818 151 162 154 151 162 154 151 162 154 CiBE0733 240 245 235 240 245 235 240 245 235 mCrCIR02B11 232 232 248 232 232 248 232 232 248 PSY-M30 C G G G C G G G C G G G PSY-C461 A A A T A A A T A A A T CiC3056-02 G A A A G A A A G A A A AocC593 C C C T C C C T C C C T MEST123 239 246 250 239 246 250 239 246 250 CiBE5866 214 222 214 222 214 222 *SNP alleles: A, adenine; C, cytosine; T, thymine; G, guanine*. *SSR allele: Numbers are the allele size in nucleotides. Lost alleles are marked in gray*. {#F3} ###### Genetic analysis using SNP and SSR nuclear markers located on LGs 7, 8, and 9 and mitochondrial (mt) and chloroplastic (cp) markers performed on SMC-58 and SMC-73 somatic hybrids that were obtained by protoplast fusion between *C. macrophylla* (CM) and Carrizo citrange (CC). **Locus** **LG** **CC** **CM** **SMC-58** **SMC-73** ------------- -------- ------------------------------------------ -------- ------------ ------------ ----- ----- ----- ----- ----- --- --- --- mCrCIR07E05 7 *[^*z*^](#TN10){ref-type="table-fn"}*119 128 116 119 128 116 119 128 116 DXS-M618 *[^*y*^](#TN9){ref-type="table-fn"}*G G A A G G A A G G A A DXS-C545 G G C G G G C G G G C G FLS-P129 C T T T C T T T C T T T Ci07C07 212 239 212 239 212 239 mCrCIR07B05 8 196 203 210 196 203 210 196 203 210 CiBE0214 312 309 312 309 312 309 CiC5164-02 C C T T C C T T C C T T CiC1749-05 G T T T G T T T G T T T mCrCIR07F11 9 160 162 164 160 162 164 160 162 164 CiC2518-02 T A T T T A T T T A T T Ci08C05 153 153 156 153 153 156 153 153 156 LCYB-M480 T C T T T C T T T C T T HYB-M62 A A C C A A C C A A C C HYB-C433 G G A G G G A G G G A G *nad*2/4-3 mt 261 251 251 251 CCMP2 cp 197 203 197 203 197 CCMP5 cp 93 95 93 95 93 CCMP6 cp 133 135 133 135 133 NTCP7 cp 182 188 182 188 182 *SNP alleles: A, adenine; C, cytosine; T, thymine; G, guanine*. *SSR allele: numbers are the allele size in nucleotides. Lost SSR alleles and modified SNP alleles are marked in gray*. In summary, somatic hybrids SMC-58 and SMC-73 combine the parental alleles from CC and CM in 45 of the 56 nuclear markers analyzed (80%). However, allelic losses were found in 11 of the loci analyzed. The origin of lost alleles was CM in 8 loci and CC in 3 loci. Most of the lost alleles, 8 of the 11, were located on the LG 6 (Table [6](#T6){ref-type="table"}) and 2 of them have a CC origin, whereas 6 come from CM. The rest of lost alleles were located on LGs 2, 3 (Table [5](#T5){ref-type="table"}), and 7 (Table [7](#T7){ref-type="table"}). On LGs 2 and 3, the origin of lost alleles was CC, whereas on LG 7, the origin of lost alleles was CM. We found alleles that are lost only in one or the other when comparing the genetic configuration of both somatic hybrids. Therefore, they are genetically different. SMC-58 lost 3 SNP alleles from CM (Figures [3B and C](#F3){ref-type="fig"}) that were identified in SMC-73 and SMC-73 lost 2 SSR alleles (mCrCIR02B11 and MEST 123 loci), one from CM and the other one from CC, although these alleles were present in the SMC-58 somatic hybrid. We investigated the parental origin of these 11 lost alleles. CM is a hybrid of *C. micrantha* W. and *C. medica* (Curk et al., [@B27]), two of the *Citrus* ancestral species. CC has *C. sinensis* and *P. trifoliata* in its pedigree and *C. sinensis* is a secondary species that originated from crosses between *C. maxima* and *C. reticulata* (García-Lor et al., [@B39]). In Ci08A10, Cibe4818, and Cibe5866 SSR markers, we cannot decipher the parental origin of the lost alleles because Ci08A10 is homozygous for CC and for the last 2 markers, the lost allele is shared between *C. micrantha* and citron. Regarding Ci07C07 SSR marker and CiC4356-06, PSY-C461 and AoC-C593 SNP markers, the lost allele comes from citron, whereas for mCrCIR02B11, JK-TAA41, and Cibe0733 SSR markers lost alleles come from *C. micrantha, P. trifoliata*, and *C. sinensis*, respectively. The later lost allele is shared between *C. maxima* and *C. reticulata* parental species of sweet orange. The cytoplasmic genome was analyzed using 1 mitochondrial marker (*nad*2/4-3) and 4 chloroplastic markers (CCMP*2*, CCMP*5, CCMP6*, and NTCP*7*) (Table [8](#T8){ref-type="table"}) that were polymorphic between CC and CM. Both somatic hybrids had the 251 nt allele of the mitochondrial marker *nad*2/4-3 that belongs to the embryogenic parental CM. However, chloroplastic genome analysis showed that the origin of SMC-73 chloroplasts was CC for the 4 markers analyzed, whereas SMC-58 combined both CM and CC alleles for these markers (Table [7](#T7){ref-type="table"}). As an example, in Figure [4](#F4){ref-type="fig"}, we display the addition of both parental alleles in the SMC-58 somatic hybrid for the NTCP*7* SSR marker. ###### Plant morphology of 9-month-old plants of the somatic hybrids SMC-58 and SMC-73 obtained by protoplast fusion between Carrizo citrange (CC) and *C. macrophylla* (CM). **Genotype** **Plant height (cm)** **Leaf number** **Internodal length (cm)** **Leaf greenness (SPAD)** **Leaf morphological index (l/w)** -------------- ----------------------- ----------------- ---------------------------- --------------------------- ------------------------------------ CC 143.6a 41.9a 3.43a 73.82a 2.51a CM 111.9b 36.8b 3.05b 60.93b 2.14b SMC-58 59.1d 19.2d 3.08bc 72.78a 1.74c SMC-73 81.5c 26.6c 3.14c 75.99a 1.79c *Values are the mean of 12 plants (n = 12). Different letters within each column indicate significant differences for P ≤ 0.05 on multiple range Duncan\'s test*. {#F4} Plant morphology ---------------- Plant morphology was evaluated in 9-month-old plants of CC, CM, SMC-58, and SMC-73. Somatic hybrids had a slower growth than both the parents and were prone to lateral branching (Figures [5A--D](#F5){ref-type="fig"}). The height of both the somatic hybrids was shorter than CC or CM (Table [8](#T8){ref-type="table"}). Differences in growth were also found between the hybrids as SMC-58 grew 20% less than SMC-73. Internodal length was longer in CC than in CM, whereas SMC-58 was similar to CM, and SMC-73 had an intermediate length between parents. The leaf morphological index obtained from the length/width ratio of the main leaflet was lower in somatic hybrids than in both the parents and was similar between SMC-58 and SMC-73. This indicates that the morphology of the measured leaves is round shaped, which is a character that is typical of tetraploid citrus plants (Barrett and Hutchison, [@B8]). Leaf greenness of somatic hybrids was similar between them and resembled CC, whereas CM had 12% lower leaf greenness than these genotypes. Somatic hybrid plants, SMC-58 and SMC-73, have a spiral phyllotaxis pattern, where leaves and straight thorns of intermediate length (16--40 mm) appear together. These characteristics are similar to those of both the parents. The leaves, showing brevipetiolate attachment to the lamina, are odd-pinnate, and the number of leaflets within the same plant varies between one, as seen with CM, and three, as seen with CC (Figures [5C and D](#F5){ref-type="fig"}). The somatic hybrid SMC-58 shows mainly one or two leaflets per leaf and trifoliate leaves are also present. The somatic hybrid SMC-73 shows mainly trifoliate leaves, even though simple and bifoliate leaves also appear. The leaf size is small (10--20 cm^2^) and heterogeneous. The petiole is shorter than the lamina and has narrow obdeltate wings with articulate junction to the lamina. The main leaflet has a length/width ratio between 1.5 and 1.8 and shape varies from elliptic, like in CC, to obovate, as in CM. The leaf margins are crenate, and the apex is obtuse in both somatic hybrids. {#F5} Tolerance to iron deficiency ---------------------------- Leaf greenness decreased in all the genotypes under the chlorosis-inducing treatment (Ch). Carrizo citrange had a greater greenness decline than CM and the somatic hybrids showed intermediate values between parents (Table [9](#T9){ref-type="table"}). In terms of growth, the shoot developed under the Ch treatment in somatic hybrids had similar leaf biomass than in CM, whereas these values were higher than in CC. In control conditions, SMC-73 had similar growth to that of CC and SMC-58 grew less than both parents. Iron concentration in the leaves developed under the Ch treatment was higher in CM than in CC and somatic hybrids had intermediate concentrations between them (Table [9](#T9){ref-type="table"}). ###### Leaf greenness (f:i), increase in shoot biomass (DW g) and iron concentration in shoot leaves (DW ppm) of Carrizo citrange (CC), *C. macrophylla* (CM) and the somatic hybrids SMC-58 and SMC-73 cultivated in greenhouse conditions for 10 weeks, either in control conditions (20 μM Fe-EDDHA) or in iron-deficient conditions (10% (v/v) CaCO~3~ 10 mM NaHCO~3~, 2 μM Fe-EDDHA). **Treatment** **Genotype** **Leaf greenness (f/i)[^X^](#TN11){ref-type="table-fn"}** **Increase in shoot biomass (DW g)** **Iron concentration (ppm)** ---------------- -------------- ----------------------------------------------------------- -------------------------------------- ------------------------------ Control CC 0.84 a 1.36 b 48.3 a CM 1.11 b 1.76 c 46.7 a SMC-58 1.02 b 0.89 a 38.7 a SMC-73 0.89 ab 1.21 b 43.5 a Iron-deficient CC 0.30 a 0.42 a 16.5 a CM 0.70 c 0.56 b 33.1 b SMC-58 0.56 b 0.52 b 23.9 ab SMC-73 0.52 b 0.61 b 21.7 ab *SPAD final/initial, values below 1 indicate greenness decrease. Values are the mean of six plants (n = 6). Different letters in each column indicate significant differences for P ≤ 0.05 on multiple range Duncan\'s test*. Tolerance to salinity --------------------- The differences in behavior between somatic hybrids and their parents under salinity (+S) were evaluated according to the growth rates, leaf symptoms, ion accumulation, and gas exchange parameters. Carrizo citrange plants subjected to salinity had 25% lower DW than control plants at the end of the experimental period (Figure [6A](#F6){ref-type="fig"}), indicating their sensitive behavior. In contrast, CM, that is salt-tolerant, showed similar growth in both, +S or Ct treatments. The SMC-73 hybrid had similar behavior to CM regarding growth, given that +S treatment did not affect this parameter. SMC-58 had 16% lower DW under the +S treatment than in Ct conditions, although this growth reduction was lower than in the sensitive CC. Leaf symptoms induced by salt toxicity were intense in CC plants that had 20% of their leaf area burned. Meanwhile, leaves of the tolerant CM were free of burns (Figure [6B](#F6){ref-type="fig"}) and somatic hybrids showed very mild leaf toxicity symptoms with only 2% (Figure [6C](#F6){ref-type="fig"}) of their leaf area affected by burns (Figure [6B](#F6){ref-type="fig"}). Leaf abscission was lower in SMC-73 or SMC-58 than in CC with 6, 3, and 7% of leaves affected, respectively. Nevertheless, the tolerant CM did not suffer this symptom. {#F6} Overall, Cl^−^ and Na^+^ molar concentrations in leaf tissue water were higher in the saline treatment (+S) than in the Ct treatment for all the genotypes (Table [10](#T10){ref-type="table"}). The parent CM, which is tolerant to salinity, had the lower Cl^−^ and Na^+^ concentrations under the +S treatment, and were 2.2 and 1.4-fold, respectively, higher than in control plants. Carrizo citrange, which is considered salt-sensitive, raised Cl^−^ and Na^+^ leaf concentrations that were 4.1 and 2.6-fold higher in +S treatment than in Ct treatment, respectively. Somatic hybrid SMC-58 subjected to +S treatment had lower Cl^−^ concentration and similar Na^+^ concentration than CC. Specifically, Cl^−^ and Na^+^ leaf concentration in SMC-58 were 4.2 and 1.8-fold, respectively, higher in +S than in Ct plants. The SMC-73 plants subjected to +S treatment had leaf Cl^−^ concentrations similar to CC, whereas leaf Na^+^ concentration was higher than in CC plants. More precisely, leaf Cl^−^ and Na^+^ concentrations in SMC-73 increased by 3.9 and 2.3-fold, respectively, in salt-treated plants when compared to Ct plants. Therefore, the data show that both somatic hybrids had lower Cl^−^ exclusion capacity than the salt-tolerant parent CM. However, SMC-58 had greater exclusion capacity than the salt-sensitive parent CC, whereas SMC-73 had similar exclusion capacity to CC. Regarding Na^+^ exclusion, the behavior observed in SMC-58 was similar to CC, whereas SMC-73 plants accumulated less Na^+^ in their leaves, showing more tolerance than the sensitive parent CC. The concentration of K^+^ in plants subjected to salinity was not different from Ct plants in the tolerant CM. Leaf concentration of K^+^ decreased by 21%, 20%, and 33%, respectively, in CC, SMC-58, and SMC-73. Salt-treated CM plants did not differ from Ct plants in their *A*~CO2~ and *E* rates (Table [11](#T11){ref-type="table"}). The salt-sensitive parent CC had reduced *A*~CO2~ rates by 39% and *E* rates by 18% when compared to Ct plants. Somatic hybrids SMC-58 and SMC-73 subjected to salinity reduced *E* rates by 33% and 43%, respectively, when compared to Ct plants. Similarly, these salt-treated plants reduced *A*~CO2~ by 32% and 53%, respectively. The data show that gas exchange parameters were more affected by salinity in SMC-73 than in SMC-58. Therefore, the former genotype was similar to CC, whereas the latter had a behavior more similar to CM. In summary, results show that somatic hybrids have an intermediate behavior between the tolerant rootstock CM and the sensitive CC. However, the differences found between SMC-58 and SMC-73 indicate that SMC-58 is better adapted to salinity than SMC-73 because the response was globally more similar to the tolerant parent CM. ###### Leaf Cl^−^, Na^+^ and K^+^ concentration (mM in tissue water) in Carrizo citrange (CC), *C. macrophylla* (CM) and SMC-58 and SMC-73 somatic hybrids. **Treatment** **Ion** **CC** **CM** **SMC-58** **SMC-73** --------------- --------- -------- -------- ------------ ------------ Control Cl^−^ 56.3a 36.5a 43.5a 53.4a Na^+^ 140.0b 85.7a 217.9c 202.0c K^+^ 571.1a 607.0b 556.2a 609.0b Saline Cl^−^ 233.2c 80.9a 183.0b 205.4c Na^+^ 367.8b 117.5a 393.7b 466.0c K^+^ 462.0a 621.2b 446.0a 468.4a *Values are the mean of 3 plants (n = 3). Different letters in each line indicate significant differences for P ≤ 0.05 at Duncan\'s multiple range test. Plants were cultivated in a greenhouse for 20 days, either in saline (40 mM NaCl) or control conditions*. ###### Transpiration (*E*, mmol H~2~O·m^−2^·s^−1^) and net assimilation (*A*~CO2~, μmol CO~2~·m^−2^·s^−1^) rates in Carrizo citrange (CC), *C. macrophylla* (CM) and SMC-58 and SMC-73 somatic hybrids. **Treatment** **Parameter** **CC** **CM** **SMC-58** **SMC-73** --------------- --------------- -------- -------- ------------ ------------ Control *E* 0.76 c 1.37 a 1.32 a 1.16 b *A*~CO2~ 6.23 b 9.99 a 9.21 a 8.74 a Saline *E* 0.62 c 1.32 a 0.89 b 0.66 c *A*~CO2~ 3.82 c 10.1 a 6.23 b 4.14 c *Values are the mean of six plants (n = 6). Different letters in each line indicate significant differences for P ≤ 0.05 at Duncan\'s multiple range test. Plants were cultivated in a greenhouse for 20 days, either in saline (40 mM NaCl) or control conditions*. Tolerance to CTV ---------------- Plants inoculated with T388 CTV strain were evaluated for growth and symptoms. CM showed reduced growth as evident by the shorter height of the plants (Figure [7A](#F7){ref-type="fig"}) and the lower aerial and root biomass (Figures [7B and C](#F7){ref-type="fig"}). Overall, plant biomass decreased by 35% (Figure [7D](#F7){ref-type="fig"}) in CM. These plants also showed yellow leaves with vein corking (Figure [8A](#F8){ref-type="fig"}) and stem pitting (Figure [8B](#F8){ref-type="fig"}). Meanwhile, CC plants and the somatic hybrids SMC-58 and SMC-73 were not different from control plants in their growth (Figure [7D](#F7){ref-type="fig"}), and neither showed the disease symptoms (Figures [8C--H](#F8){ref-type="fig"}). {#F7} {#F8} Discussion {#s4} ========== Genetic characterization of the somatic hybrids ----------------------------------------------- Two allotetraploid somatic hybrids were previously obtained from protoplasts isolated from callus of CM and from leaves of CC (Pensabene-Bellavia et al., [@B98]). These somatic hybrids, their parents, and the embryogenic callus of CM were analyzed to verify their origin and genetic structure of the hybrids. Fifty-six nuclear molecular markers distributed uniformly on the 9 LGs of the clementine genetic map (Ollitrault et al., [@B91]) and 5 cytoplasmic markers that were polymorphic between the parents were used for the analysis. Nuclear molecular markers confirmed that (i) the embryogenic callus of CM did not show differences compared to leaves of CM for all these markers and (ii) the somatic hybrids added the parental genomes although some parental alleles were lost. Specifically, 11 lost alleles have been identified on different LGs (2, 3, 6, and 7) although most of them are located on LG 6 (8 of the 11 alleles). Differences in 5 markers have also been found between the somatic hybrids. Most of the lost alleles observed in the somatic hybrids have their origin in the embryogenic parent CM (7 of them) even though 4 of them correspond to the leaf parent CC. For some markers, it has been possible to identify the parental origin of the lost allele. Most of the lost alleles come from *C. medica*, whereas others come from *C. micrantha, C. sinensis*, and *P. trifoliata*. These results suggest that the loss of parental alleles occurred during the somatic hybridization process and the differences observed between hybrids seem to be limited to sub-chromosomal level because the flow cytometry analysis did not show differences in the number of chromosomes (2n = 4x = 36) between somatic hybrids or when compared to the tetraploid control. Furthermore, genetic analysis has been performed using leaf samples of the somatic hybrids taken from different branches and the same differences between somatic hybrids and parents were found. However, no differences were identified between analyses of different DNA preparations, discarding the presence of chimeras. Most of the absent alleles that have been identified are located on the same LG and consist of deleted fragments (SSR allele absence) and punctual variations in a small number of nucleotides (non-observed SNP alleles). This indicates that there is chromosome instability in this complex intergeneric combination given that the genomes of the four citrus ancestral species and related genera are present in the somatic hybrids. Previous studies performed in citrus (Xu et al., [@B124]) and other species (Sundberg and Grimelius, [@B112]; Sun et al., [@B111]; Smyda-Dajmund et al., [@B108]) state that chromosome losses, genomic deletions, and epigenetic alterations are more frequent in somatic hybrids between parents that have a distant genetic relationship than in those from closely related parents. In SMC-58 and SMC-73, most lost alleles do not come from the species that are genetically more distant, *C. micrantha* and *P. trifoliata*. This finding suggests that there is no bias against the most dissimilar genomes when somatic hybridization is performed. Therefore, the identified losses might be either random or caused by some other effect. It has also been reported that genomic losses in citrus somatic hybrids are parent-biased toward the callus parent (Xu et al., [@B124]), which might explain that most of the alleles lost in SMC-58 and SMC-73 come from CM. Overall, the wide diversity of the genomes combined in SMC-58 and SMC-73 and the different origin of the parental protoplasts used to perform the fusions might explain the uneven genomic losses that we observed. Nevertheless, further studies would be required to verify these hypotheses. Differences between SMC-58 and SMC-73 have also been found in the cytoplasmic genome. Both hybrids have the CM mitochondrial genome. However, SMC-73 has the CC chloroplastic genome, whereas chloroplastic genome recombination was detected in SMC-58. Citrus somatic hybrids predominantly inherit the mitochondrial genome from the embryogenic parent (Kobayashi et al., [@B66]; Saito et al., [@B104]; Yamamoto and Kobayashi, [@B125]; Moriguchi et al., [@B79]; Moreira et al., [@B76]; Cabasson et al., [@B13]; Ollitrault et al., [@B87]; Guo et al., [@B55]; Xiao et al., [@B123]) even though there are some reports of mitochondrial recombination events (Vardi et al., [@B116]; Moriguchi et al., [@B79]; Cheng et al., [@B21]; Dambier et al., [@B28]). Recently, Cai et al. ([@B14]) have demonstrated that mitochondrial genome of protoplasts isolated from embryogenic callus is essential for plant regeneration after protoplast fusion experiments. However, chloroplastic genome is randomly inherited from one of the parents or shows recombination (Grosser et al., [@B51]; Dambier et al., [@B28]; Aleza et al., [@B4]). It has also been proven that mitochondrial and chloroplastic genomes are involved in differences in aroma and organoleptic fruit properties (Fanciullino et al., [@B32]; Satpute et al., [@B106]), disease resistance (Tusa et al., [@B115]; Omar et al., [@B94]), floral developmental disturbances, and male sterility (Guo et al., [@B54]; Zheng et al., [@B126]). Nevertheless, there is no information available about how these new combinations and rearrangements occurring on the cytoplasmic genome affect the agronomical behavior of citrus rootstocks. Most publications on citrus somatic hybridization report the symmetric addition of nuclear parental genomes (Ollitrault et al., [@B89]) although subchromosomal variations have been detected in citrus somatic hybrids (Olivares-Fuster, [@B84]; Froelicher, [@B36]; Guo et al., [@B56]; Xu et al., [@B124]). However, studies describing them are scarce. Different hypotheses have been suggested for these kind of changes such as extended periods of *in vitro* culture (Oberwalder et al., [@B83]; Guo and Deng, [@B53]), genetic divergence between parents, and increased ploidy level (Sundberg and Grimelius, [@B112]; Miranda et al., [@B75]). Genetic analysis of somatic hybrids has been usually performed with a small number of molecular markers, enough to confirm their hybrid origin but not sufficient to identify these variations (Oberwalder et al., [@B83]; Guo and Deng, [@B53]). In potato (*Solanum* spp) somatic hybrids, similar variations have also been recently described using DArT markers (Diversity Array Technology) (Smyda-Dajmund et al., [@B108]). More than 5,000 markers distributed across the potato genome were analyzed in the somatic hybrids and 2,000 were found to be polymorphic between parents. Among them, between 13.9% and 29.6% of alleles were found to be lost in the somatic hybrids. The identification of genomic changes in somatic hybrids justifies the need for performing a detailed genetic analysis of the plants obtained by somatic hybridization to gather information on their genetic structure. This information is key to optimize and interpret the data on physiological behavior of the somatic hybrids to use them as rootstocks. Performance of SMC-58 and SMC-73 somatic hybrids as potential citrus rootstocks ------------------------------------------------------------------------------- Several rootstock breeding programs based on somatic hybridization are currently being carried out across the world. In Florida, a large number of somatic hybrids have been obtained, which stand out for their good adaptation to the local soil, inducing good fruit quality, and high yields (Grosser et al., [@B44]). Breeding programs focused on somatic hybridization have also been carried out in the Mediterranean basin (Dambier et al., [@B28]), as well as in China (Guo et al., [@B55], [@B56]), Brazil (Mendes-da-Gloria et al., [@B74]; Mourao et al., [@B80]), and Mexico (Medina-Urrutia et al., [@B73]). These data reveal that somatic hybridization is an efficient approach to produce new citrus rootstock candidates. The morphology of somatic hybrids SMC-58 and SMC-73 shows some intermediate characters between the parents. This type of inheritance has also been described in somatic hybrids between *Citrus* and related genera such as *Citropsis, Severinia*, and *Microcitrus* (Smith et al., [@B107]) and also between different *Citrus* species (Olivares-Fuster, [@B84]). The growth of somatic hybrids when compared with their parents is slower as it has also been described in several citrus allotetraploid somatic hybrids (Grosser et al, [@B50]; Grosser et al., [@B52]). This character is related to the increase in ploidy level (Lee, [@B69], [@B70]). Citrus tetraploid hybrids have been used to increase the tree density in orchards to maximize the management efficiency. Furthermore, tetraploid rootstocks do not reduce the yield efficiency of the scion (Ruiz et al., [@B101]) and produce fruits with excellent organoleptic qualities (Grosser et al., [@B44]). Therefore, the profitability of citrus plantations can be increased using tetraploid citrus rootstocks (Grosser et al., [@B49], [@B44]; Grosser and Chandler, [@B45]). We have evaluated the tolerance/susceptibility of CM + CC somatic hybrids to the severe T388 CTV strain. This strain causes different symptoms in susceptible citrus genotypes. The symptoms include seedling yellows, vein corking, or stem pitting when used either as varieties or rootstocks and the quick-decline of trees grafted onto SO (Moreno et al., [@B77]; Lee and Keremane, [@B71]). CM was found very sensitive to T388, whereas CC and the two CM + CC somatic hybrids were found to be tolerant. In Spain and in other Mediterranean countries, severe strains of CTV have been identified even though the incidence is low (Moreno et al., [@B77]). However, *Toxoptera citricida* (Kirkaldy), which is a very efficient vector of severe CTV strains, is already present in northern Portugal and north western Spain. The probable introduction of this aphid into the citrus producing areas would predictably cause a dispersion of severe CTV strains that would affect the trees grafted onto CM (Ilharco et al., [@B62]). Therefore, it is very important to have alternatives to this rootstock that can be used in alkaline and saline soils, where CC is not a good choice. In other studies, the quick decline was evaluated in somatic hybrids obtained from SO and several tolerant species, but global conclusions could not be reached. While somatic hybrids between SO and Rangpur lime (*C. limonia* Osb.) or Rough lemon (*C. jambhiri* Lush) were tolerant, hybrids obtained from SO and trifoliate orange (*P. trifoliata*) or Cleopatra mandarin were susceptible to this disease (Grosser et al., [@B46]). The inheritance of some traits such as CTV tolerance in the somatic hybrids is clearly coupled with the dominance or codominance of the trait in relation to the parental combinations (Bassene et al., [@B9]; Gmitter et al., [@B42]). The performance of the somatic hybrids in the presence of soil carbonates, which are abundant in the Mediterranean citrus producing areas, is similar to the tolerant CM and much better than CC. The CM + CC hybrids are also more tolerant to salinity than CC. Enhanced tolerance to these stresses as well as to drought and boron excess has also been described in citrus rootstocks with increased ploidy (Saleh et al., [@B105]; Grosser et al., [@B52]; Allario et al., [@B5]; Tan et al., [@B113]; Ruiz et al., [@B101],[@B102],[@B103]). These somatic hybrids have already started to yield fruits even though fruits are still sporadic and scarce. A large number of apomictic seeds per fruit were found. This characteristic is very important for citrus rootstocks as their clonal propagation and cultivation in nurseries are made easy. Field experiments have already been initiated in collaboration with Agromillora Research S.L. and will allow, within a few years, to confirm the data obtained in the greenhouse experiments and to collect additional information about fruit quality and yield induced by the grafted variety. All this information will be analyzed to determine if any of the studied somatic hybrids can be used commercially, which would be a great advantage for the Mediterranean citriculture. The importance of performing in-depth molecular and physiological characterization of somatic hybrids ----------------------------------------------------------------------------------------------------- The main goal of citrus rootstock improvement based on somatic hybridization by protoplast fusion is to recover allotetraploid somatic hybrids between parents displaying complementary characteristics as seen in our study. Previous studies on somatic hybridization variability carried out in the past decades reveal that characters expressed by the hybrids can be non-additive. The hybrid phenotype can differ from the addition of parental effects given that allopolyploidization triggers gene expression changes and modifies epigenetics altering the phenotype (Bassene et al., [@B9], [@B10]; Dambier et al., [@B28]; Xu et al., [@B124]). Some studies discuss to what extent these changes are caused by *de novo* interactions established between genomes coming from different species (Hegarty et al., [@B58]) or to the ploidy gain (Dambier et al., [@B28]; Tan et al., [@B114]). Allopolyploidization, generated either by sexual or somatic hybridization, involves the coexistence of parental genomes in a single nucleus. Additionally, in the case of allotetraploid somatic hybrids, changes also take place in cytoplasmic genome composition. The new genomic configuration is associated with diverse reorganizations and modifications affecting the structure and regulation of the new somatic hybrid genome (Comai et al., [@B23]; Ozkan et al., [@B96]; Wang et al., [@B120]; Soltis and Soltis, [@B109]; Flagel and Wendel, [@B35]). This event, coined as genomic *shock* (Song et al., [@B110]), has a dynamic and stochastic nature and is composed of diverse processes such as fragment elimination or exchange at sub-chromosomic or chromosomic level, modifications in the methylation pattern, gene repression/expression changes, and activation of transposable elements (Chen, [@B18]; Xu et al., [@B124]) among others. These changes modify the gene expression either by altering the sequence or by epigenetic regulation (Comai, [@B22]). In addition, these changes may confer genome plasticity to improve the adaptation of the hybrids to the environment (Chen, [@B18]). The neoregulation of parental genomes in allopolyploid plants would greatly explain the obtention of genotypes and phenotypes that were absent in the diploid pool (Osborn et al., [@B95]) and the non-additive inheritance (He et al., [@B57]; Albertin et al., [@B1]; Hegarty et al., [@B59]; Wang et al., [@B120],[@B119]; Chen, [@B18], [@B19]; Flagel et al., [@B34]; Flagel and Wendel, [@B35]). The study of genome expression in neopolyploids has recently gained importance, as it has been proposed as a useful approach to understand how genomes work and evolve (Gmitter et al., [@B42]; Gianinetti, [@B40]). Somatic hybridization is more efficient than sexual hybridization as a method for citrus breeding when parents display a complex reproductive biology such as apomixis and high heterozygosity, as in the case of most of the rootstocks used. Nevertheless, it is still necessary to regenerate an adequate number of plants from each fusion to perform further screenings that verify their characteristics and agronomic behavior. This is essential to properly assess their usefulness in breeding programs, yet, the molecular basis of the traits that shape the rootstock agronomical behavior is still unknown. The new genetic (Ollitrault et al., [@B91]) and genomic (Wu et al., [@B122]) tools available nowadays along with the affordable sequencing technologies are paving the way for the availability of numerous molecular markers and genetic information. This knowledge will contribute to the understanding of the molecular processes behind these traits and shorten the time required to perform additional evaluations. It is also essential to have rapid screening methods for early evaluations in greenhouse conditions. This will maximize the efficiency of breeding programs in terms of time, resources, and labor costs. Only those traits that are strictly necessary should be considered for long-term field evaluations. Conclusion {#s5} ========== Somatic hybrids SMC-58 and SMC-73 are promising citrus rootstocks for areas with the presence of CTV and calcareous and saline soils. They have punctual sub-chromosomic losses and show differences in morphology and physiological behavior, both between them and when compared with their parents. This is an evidence of genomic alterations that affect each hybridization event individually and are somehow independent from parental combinations. These identified genetic variations, along with the possible neoregulation events, the new cytoplasmic combinations, and the ploidy gain, might be the underlying phenotypic differences found between the hybrids and the phenotypic deviation from parental additive inheritance. Further investigation on somatic hybrids can add great value to citrus breeding programs as it can reveal information crucial to understand the principles operating in citrus genome expression, regulation, and evolution. Author contributions {#s6} ==================== LN, EP-M, PO, and RM conceived the study and were in charge of the direction and planning. MR, AQ, GP-B, EP-M, LN, and RM contributed in the experiment design. MR, AQ, GP-B, and AG-L performed the experiments. MR, AG-L, and PA analyzed the data. MR and PA took the lead in interpreting the results and writing the manuscript with input and review from LN, EP-M, and PO. Conflict of interest statement ------------------------------ The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. This work was financed by the Spanish MINECO Ministry, Project AGL2011-26490 and by agreement between IVIA and Agromillora Research S.L. MR was supported by grant co-funded by the Centre de Coopération International en Recherche Agronomique pour le Développement (CIRAD) and the Valencian Institute for Agricultural Research (IVIA), DOCV \[2010/8910\]. We are very grateful to Dr. Mireia Bordas from Agromillora Research that made the micropropagation of the rootstocks, Dr. José Guerri, and Dr. Karelia Velázquez for their help in the CTV analysis, the technical assistants Frederique Ollitrault, Mª Carmen Prieto, Enric Alcaide, Carmen Casamayor, Teresa García, Carmen Ortega, and Antonio Navarro, and the greenhouse technical team headed by José Antonio Pina, Rafa Montalt, and Diego Conchilla for their kind support. We would also like to thank Yoko Hiraoka for her useful editing suggestions. [^1]: Edited by: Jaime Prohens, Universitat Politècnica de València, Spain [^2]: Reviewed by: Sergio J. Ochatt, INRA UMR1347 Agroécologie, France; Wen-Wu Guo, Huazhong Agricultural University, China [^3]: This article was submitted to Plant Breeding, a section of the journal Frontiers in Plant Science

Crude oil normally contains fractions of light and heavier gases which cannot be transported together with the liquid fraction of the crude oil due to their volatility. Transport-technically it would be favourable if the crude oil were separated into a gas fraction, a wet gas fraction and a liquid fraction. However, separation and transport of the petroleum products in three fractions from a production field involve considerable extra expenses, and it is therefore more common for the crude oil to be separated into a gas fraction and a liquid fraction. The wet gas phase is therefore divided into a lighter fraction which is transported together with the gas fraction, and a heavier fraction which is transported with the liquid fraction. When a liquid petroleum fraction containing heavier gases, such as propane and butane, is being loaded at a moderate positive pressure, gages continuously evaporate from the liquid fraction. To prevent a pressure increase in the transport or storage tanks, the evaporating gases, the volatile organic compounds, must be drawn from the tanks and be carried away for combustion or they must be carried to a re-injection plant. It is known that there is relatively extensive evaporation of volatile organic compounds as oil is being pumped into larger tanks. Normally a pressure in the order of 1.05 to 1.07 bar is maintained in both storage and transport tanks. During the loading of a tanker for example, it is common for the oil to be pumped from a storage tank through a supply pipe to a position above the cargo tank, from where the oil is directed into the tank through a drop line down to the bottom portion of the tank. A drop line of this kind may have a length in the order of several tens of metres. When the oil enters the upper end portion of the drop line, gravity will accelerate the liquid flowing down the drop line, whereby, a lower overall pressure is created in the supply pipe and the upper portion of the drop line. In these pipes, in which there is a lower overall pressure, there is considerable evaporation of volatile organic compounds, which will be re-liquefied only to a minor extent when the pressure increases again to the normal pressure of the tank. The invention has as its object to remedy the drawbacks of known technique.

These teachings relate generally to luminous systems that provide observed visible color, and more particularly to a luminous system that provides a first observed visible color that is primarily produced by the emission of the system when such system is powered, and also provides a second observed visible color that is primarily produced by the reflection of the system when such system is non-powered. The primary purpose of luminous systems is to generate light of certain desired visible color(s), white, blue, green, etc., with the use of illumination source(s), e.g. LEDs, for a broad range of applications, e.g. general lighting, illuminated graphics, etc. Thus, when the illumination source(s) are powered, the observed visible color of such systems is predominantly a result of the emission produced by the system. However, when the illumination sources are non-powered, the observed visible color of such systems is mainly produced by way of ambient light reflected from the surface of the system, e.g. a luminous system having a white surface will reflect ambient light that is observed as a white visible color, whereas a luminous system having a red surface will reflect ambient light that is observed as a red visible color. In general, white illumination sources, including white light LEDs, have been used in luminous systems to generate light of observed visible color, e.g. white light or colored light. In instances where colored light is desired, these systems generate color through the absorption of all the wavelengths of light produced from the white illumination source(s), except those wavelengths associated with the color desired. Unfortunately, this approach to color generation results in substantial loss of energy due firstly, to the amount of energy needed to create the white light, and secondly, to the additional energy lost in the subtraction of the wavelengths to create a colored emission. This can be a particular problem when the white illumination source does not contain sufficient energy of the desired color, such as for example in the case of white light LEDs that provide only modest amounts of energy at red wavelengths. An additional drawback to utilizing white illumination sources is the difficulty in manipulation of the reflected light of the system, therefore suffering from the limitation that the observed visible color produced when the white illumination sources are non-powered must be substantially the same as the observed color when the illumination sources are powered. This is due to the color generation mechanism of the system since wavelengths associated with that of the white illumination source are similar to those associated with the ambient light, therefore making it difficult to tailor the emission of the system without affecting the reflection of the system and vice versa. In an effort to provide more efficient luminous systems, UV or blue illumination sources have been utilized, rather than white, to generate light of visible color, e.g. white light or colored light. This is generally accomplished by down-converting the emission energy of the UV or blue illumination source(s) into longer wavelengths with the use of energy converting material(s), e.g. phosphorescent and/or fluorescent materials. For example, when a blue LED is used as the illumination source to provide the primary electromagnetic radiation, the luminous system can generate white light by absorbing a portion of the primary electromagnetic radiation, i.e. blue light in this case, using a energy conversion layer and down-converting this radiation to a secondary electromagnetic radiation having green and yellow wavelengths, thereby resulting in an emission of the system comprising blue, green and yellow wavelengths which produce an observed visible color of white. Although these systems may be more efficient in generating light than those which utilize white light sources, when these systems are non-powered, the observed visible color of the system is also difficult to tailor to a desired observed visible color. However, with the use of UV or blue illumination source(s) along with energy converting material(s), the observed visible color of the system when the UV or blue illumination source(s) are non-powered is now not only the unabsorbed ambient light that is reflected from the surface of the system, but also the emission of the energy conversion material(s), although minimal, due to the system's exposure to ambient light. For example, the absorption of blue light by the energy conversion layer causes the reflectance of the surface of the system to appear yellowish when the primary electromagnetic radiation is not supplied, i.e. the illumination source(s) are non-powered, resulting in an undesirable observed visible color. There is, therefore, a need for utilizing higher efficiency luminous systems which are capable of not only providing a desired observed visible color when powered, but also a desired observed visible color when non-powered. It is also desirable to provide higher efficiency luminous systems, wherein the system not only embodies elements for achieving desired observed visible color when powered and when non-powered, but also embodies elements that enable the system to provide a wider gamut of observed visible color without substantial loss of energy. Furthermore, it is also desirable to incorporate within these systems elements that enable the luminous system to not only generate light of observed visible color, but also for a broad surface area.

Q: Why is my Crosstab being cut off in Excel? I'm attempting to create an excel spreadsheet using BIRT. The spreadsheet is a crosstab mapping two objects together. The number of rows and columns are dynamic based on values in a MySQL database. Currently I have a working implementation of the report for PDF output. Now, I am trying to create a second version of the report for Excel. I have copied the report design and begun adjusting it to work with Excel. Everything looks good, but only the first 3 columns are displayed after the header. All rows appear correctly. I have tried the following: I tried setting Overflow to Visible on every element on the page. This had no effect. I tried setting the master page's height and width to ridiculously large values. All of the information displayed correctly, but I am hoping for a solution without hard coded values. In the future the data width might exceed my arbitrary value again and be cut off. I am constrained in the following ways: I am not able to switch reporting engines (I have to use BIRT). I am not able to switch Excel emitters. This blog entry mentions my problem: http://www.spudsoft.co.uk/2011/10/the-spudsoft-birt-excel-emitters/ but it does not offer a solution other than an emitter switch. The specific quote is "The files also have problems with page layout that I could not work around (specifically wide reports would be cut off)." Beyond the one blog entry my googlefu has failed me. Any help is appreciated! Thank you! A: There are two questions here. The first one is relatively easy, the second is complex. 1.Why is my Cross tab being cut off in Excel? 2.How do I dynamically adjust the master page width based on the number of columns in the report at runtime? A1: The Cross tab is being cut off because column widths have been manually set, where the number of columns will expand past the set width of the Master page. Anytime you grab report design element and adjust, BIRT assumes you know what your doing and does not override your setting. The solution is to recreate the report element (Table or Cross Tab) and not manually adjust any sizes. When run in HTML or Excel all the columns will be automatically set to display in the available master page width. Screen shot of a BIRT 4.2 Cross Tab, Report Item with a 2 inch master page width and 30 columns A2: This is not easy, and I will not be providing the answer at this time. I will point toward the solution and identify a couple of the road blocks. A valid solution to this question must include a functioning solution using the Sample Database. (as of BIRT 4.2.1) Challenge1 - The Master Page Width is set BIRT Report Scripting in events prior to report Table or Cross Tab item being completed. You can not simply count how many columns are in the report; If you wanted to count, columns -- Report Design intialize columnCount = 0; Cross Tab, onCreate columnCount ++; In my research there are two paths suggested for counting columns prior to the Cross Tab item being created. Either Run the data set in the beforeFactory (this means two queries to the data base, one to count and one for the report), then get a count and use it. Calculate the value in your intial query and harvest it in the Data Set, onFetch. I followed the Data Set, onFetch, option using a computed column but did not get it working. Challenge2 - The Width Property of the Master Page must be set on or before the Report Design, beforeRender. With the beforeFactory being the most often recommended. Additionally the Width Property of the Master Page is only available when the Master Page "Type" is set to "Custom", in my attempts I set this manually in the Property Editor General. Passing Values from the onFetch to beforeFactory must be done using a PersistentGlobalVariable which can only pass strings, not integers. I found all kinds of way for this to not work. Even passing "12in" in PersistentGlobalVariable failed to adjust the master page Width Either of these codes in beforeFactory will adjust the Master Page Width (when Type = Custom) Pass the Value reportContext.getReportRunnable().designHandle.getDesignHandle().findMasterPage("Simple MasterPage").setProperty("width","12in"); Calculate a value and pass it increaseWidth = 20; reportContext.getReportRunnable().designHandle.getDesignHandle().findMasterPage( "Simple MasterPage").setProperty("width",((2+increaseWidth)+"in")); In the end I have been unable to find or create a functional report that adjusts the Master Page Width passed on the number columns generated at report run time. I think it is possible, but doing so is beyond my current skills.

Gillum vows areas won’t be ‘forgotten’ if he wins MARIANNA — Most of the houses, the ones still standing, are crowned with blue tarps, and the heavy-duty trucks are still clearing massive trees snapped like matchsticks on the back roads surrounding the Sunrise Worship Center in Jackson County. For many members of the almost-all black audience who came to hear Democratic gubernatorial candidate Andrew Gillum speak Monday on the penultimate day before what voters have been told is the most important election in their lifetimes, Gillum represents more than the opportunity to make history by putting an African-American in the Florida governor’s mansion. The Tallahassee mayor also carries the promise of delivering what some of the region’s black residents feel has been lacking in the aftermath of the devastation wrought by Hurricane Michael, which made landfall in the Panhandle as a Category 4 hurricane on Oct. 10. “We need more support in the black areas,” Lori Hall, 42, told The News Service of Florida after Gillum addressed dozens of area residents during a final bus tour Monday. “It’s like we’re forgotten about.” Gillum veered from his typical stump speech, in which the gubernatorial candidate points out that he’s visited places like Calhoun County, The Villages and other conservative locales, to target the folks in the audience, some of whose homes still lack power. “Marianna, I want you to know that, even though this area is often referred to as the ‘Forgotten Coast,’ you’re not going to be forgotten with the Gillum-King administration,” Gillum, 39, said, referring to his running mate, Chris King. Florida “cannot be all that she needs to be if we’re leaving whole parts of the state” behind, he said. “We can’t reach our highest heights of potential. If we get parts of our areas that have been devastated by hurricanes, and we’re not real smart about how we reconstruct these areas, you start to lose population. Folks start to go other places. Jobs and industry decides that they don’t want to open up again. They’ll go someplace else. That won’t work for us. That won’t work for you. So you need a governor that’s going to go to work on your behalf to make sure that we get you back to 100 percent, that will get you back whole, that will make this an area that works, for everybody,” Gillum said, eliciting a roar from the crowd. Gillum is facing off Tuesday against Ron DeSantis, a Republican backed by President Donald Trump, in one of the most closely watched governor’s races in the nation. Trump traveled to the Sunshine State twice last week to boost enthusiasm for DeSantis and for Gov. Rick Scott, who is running against Democratic U.S. Sen. Bill Nelson. Meanwhile, former President Barack Obama held a rally Friday for Gillum and Nelson in Miami. Gillum’s drawn other A-list support as well; he’s been joined by black and Hispanic athletes and celebrities on the campaign trail since his surprise Aug. 28 victory in a crowded Democratic primary. After traveling to Marianna on Monday, Gillum was slated to go to Monticello, Madison and Crawfordville — North Florida towns not far from the mayor’s Tallahassee base. He was scheduled to close out the last day before the election with a “Bring It Home Midnight Rally and Concert,” featuring rapper Sean “Diddy” Combs, Angela Rye, DJ D-Nice and others at Florida A&M University, where Gillum began his political career as student body president. And Gillum’s election-night party, which will also take place at FAMU, will have some star-power, as well. California billionaire Tom Steyer, founder of the progressive NextGen America organization that focuses on college-age and young voters, will join Gillum and King, after meeting with students near Florida State University. Democrats across the state — and the nation — are hoping Gillum can help their party reverse course after being shut out of the governor’s mansion for more than two decades. Holding a blue Gillum sign inside the church, Rosa Pollock said she is “just elated” that the mayor came to her town. “I’m 72, but right now I feel like about 20. It just gave me so much energy,” Pollock told the News Service. The windows on her Marianna home are still missing, and a large tree is resting beside the house, but the roof is intact, Pollock said. Gillum hasn’t won her support because he’s black, but because of “what he’s saying he can do to help this area,” she said. “I learned a long time ago not to see color. … But I am so proud, on the other hand, that he is like me,” Pollock said. “His blackness is just the icing on the cake. That’s a smart young man. Trust me. He knows what he’s talking about. And I can feel his sincerity. I can feel that. I’m pretty good about being able to tell that about people. “ Pollock, a longtime Democrat, said she sees a boost of enthusiasm this year, compared to previous governor’s elections in Florida. “Because everybody’s like, oh no. We’ve got to get this thing changed. We’ve got to turn these red states back to blue,” she said.

Brutal Turnovers Continue as Lions End Season with 8th Straight Loss Matthew Stafford fumbled two balls away and lost another on an interception, while Mikel Leshoure coughed the ball up on a short play, with all four turnovers contributing to another in a long line of losses to end the season. Eight straight losses isn't so much a skid as it is a flaming car wreck. Which explodes. And then catches on fire again. The turnovers weren't the only story, and yet another slow offensive start by the Lions caused them to fall behind and forced them into a hole they would never climb out of. Calvin Johnson had fewer than 100 yards for the first time since Week 8 and failed to reach 2,000 yards, and the rest of the receivers continued to be mediocre, though Kris Durham made a really nice catch again in this game and might find a nice role for next season. Still, with the season wrapped, the Lions now have a very daunting task ahead of them. How do you fix a team which, really, was in a lot of close games that didn't fall its way? Is Jim Schwartz on the hot seat? Scott Linehan? What about the secondary? Is that the focus or is the offensive line? What about more receivers?

William Charles Redfield William Charles Redfield (March 26, 1789 – February 12, 1857) was an American meteorologist. He was the first president of the American Association for the Advancement of Science (1843). William Charles Redfield is known in meteorology for his observation of the directionality of winds in hurricanes (being among the first to propose that hurricanes are large circular vortexes, though John Farrar had made similar observations six years earlier), though his interests were varied and influential. Redfield organized and was a member of the first expedition to Mount Marcy in 1837; he was the first to guess that Marcy was the highest peak in the Adirondacks, and therefore in New York. Mount Redfield was named in his honor by Verplanck Colvin. He was elected an Associate Fellow of the American Academy of Arts and Sciences in 1845. At a meeting of the American Association for the Advancement of Science, in 1854, Redfield mentioned a storm-path in which no less than seventy odd vessels had been wrecked, dismasted, or damaged. See also James Espy Notes References Moore, Peter (2015), "The Weather Experiment, the pioneers who sought to see the future", New York, Farrar, Straus and Giroux, External links Category:1789 births Category:1857 deaths Category:American meteorologists Category:Fellows of the American Academy of Arts and Sciences Category:People from Middletown, Connecticut

It was a special treat having Sugar Ray Leonard and Usher together, as Usher will depict Sugar Ray Leonard in upcoming biopic “Hands of Stone”. Los Angeles, CA (PRWEB)May 29, 2013 B. Riley & Co. and The Sugar Ray Leonard Foundation presented The 4th Annual "Big Fighters, Big Cause" Charity Fight Night to benefit The Sugar Ray Leonard Foundation in its support for Juvenile Diabetes Research and The Wounded Warrior Project. This prestigious invitation-only Red Carpet event took place at The Santa Monica Pier on May 21, 2013. Tommy Davidson was the Master of Ceremony for the evening, which featured a Professional Boxing fight card commissioned by the California State Athletic Commission. Songstress Franchesca Robi (daughter of The Platters’ Paul Robi) sung the National Anthem to ring in the fights. The fight card consisted of four professional bouts. It was a special treat having Sugar Ray Leonard and Usher together, as Usher will depict Sugar Ray Leonard in upcoming biopic “Hands of Stone”. Sugar Ray Leonard and Usher showed off some moves in the ring and were soon joined by other celebrity guests. The event’s targeted audience of over 1400 guests comprised of C-suite executives from nearly 200 public companies across a range of sectors, leading institutional investors, high net worth individuals, financial services professionals, celebrities, sports legends, and other high-profile individuals. Zota Pop, a Top 40s band comprised of world-class musicians, provided musical entertainment along with DJ BABY CHINO, the 10-year-old DJ phenomenon who has been seen on Nickelodeon's hit show "Figure It Out". Rusnak, Maserati, BMW and Porsche, part of the Rusnak Auto Group proudly supported the Sugar Ray Leonard Foundation. Sugar Ray Leonard honored honor Medtronic, Inc. by presenting an Award in the ring for its work in Juvenile Diabetes with the Insulin Pump. The Hauser Insurance Group was also a proud supporter of the cause. The evening was set against a rich environment for both charitable and business development opportunities. The lovely ladies from Charity Angels and Crown Diva Boutique & Pageant Academy sold raffle tickets throughout the evening, benefitting the cause. Guests had the opportunity to win spectacular prizes. A true highlight of the evening was the Charitable Live Auction. Item Sparkling Hill Resort, a European-inspired wellness resort known as the first resort in the world to incorporate Swarovski crystal elements into every aspect of its design, stood out. The winner of this Live Auction Item received a gift certificate for a 5 night Couples Escape in a stunning penthouse suite, with access to a wide range of wellness treatments featured at the resort’s world-renowned Kurspa – a 40,000 square foot spa providing over 100 treatments and therapies. Guests enjoyed an abundance of delicious food and beverages. Legends Beer offered its premium craft beer in the Legends 100% recyclable aluminum bottle. Legends believes that consumers can have both great beer, and interesting content with the same package. The Sugar Ray Leonard Foundation was launched by boxing legend and six-time world champion Sugar Ray Leonard to benefit the Juvenile Diabetes Research. The mission of The Sugar Ray Leonard Foundation (SRLF) is to find a cure for diabetes and its complications through the support of research. After watching his father struggle with Diabetes and its complications for years, Ray is very passionate about finding a cure for Juvenile Diabetes. Ray is also very passionate about empowering wounded warriors dealing with post-traumatic stress disorder and other lasting effects of combat. Part of the proceeds from this event go to the Wounded Warrior Project (WWP). For more information about the Foundation and their cause, please visit: SugarRayLeonard.com B. Riley & Co., a leading full-service investment bank, provides a full array of corporate finance, research, sales, trading and otcqx dad services to corporate, institutional and high net worth clients. Headquartered in Los Angeles, with offices in San Francisco, New York, Newport Beach, Boston and Atlanta, the firm is recognized for its distinguished Equity Research. Their investment banking services include merger and acquisitions advisory to public and private companies, initial and secondary public offerings, and institutional private placements. Engaged by both companies and investors, their Corporate Governance Advisory Services Group helps maximize value for shareholders. Founded in 1997, the firm began by successfully targeting small-capitalization California-based companies and has won a reputation for providing proprietary, unbiased and often contrarian equity research coverage of companies that are under-followed or misunderstood by Wall Street. For more information, please visit http://www.brileyco.com

/* Copyright 1989, 1998 The Open Group Permission to use, copy, modify, distribute, and sell this software and its documentation for any purpose is hereby granted without fee, provided that the above copyright notice appear in all copies and that both that copyright notice and this permission notice appear in supporting documentation. The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE OPEN GROUP BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. Except as contained in this notice, the name of The Open Group shall not be used in advertising or otherwise to promote the sale, use or other dealings in this Software without prior written authorization from The Open Group. */ #ifndef _MULTIBUFCONST_H_ #define _MULTIBUFCONST_H_ #define MULTIBUFFER_PROTOCOL_NAME "Multi-Buffering" #define MULTIBUFFER_MAJOR_VERSION 1 /* current version numbers */ #define MULTIBUFFER_MINOR_VERSION 1 /* has ClearImageBufferArea */ /* * update_action field */ #define MultibufferUpdateActionUndefined 0 #define MultibufferUpdateActionBackground 1 #define MultibufferUpdateActionUntouched 2 #define MultibufferUpdateActionCopied 3 /* * update_hint field */ #define MultibufferUpdateHintFrequent 0 #define MultibufferUpdateHintIntermittent 1 #define MultibufferUpdateHintStatic 2 /* * valuemask fields */ #define MultibufferWindowUpdateHint (1L << 0) #define MultibufferBufferEventMask (1L << 0) /* * mono vs. stereo and left vs. right */ #define MultibufferModeMono 0 #define MultibufferModeStereo 1 #define MultibufferSideMono 0 #define MultibufferSideLeft 1 #define MultibufferSideRight 2 /* * clobber state */ #define MultibufferUnclobbered 0 #define MultibufferPartiallyClobbered 1 #define MultibufferFullyClobbered 2 /* * event stuff */ #define MultibufferClobberNotifyMask 0x02000000 #define MultibufferUpdateNotifyMask 0x04000000 #define MultibufferClobberNotify 0 #define MultibufferUpdateNotify 1 #define MultibufferNumberEvents (MultibufferUpdateNotify + 1) #define MultibufferBadBuffer 0 #define MultibufferNumberErrors (MultibufferBadBuffer + 1) #endif /* _MULTIBUFCONST_H_ */

--- author: - 'D. Barducci,' - 'S. De Curtis,' - 'S. Moretti' - 'and G.M. Pruna' bibliography: - '4DCHMLC.bib' title: | Top pair production at a future $e^+e^-$ machine\ in a composite Higgs scenario --- LAPTH-020/15\ PSI-PR-15-05\ Introduction ============ The large mass gap between the third generation Standard Model (SM) quarks and the first two, possibly hints at an intrinsic difference between the nature of these particles. While there is no explanation for this mass hierarchy in the SM, several New Physics (NP) scenarios attempt to find a resolution to this puzzle. Among these, Composite Higgs Models (CHMs), wherein the Higgs boson emerges as a pseudo Nambu-Goldstone Boson (pNGB) of a spontaneous breaking of a global symmetry in a new strongly interacting sector, play a special role. In fact, this type of NP framework is primarily designed as an alternative to the Electro-Weak Symmetry Breaking (EWSB) pattern of the SM and the idea goes back to the ’80s [@Kaplan:1983fs; @Georgi:1984ef; @Georgi:1984af; @Dugan:1984hq]. However, one modern ingredient of CHMs is the mechanism of so-called ‘partial compositeness’ [@Kaplan:1991dc], wherein the heaviest SM fermions (indeed, the third generation states) mix with new states arising from the strong sector in order to explain the mass difference with respect to the other SM fermions. The simplest example, based on the symmetry breaking pattern $SO(5)\to SO(4)$, was considered in [@Agashe:2004rs] in the context of 5-Dimensional (5D) scenarios while deconstructed 4D effective descriptions of this model were recently proposed [@Panico:2011pw; @DeCurtis:2011yx]. These explicit CHM constructions present several features of phenomenological relevance at colliders, as they include in their spectrum only the lowest lying resonances, both spin 1/2 and spin 1 states, arising as bound states of the new strongly interacting dynamics, that are the only degrees of freedom which might be accessible at the Large Hadron Collider (LHC) and future $e^+e^-$ machines. In particular the 4D Composite Higgs Model (4DCHM) of [@DeCurtis:2011yx] allows, due to the choice of its fermionic sector, for a finite one loop Higgs potential, calculable via the Coleman-Weinberg technique [@Coleman:1973jx], and, for a natural choice of the model parameters, the emerging Higgs mass turns out to be compatible with the measurements by the ATLAS [@Aad:2012tfa] and CMS [@Chatrchyan:2012ufa] experiments. Part of the new particle content of CHMs, both fermions and vector bosons, can manifest itself in $t\bar t$ production processes in two ways. One the one hand, potentially large deviations from the SM value of the $Ztt$ coupling can arise, because of the mixing between the top quark and its partners ($t'$s) or else between the $Z$ and its partners ($Z'$s). On the other hand, the neutral $Z'$ states can enter as propagating particles in the diagrams describing top pair production and thus contribute on their own or else through interference effects with the SM neutral gauge bosons. Concrete CHM realisations can therefore be used as an ideal theoretical scenario where to test the composite Higgs idea in $t\bar t$ production. This is the reason why a close look at this production process within the 4DCHM was taken in Ref. [@Barducci:2012sk]. Herein, it was shown that the additional $Z'$ resonances present in this CHM scenario could greatly affect the phenomenology of $t\bar t$ production at the LHC, through their effects onto both the cross section and (charge and spin) asymmetries, so long that they can be produced resonantly and subsequently decay into top-antitop pairs. Indeed, Ref. [@Barducci:2012sk] confirmed that the 13 TeV stage of the LHC will enable one to even detect such $Z'$ states, assuming standard detector performance and machine luminosity. However, at the LHC, the subprocess induced by $Zt\bar t$ interactions in top-pair production is EW in nature and further induced by $q\bar q$ scattering, hence it sees a double suppression with respect to the leading QCD background due to the $gg\to t\bar t$ channel. It cannot therefore be used to investigate deviations in the $Zt t$ coupling for which one should rely instead on the $t\bar t Z$ final state, whose experimental precision is unfortunately extremely limited at present, with errors of order 100% after the 7, 8 TeV LHC runs with full luminosity [@ttZ; @ttZ-ATLAS; @ttZ-ICHEP2014; @Khachatryan:2014ewa], and unlikely to be improved significantly at Run 2 with standard machine configuration[^1]. Possibly, a tenfold LHC luminosity upgrade [@Gianotti:2002xx] could overcome the poor sensitivity to the $Zt t$ coupling of the current CERN machine. Needless to say, a future $e^+e^-$ collider operating at the $t\bar t$ threshold and above would therefore be the ideal environment where to test both real and virtual CHM effects in the top-antitop cross section and asymmetries. Such machine prototypes currently include the International Linear Collider (ILC) [@Phinney:2007gp; @Behnke:2007gj; @Phinney:2007zz; @Djouadi:2007ik; @Brau:2007zza; @BrauJames:2007aa; @Behnke:2013lya; @Adolphsen:2013kya; @Adolphsen:2013jya; @Behnke:2013xla; @Baer:2013cma], the Compact Linear Collider (CLIC) [@Aicheler:2012bya] and the Triple Large Electron-Positron (TLEP) collider [@Gomez-Ceballos:2013zzn] (whose design study recently merged in the Future Circular Collider (FCC) one with the electron-positron option (FCC-ee) [@FCC-ee]). Rather independently of the actual machine, there are common characteristics that render $\epem$ colliders attractive with respect to $pp$ and $p\bar p$ ones: (i) a well defined initial state and controllable collision energy $\rs$; (ii) a particularly clean experimental environment since all processes are initiated by EW interactions; (iii) more accurate theoretical predictions for all event rates for the same reason; (iv) signals that are in general not swamped by backgrounds as the rates for the former do not differ from those of the latter by orders of magnitudes, as it happens at hadronic machines because of the QCD interaction dominance; (v) the possibility (at least in principle) of reconstructing any hadronic final state, with accuracy mainly driven by the detector jet-energy resolution and flavor-tagging efficiency; (vi) the possibility of having highly-polarised initial beams, which give an extra handle for enhancing particular signals and suppressing their backgrounds too. As a consequence, even at moderate Centre-of-Mass (CM) energy $\rs$, an $\epem$ collider can be quite competitive with respect to hadron colliders in performing precision physics, in particular, in the Higgs-boson sector, providing model-independent measurements of couplings and covering with ease even hadronic decay channels, and in the top-quark system, enabling the precise extraction of the top mass, width and couplings. The CM energy is of course a critical parameter in the present discussion. ILC studies have been focused on the $\rs=500$ GeV option for quite a long time, while envisaging the possibility to run at the top-pair threshold $\rs\simeq 350$ GeV for top precision measurements as well as even smaller $\rs$ in order to scrutinise $W$ and $Z$ boson physics. However, after the Higgs boson discovery, it has become obvious that a CM energy that enhances the associated production $\epem\to HZ$ would be optimal for Higgs precision measurements, which are now the highest priority. Both ILC and TLEP (and possibly CLIC) would conform with this physics requirements. Nevertheless, going to higher $\rs$, above and beyond 500 GeV, remains in the plan, as one can enlarge considerably the physics scope of the machine, by not only complementing the potential of studying the Higgs boson sector by onsetting Higgs production via vector boson fusion, but also enabling studies of new objects that may be found at the LHC in the meantime. While the possibility for upgrades to higher energies (up to $\rs\sim1$ TeV) with the same ILC technology is also envisaged, the multi-TeV regime is the natural operating ground of CLIC. It is the purpose of this study to assess the sensitivity of an $e^+e^-$ machine operating at energy scales between $\sim 2m_t$ and 3 TeV to variations of $t\bar t$ production induced by a composite Higgs scenario, by looking at inclusive observables, such as cross section as well as (charge and spin) asymmetries, with and without beam polarisation, and differential ones, mapped in terms of energy and angular variables. The plan of the paper is as follows. In Sect. \[top-measure\] we describe the top-quark measurements foreseen at a future $e^+e^-$ machine and contrast these with those planned at the LHC. In the following part, Sect. \[top-4DCHM\], we detail the effects onto the $t\bar t$ system induced by the 4DCHM while in Sect. \[top-selection\] we describe how they can be extracted. We then summarise and conclude in Sect. \[conclude\]. \[top-measure\] Top-quark measurements ====================================== The top quark is the heaviest known elementary particle. Thanks to its large mass, and the related strength of its coupling to the Higgs boson, this particle plays a central role in many NP models, particularly in understanding the details of EWSB. The properties of the top quark have in fact profound consequences, for instance, on the stability of the SM vacuum, which depends on the precise value of the top mass. As mentioned, while in the short- and mid-term future top-quark studies will be mainly driven by the LHC experiments, they will be an integral part of particle physics studies at any future facility [@Agashe:2013hma; @Moortgat-Pick:2013awa]. An $e^+ e^ -$ collider will have a rich top-quark physics programme mainly in two domains: accurate determination of top properties at the $t \bar t$ production threshold (e.g., measurement of $m_t$ with an uncertainty of $\sim$100 MeV on the ${\overline{\rm MS}}$ mass and of the top-quark gauge couplings at the percent level) and search for NP with top quarks above the $t\bar t$ threshold (e.g., direct measurement of the top-quark Yukawa coupling, extraction of rare top-quark decays, searches for new particles decaying into top-quark pairs, etc.). ![*Left: Statistical uncertainties on the CP-conserving top-quark axial and vector form factors expected at the LHC-13 with 300 fb$^{-1}$ [@Juste:2006sv; @Rontsch:2014cca] (red), at ILC-500 with 500 fb$^{-1}$ and beam polarisation of $P=\pm 0.8$, $P'=\pm 0.3$ (from [@Baer:2013cma], [@Amjad:2013tlv; @Asner:2013hla]) (blue) and at TLEP (FCC-ee) without beam polarisation with $\sqrt s=360$ GeV and 2.6 ab$^{-1}$ [@Janot:2015yza] (green). Right: Typical deviations for the $Zt_L t_L$ and $Z t_Rt_R$ couplings in various NP models represented by purple points (see [@Richard:2014upa]). The black points indicate the expected deviations for different choices of the 4DCHM parameters (see Fig. \[tLR\] later on). Also shown are the sensitivities expected after LHC-13 with 300 fb$^{-1}$, (region inside the red-dashed lines), after HL-LHC with 3000 fb$^{-1}$ (region inside the inner red-dashed lines), from ILC-500 with polarised beams (region inside the blue-dashed lines) [@Baer:2013cma] [and from FCC-ee (region inside the green lines: the continuous(dashed) line indicates the bounds extracted from the angular and energy distribution of leptons($b$-quarks))]{} in the extraction of the $Zt_L t_L$ and $Z t_Rt_R$ couplings.*[]{data-label="grojean"}](Janot_bounds.pdf "fig:"){width="48.00000%"} ![*Left: Statistical uncertainties on the CP-conserving top-quark axial and vector form factors expected at the LHC-13 with 300 fb$^{-1}$ [@Juste:2006sv; @Rontsch:2014cca] (red), at ILC-500 with 500 fb$^{-1}$ and beam polarisation of $P=\pm 0.8$, $P'=\pm 0.3$ (from [@Baer:2013cma], [@Amjad:2013tlv; @Asner:2013hla]) (blue) and at TLEP (FCC-ee) without beam polarisation with $\sqrt s=360$ GeV and 2.6 ab$^{-1}$ [@Janot:2015yza] (green). Right: Typical deviations for the $Zt_L t_L$ and $Z t_Rt_R$ couplings in various NP models represented by purple points (see [@Richard:2014upa]). The black points indicate the expected deviations for different choices of the 4DCHM parameters (see Fig. \[tLR\] later on). Also shown are the sensitivities expected after LHC-13 with 300 fb$^{-1}$, (region inside the red-dashed lines), after HL-LHC with 3000 fb$^{-1}$ (region inside the inner red-dashed lines), from ILC-500 with polarised beams (region inside the blue-dashed lines) [@Baer:2013cma] [and from FCC-ee (region inside the green lines: the continuous(dashed) line indicates the bounds extracted from the angular and energy distribution of leptons($b$-quarks))]{} in the extraction of the $Zt_L t_L$ and $Z t_Rt_R$ couplings.*[]{data-label="grojean"}](FIG1_Updated.pdf "fig:"){width="48.00000%"} Moreover, machines with the possibility of polarised electron and/or positron beams will allow additional precision measurements of the couplings of the top quark to the photon and to the $Z$ by measuring polarisation-dependent asymmetries and cross sections [@Grzadkowski:2000nx]. The ILC (and possibly CLIC), for example, provides an ideal setup for this type of scenario, with a large set of observables allowed by the polarisation of both leptonic beams. In fact, also a machine like TLEP (or a generic FCC-ee) will have the possibility to extract with great precision the couplings of the photon and $Z$ to the top quark even without polarised initial beams, by analysing observables involving different helicities of the produced (anti)top quark [@Janot:2015yza], as its polarisation is transferred to the final state particles via the weak decays rather efficiently. In the end, the two beam options (with and without polarisation) are competitive. On the one hand, the polarisation of the initial $e^+e^-$ state does not correspond to a unique spin combination of the final $t\bar t$ system. On the other hand, the lack of beam polarisation is compensated by a larger integrated luminosity. The top-quark couplings to the photon and $Z$ can be parametrised in several ways. For example, in [@Baer:2013cma], the analysis makes use of the usual form factors defined by[^2]: $$\Gamma_\mu^{ttX}(k^2,q,\bar q)=-i e\big [\gamma_\mu (F_{1V}^X(k^2)+\gamma_5F_{1A}^X(k^2))+\frac {\sigma_{\mu\nu}}{2 m_t}(q+\bar q)^{\nu}(i F_{2V}^X(k^2)+\gamma_5F_{2A}^X(k^2))\Big] \label{F}$$ where $e$ is the proton charge, $m_t$ is the top-quark mass, $q$ ($\bar q$) is the outgoing top (antitop) quark four-momentum and $k^ 2=(q+\bar q)^2$. The terms $F_{1V,A}^{X}(0)$ in the low energy limit are the $ttX$ vector and axial-vector form-factors (at tree level the only non-vanishing ones in the SM are $F_{1V,A}^{Z}$ and $F_{1V}^\gamma$). It is particularly interesting to study the couplings of the top quark to the photon and $Z$ to search for NP effects. As intimated, at hadron colliders, the EW production of $t\bar t$ is suppressed with respect to QCD production and this is especially true at the LHC where most of the $t\bar t$ production comes from gluon-gluon fusion. In the case of the $t\bar t Z$ final state, relatively clean measurements are expected at the LHC for the $Z$ decaying leptonically. However the cross section is quite small, so that only a precision of about 10% for $F_{1A}^Z$ is expected after a few 100 fb$^{-1}$ (at the HL-LHC with an integrated luminosity of 3000 fb$^{-1}$ the precision of this measurement is expected to improve by a factor 3 or so). In contrast, the sensitivity to $F_{1V}^Z$ is very poor. The sensitivities achievable for the CP-conserving top-quark form factors $F^X_{1V},~F^Z_{1A},~ F^X_{2V}$, defined in Eq. (\[F\]), at the LHC running at 13 TeV (LHC-13) after 300 fb$^{-1}$ are reported in the left panel of Fig. \[grojean\] and are taken from [@Juste:2006sv; @Rontsch:2014cca]. Also shown are the sensitivities reachable at the 500 GeV ILC (ILC-500) assuming an integrated luminosity of 500 fb$^{-1}$ and 80% electron and 30% positron polarisation [@Amjad:2013tlv; @Asner:2013hla]. Very recently an analysis in [@Janot:2015yza] exploited the reach of TLEP (FCC-ee) in the energy configuration $\sqrt{s}$=360 GeV with unpolarised beams and with an integrated luminosity of 2.6 ab$^{-1}$. The result is that a choice of optimal observables of the lepton angular and energy distributions of events from $t\bar t$ production in the $l \nu q \bar q b \bar b$ final states can give sensitivities to the top-quark EW couplings which are comparable to the ones from a polarised ILC-500. [This is well manifest from the two green contours in the figure, wherein the plain ellipse is obtained via the angular and energy distributions of leptons while the dashed one is extracted from the angular and energy distributions of $b$-quarks.]{} Overall, [despite relatively merits of ILC versus TLEP (FCC-ee) cannot (and need not) be rigorously ascertained here[^3],]{} it is clear that an $e^+ e^-$ collider is very powerful in increasing the sensitivities to both the vector and axial-vector form factors beyond the LHC scope, thus allowing for an independent measurement of the left- and right-components of the $Z t t$ couplings at the percent level. Many extensions of the SM typically induce large deviations in $Z$ boson couplings to $t \bar t$. In general, any new fermion which mixes with the third generation quarks might affect this coupling strength and, depending on the NP scheme, such deviations can be different for the left- and right-components. In [@Richard:2014upa] a wide spectrum of predictions for deviations of the $Ztt$ couplings in various BSM scenarios, like Randall-Sundrum models, Little Higgs and CHMs, was considered. In all these schemes the top quark is assumed to carry a great deal of compositeness through the mixing with new heavy fermions but also a mixing between the SM gauge bosons and the heavy vector states can induce variations of the top-quark EW couplings. These deviations, expressed in the $ Z t_L t_L$ and $Zt_R t_R$ couplings, for a generic NP scale around 1 TeV, are pictorially drawn in Fig. \[grojean\] (right panel), where the purple points represent typical deviations for different NP scenarios. The region within the [outer(inner) red-]{}dashed lines represents the sensitivity which can be reached by the LHC-13[(HL-LHC)]{} with 300[(3000)]{} fb$^{-1}$ of integrated luminosity through the $ttZ$ cross section measurement [@Juste:2006sv; @Rontsch:2014cca], while the ILC-500 sensitivity with 500 fb$^{-1}$ of integrated luminosity (detailed by the blue-dashed contour) can be at the percent level (the ILC-500 expected accuracies for the $t_L$ and $t_R$ couplings can be estimated to be $\Delta (Zt_Lt_L)/Zt_Lt_L(\%)\simeq0.6$ and $\Delta (Zt_Rt_R)/Zt_Rt_R(\%)\simeq1.4$ [@Amjad:2013tlv; @Asner:2013hla]). As a result, with an $e^+e^-$ collider, one can in general reach an excellent separation of different NP models while the LHC will not be able to do so even at the high-luminosity option. This is clear for the NP scheme we will consider in this paper as a prototype of CHMs. In fact, in the right plot of Fig. \[grojean\] we also include the points corresponding to the deviations obtained within the 4DCHM (as described in the next section). It is then clear that the LHC will not be able to disentangle the 4DCHM by the SM for a wide range of its parameter space[^4]. \[top-4DCHM\] Top pair production in the 4DCHM ============================================== Calculation ----------- Let us consider the process $e^+e^-\to t \bar t$ in the calculable setup provided by the 4DCHM [@DeCurtis:2011yx], which encodes the main characteristics of CHMs wherein the physical Higgs state is a pNGB emerging from the $SO(5)\to SO(4)$ breaking. Models of this kind generally predict modifications of its coupling to both bosons and fermions of the SM, hence the measurements of these quantities represent a powerful way to test the possible non-fundamental nature of the newly discovered state [@Barducci:2013wjc; @Barducci:2013ioa]. Furthermore, the presence of additional particles, both spin-1 and spin-1/2, in the spectrum of such CHMs leads to mixing effects with the SM states with identical quantum numbers as well as new Feynman diagram topologies, both of which would represent a source of deviations from the SM expectations. Now, focusing onto the 4DCHM as an illustrative example representing a description of the minimal additional heavy matter to ensure a finite effective potential for the Higgs state, modifications in the $e^+e^-\to t \bar t$ process arise via the following effects: (i) corrections to the $Zee$ coupling due to the mixing of the $Z$ with the $Z'$s, which however is very small in the parameter range considered; (ii) corrections to the $Z t t$ coupling which come from the mixing of the $Z$ with the $Z'$s but also from the mixing of the top (antitop) with the extra-(anti)fermions, as expected because of the partial compositeness mechanism; (iii) the presence of new particles, namely the $s$-channel exchange of $Z'$s, which can be sizeable also for large $Z'$ masses due to the interference with the SM states. In the model independent effective approaches which are generally used for the phenomenological study of CHMs, the latter effect is not captured. However, as we will show, it can be crucial from moderate to high CM energies of a lepton collider. Specifically, the framework on which we base our analysis, the 4DCHM, describes, in addition to the SM particles, a large number of new ones both in the fermionic and bosonic (gauge) sector. In particular, 5 neutral and 3 charged extra spin-1 resonances are present, together with 8 partners of the top and of the bottom quarks, called in a general way $t^\prime$ and $b^\prime$. Moreover 4 exotic extra fermions, 2 with charge 5/3 and 2 with charge $-4/3$, are present (called $X$ and $Y$, respectively). See [@Barducci:2012kk] for details of the model implementation adopted here. In general, the 4DCHM can be schematised as a two site model arising from an extreme deconstruction of a 5D theory and can be described by two sectors, mixed between themselves via the mechanism of partial compositeness. The gauge structure of the elementary sector is associated with the $SU(2)_L\otimes U(1)_Y$ SM gauge symmetry whereas the composite sector has a local $SO(5)\otimes U(1)_X$ symmetry. The parameters of the gauge sector are: $f$, the scale of the spontaneous global symmetry breaking $SO(5)\to SO(4)$ in the TeV range, and $g_\rho$, the $SO(5)$ strong gauge coupling constant (which for simplicity we take equal to the $U(1)_X$ one). Regarding the fermionic sector, we just recall that the new heavy states (20 in total) are embedded in fundamental representations of $SO(5)\times U(1)_X$ and two multiplets of states for each of the SM third generation quarks are introduced in such a way that only top and bottom quarks mix with these heavy fermionic resonances in the spirit of partial compositeness. This choice of representation is a realistic scenario compatible with EW precision measurements. The SM third generation quarks are embedded in an incomplete representation of $SO(5)\otimes U(1)_X$ in such a way that their correct hypercharge is reproduced via the relation $Y=T^{3R}+X$. Notice also that this is the minimum amount of new heavy fermion content necessary for an ultra-violet finite Higgs potential which is radiatively generated [@DeCurtis:2011yx]. The Lagrangian describing the gauge and top sectors of the 4DCHM is the following: $$\begin{split} \mathcal{L_{\rm 4DCHM}}\supset&\frac{f^2}{2}Tr|D_{\mu}\Omega|^2+f^2(D_{\mu}\Phi)(D_{\mu}\Phi)^T+\\ +&(\Delta_{t_L}\bar{q}_L\Omega\Psi_T+\Delta_{t_R}\bar{t}_R\Omega\Psi_{\tilde{T}}+h.c.)+\\ -&m_*(\bar{\Psi}_T \Psi_T+\bar{\Psi}_{\tilde{T}}\Psi_{\tilde{T}})+\\ -&(Y_T\bar{\Psi}_{T,L}\Phi^T\Phi\Psi_{\tilde{T},R}+M_{Y_T}\bar{\Psi}_{T,L}\Psi_{\tilde{T},R}+h.c.)\\ \end{split}$$ with the covariant derivatives defined by $$\begin{aligned} D^{\mu}\Omega&=&\partial^{\mu}\Omega-i g_{0}\tilde{W}\Omega+i g_\rho\Omega\tilde{A},\\ D_{\mu}\Phi&=&\partial_{\mu}\Phi-i g_\rho\tilde{A}\Phi\end{aligned}$$ where $(g_0,\tilde W)$ and $(g_\rho,\tilde A)$ indicate in a generalised way the gauge couplings and gauge fields of the elementary and composite sector, respectively. The field $\Omega$, responsible for the symmetry breaking, is given by $$\Omega=\textbf{1}+i\frac{s_h}{h}\Pi+\frac{c_h-1}{h^2}\Pi^2,\quad s_h,c_h=\sin,\cos(h/2 f),\quad h=\sqrt{h^{\hat{a}}h^{\hat{a}}},$$ where $\Pi=\sqrt{2}h^{\hat{a}}T^{\hat{a}}$ is the PNGB matrix with $T^{\hat{a}}$ the broken generators of $SO(5)/SO(4)$. The field $\Phi$ is a vector of $SO(5)$ that describes the spontaneous symmetry breaking of $SO(5)\rightarrow SO(4)$ and is given by $\Phi=\phi_0\Omega^T$ where $\phi_0^i=\delta^{i5}$. Finally, $\Psi_{T,\tilde T}$ are the two fundamental representations of $SO(5)$ in which the new fermions are embedded in, and $\Delta_{t_L,t_R},m_*$ and $Y_T,M_{Y_T}$ the parameters describing the linear mixing between the elementary and composite sector, the mass parameter of the new extra quarks and the parameters describing the new quark interactions with the GB fields and among themselves. For brevity we do not write the Lagrangian of the bottom sector, for which similar expressions hold. Among the various new states of the 4DCHM, the relevant ones, for the purpose of our study, are the neutral gauge bosons $Z'_{2,3}$ (in fact the $Z'_{1,4}$ states are essentially inert as they do not couple to $e^+e^-$ while the $Z'_5$ is only poorly coupled [@Barducci:2012kk]) and the additional fermions which affect the $Z'$ widths. The mass spectrum of the spin-1 fields is computed at the scale $f$, with $f$ around 1 TeV to avoid excessive fine tuning. In particular, $Z'_{2,3}$ are nearly degenerate, while the $Z'_5$ is heavier: $$\begin{split} & M^2_{Z^\prime_2}\simeq \frac{ m_\rho^2}{c_\psi^2} (1-\frac{s_\psi^2 c_\psi^4}{4 c_{2\psi}}\xi),\\ & M^2_{Z^\prime_3}\simeq \frac{ m_\rho^2}{c_\theta^2} (1-\frac{s_\theta^2 c_\theta^4}{4 c_{2\theta}}\xi),\\ & M^2_{Z^\prime_5}\simeq 2 m_\rho^2 \left[1+\frac 1 {16} (\frac 1 {c_{2\theta}}+\frac 1{2 c_{2 \psi}})\xi\right] \end{split} \label{MZ'}$$ with $m_\rho=f g_\rho$, $s_\theta/c_\theta=g_0/g_\rho$, $s_\psi/c_\psi=g_{0Y}/g_\rho$, $g_0$ and $g_{0Y}$ being the $SU(2)_L$ and $U(1)_Y$ gauge couplings respectively, $\xi=v^2/f^2$ and $v$ the Vacuum Expectation Value (VEV) of the Higgs state. The first two resonances correspond the the neutral component of the $(\textbf{3,1})$ and $(\textbf{1,3})$ triplet of the unbroken $SU(2)_L$ and $SU(2)_R$ while the latter to the heaviest gauge boson of the $SO(5)/SO(4)$ coset. The fermionic Lagrangian of the 4DCHM [@DeCurtis:2011yx] contains the mixing parameters relating the elementary and the composite sectors as well as the Yukawas of the latter. The top and bottom quark masses are proportional to the EWSB parameters and to the elementary/composite sector mixings as suggested by the partial compositeness hypothesis. For the process of interest here, $e^ + e^ - \to\ \gamma, Z, Z'\to t\bar t$, we need the couplings of the $Z,Z'$ to the electron-positron pair which live in the elementary sector and those to the top-antitop pair which interacts with the composite fermionic sector. While the former come only from the mixing $Z-Z'$, in the latter also the mixing of the third generation (anti)quarks with the new heavy fermions has to be taken into account. The analytic expressions at the leading order in $\xi$ for the neutral current interaction Lagrangian of the 4DCHM are given in [@Barducci:2012sk]. Concerning the $Ztt$ vertex modifications, we plot in Fig. \[tLR\] the deviations of the left- and right-handed couplings with respect to the SM ones. (Here, $\Delta g_L/g_L=(g_L^{\rm 4DCHM}-g_L^{\rm SM})/g_L^{\rm SM}$, where $g_L^{\rm SM}$ is the $Z t_L t_L$ coupling within the SM, and the same definition holds for the right-component.) ![ *Deviations of the left- and right-handed couplings of the $Z$ to $t \bar t$ in the 4DCHM with respect to the SM ones. The red points correspond to a scan with $0.75$ TeV $\le f\le 1.5$ TeV, $1.5\le g_\rho\le 3$ and on the extra-fermion sector parameters as described in [@Barducci:2012kk]. The black points correspond to the subset with $M_{Z^\prime}\sim f g_\rho>2$ TeV and $M_{t^\prime}>782$ GeV, $M_{b^\prime}>785$ GeV and $M_{X}>800$ GeV (left), while in the right plot bounds on the masses of the extra fermions are imposed to be universal and equal to 1 TeV.* []{data-label="tLR"}](dgr_dgl.png "fig:"){width="35.00000%"} ![ *Deviations of the left- and right-handed couplings of the $Z$ to $t \bar t$ in the 4DCHM with respect to the SM ones. The red points correspond to a scan with $0.75$ TeV $\le f\le 1.5$ TeV, $1.5\le g_\rho\le 3$ and on the extra-fermion sector parameters as described in [@Barducci:2012kk]. The black points correspond to the subset with $M_{Z^\prime}\sim f g_\rho>2$ TeV and $M_{t^\prime}>782$ GeV, $M_{b^\prime}>785$ GeV and $M_{X}>800$ GeV (left), while in the right plot bounds on the masses of the extra fermions are imposed to be universal and equal to 1 TeV.* []{data-label="tLR"}](dgr_dgl_1TeV.png "fig:"){width="35.00000%"}\ In the plots, the red points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$ (which are natural values for the scale $f$ of the underlying strong sector, in order to avoid the aforementioned fine tuning, and for the new strong coupling constant) and a scan on the extra-fermion sector parameters as described in [@Barducci:2012kk]. In doing so, we impose the requirement that the physical quantities $e, M_Z, G_F, m_t,m_b,v,m_H$ are consistent with experimental data. For the first three we adopt the current Particle Data Group (PDG) values [@Beringer:1900zz] while for the last four we require $165\le m_t\le 175$, $2$ GeV $\le m_b \le 6$ GeV, $v \simeq 246$ GeV and $120$ GeV $\le m_H\le 130$ GeV. The black points (already pictorially reported in Fig. \[grojean\]) correspond instead to $M_{Z^\prime}\sim f g_\rho>2$ TeV and $M_{t^\prime}>782$ GeV, $M_{b^\prime}>785$ GeV and $M_{X}>800$ GeV for the left panel. These requests represent allowed configurations from both EWPTs[^5] and direct searches (see [@Chatrchyan:2013uxa; @CMS:2013una; @Chatrchyan:2013wfa] for the latest CMS results for direct searches of extra fermions). For the case of the $t^\prime$ and $b^\prime$ states, the experimental collaborations set bounds depending on their decay branching fractions. For our analysis we have chosen to impose the strongest of these limits as a naive estimate. The 13 TeV run of the LHC is expected, if no such $t'$ and $b'$ states are discovered, to set stronger bounds on the masses of these particles. For this reason we enforce in the right panel of Fig. \[tLR\] a general 1 TeV cut on the masses of all the extra fermions. This requirement slightly reduces the number of allowed points without however significantly changing the size of the deviations. Therefore our analyses will be performed while enforcing the actual bounds on the extra fermions. As it is clear from the plots, there is a common trend in reduction of the left-handed coupling while the right-handed one is enhanced. The modifications can be substantial: up to 20% for the $Zt_R t_R$ coupling whereas they can reach $-10\%$ for the $Zt_L t_L$ one. By comparing with the sensitivities shown, one can realise that the 4DCHM induced deviations may be hard to detect at the LHC-13 or HL-LHC. In fact, the LHC can reach a 10% sensitivity in the $Ztt$ axial coupling measurement while it is quite insensitive to the vector one [@Baer:2013cma]. On the contrary, the ILC expected accuracies [@Amjad:2013tlv; @Asner:2013hla] could be able to disentangle the 4DCHM (or similar CHMs) from other NP models and the SM itself. As stated, the indirect signals from a CHM are not only encoded in the coupling modifications. In fact, the interferences due to the $Z'$s (mainly $Z'_{2,3}$) $s$-channel exchanges play a crucial role. In this respect it is important to stress that the extra gauge bosons of the 4DCHM may have different widths depending on the choice of the composite fermion sector parameters. As pointed out in [@Barducci:2012kk], one can divide the mass spectrum of the latter in two distinct configurations, as follows: (i) a regime where the mass of the lightest fermionic resonance is too heavy to allow for the decay of a $Z'$ in a pair of heavy fermions and, consequently, the widths of the $Z'$s are small, typically well below 100 GeV; (ii) a regime where a certain number of masses of the new fermionic resonances are light enough to allow for the decay of a $Z'$ in a pair of heavy fermions and, consequently, the widths of the involved $Z'$ states are relatively large and can become even comparable with the masses themselves. Let us now compare the deviations due to the 4DCHM with respect to the SM expectations for the following observables: the total cross section $\sigma(e^+e^-\to t\bar t)$, the Forward-Backward Asymmetry $A_{FB}$ plus the (single and double, respectively) spin asymmetries $A_{L}$ and $A_{LL}$ defined as follows: $$\begin{split} & A_{FB}= \frac{N(\cos\theta^*>0)-N(\cos\theta^*<0)}{N_{\rm tot}},\\ & A_L=\frac{N(-,-)+N(-,+)-N(+,+)-N(+,-)}{N_{\rm tot}},\\ & A_{LL}=\frac{N(+,+)+N(-,-)-N(+,-)-N(-,+)}{N_{\rm tot}}, \end{split} \label{asym}$$ with $\theta^*$ the polar angle in the $t \bar t$ rest frame (which would coincide with the CM frame if no radiation from the initial state occurred prior to the hard scattering). $N$ denotes the number of observed events in a given hemisphere (for $A_{FB}$) or for a set polarisation (for $A_L$ and $A_{LL}$), in which case its first (second) argument corresponds to the helicity of the final state top (antitop), whereas $N_{\rm tot}$ is the total number of events. In particular, $A_L$ singles out one final state particle, comparing the number of its positive and negative helicities while summing over the helicities of the antiparticle (or *vice versa*) whereas $A_{LL}$ relies on the helicity flipping of either of the final state particles. These spin (or polarisation) asymmetries focus on the helicity structure of the final state fermions which can be reconstructed in top (antitop) (semi-)leptonic decays with leptons used as spin analysers. In general, such asymmetries are extracted as coefficients in the angular distributions of the top (antitop) decay products, as described in [@Bernreuther:2008ju]. In order to perform the aforementioned calculations in an automated way, several openly available tools were used. The described model was first implemented in LanHEP v3.1.9 [@Semenov:2010qt] with the use of the SLHA+ library [@Belanger:2010st], so as to obtain an output of Feynman rules in CalcHEP format [@Pukhov:1999gg; @Belyaev:2012qa] (available at the HEPMDB website [@HEPMDB]), upon which one of two Monte Carlo (MC) partonic event generators was built. However, since CalcHEP does not implement polarisation, a second code was constructed based on MadGraph [@Stelzer:1994ta], which agreed entirely with the above one in the unpolarised case. The approximation of our calculations is at tree level for what concerns MC event generation whereas some loop corrections were included in the computation of the model spectra (again, see [@Barducci:2012kk] for details). Finally, although Initial State Radiation (ISR) and Beam-Strahlung (BS) affecting the colliding leptons should in principle be accounted for, we have verified their essentially negligible impact throughout. For the former, the standard expressions of Refs. [@Jadach:1988gb; @Skrzypek:1990qs] were considered. Regarding the latter, the parametrisation specified for the ILC project in [@Behnke:2013xla] was adopted: i.e., - beam size $(x+y)$: $645.7$ nm, - bunch length: $300$ $\mu$m, - bunch population: $2\cdot10^{10}$. Even if the presence of ISR and BS can uniformly affect specific observables (e.g., the asymmetries of the 4DCHM and the SM independently show a uniform relative correction of $5\%$($3\%$) at $\sqrt{s}=370$($500$) GeV), the relative trend of the 4DCHM observables with respect to the SM ones is independent of the presence of ISR and BS. Therefore, for ease of computation and to improve simulation speed, such features will not be considered any further. Results ------- Here we will consider three discrete energy values for an $e^+ e^-$ collider, 370, 500 and 1000 GeV. Further, we will discuss results without and with polarisation of the initial beams in turn. To have an idea of the typical deviations induced by the 4DCHM with respect to the SM in the mentioned observables, in Fig. \[differential\] we plot, for a single benchmark point ($M_{Z'_{2,3,5}}$= 2122, 2214, 2831 GeV, $\Gamma_{Z'_{2,3,5}}$= 452, 319, 91 GeV), the differential distributions for the cross section $\sigma$ with respect to $\cos\theta^*$ and of the single spin asymmetry $A_L$ with respect to the transverse momentum ($p_T$) of the emitted top (anti)quark, for the aforementioned different fixed energy options. ![*Differential distributions for the cross section $\sigma$ with respect to $\cos\theta^*$ (left) and for the single spin asymmetry $A_L$ with respect to the $p_T$ (right) of the emitted top quark, for the three different energy options within the SM (dashed) and the 4DCHM (solid) for $M_{Z'_{2,3,5}}$= 2122, 2214, 2831 GeV and $\Gamma_{Z'_{2,3,5}}$= 452, 319, 91 GeV.*[]{data-label="differential"}](bench1-370-sigma.pdf "fig:"){width="57.00000%"} ![*Differential distributions for the cross section $\sigma$ with respect to $\cos\theta^*$ (left) and for the single spin asymmetry $A_L$ with respect to the $p_T$ (right) of the emitted top quark, for the three different energy options within the SM (dashed) and the 4DCHM (solid) for $M_{Z'_{2,3,5}}$= 2122, 2214, 2831 GeV and $\Gamma_{Z'_{2,3,5}}$= 452, 319, 91 GeV.*[]{data-label="differential"}](bench1-370-AL.pdf "fig:"){width="57.00000%"}\ ![*Differential distributions for the cross section $\sigma$ with respect to $\cos\theta^*$ (left) and for the single spin asymmetry $A_L$ with respect to the $p_T$ (right) of the emitted top quark, for the three different energy options within the SM (dashed) and the 4DCHM (solid) for $M_{Z'_{2,3,5}}$= 2122, 2214, 2831 GeV and $\Gamma_{Z'_{2,3,5}}$= 452, 319, 91 GeV.*[]{data-label="differential"}](bench1-500-sigma.pdf "fig:"){width="57.00000%"} ![*Differential distributions for the cross section $\sigma$ with respect to $\cos\theta^*$ (left) and for the single spin asymmetry $A_L$ with respect to the $p_T$ (right) of the emitted top quark, for the three different energy options within the SM (dashed) and the 4DCHM (solid) for $M_{Z'_{2,3,5}}$= 2122, 2214, 2831 GeV and $\Gamma_{Z'_{2,3,5}}$= 452, 319, 91 GeV.*[]{data-label="differential"}](bench1-500-AL.pdf "fig:"){width="57.00000%"}\ ![*Differential distributions for the cross section $\sigma$ with respect to $\cos\theta^*$ (left) and for the single spin asymmetry $A_L$ with respect to the $p_T$ (right) of the emitted top quark, for the three different energy options within the SM (dashed) and the 4DCHM (solid) for $M_{Z'_{2,3,5}}$= 2122, 2214, 2831 GeV and $\Gamma_{Z'_{2,3,5}}$= 452, 319, 91 GeV.*[]{data-label="differential"}](bench1-1000-sigma.pdf "fig:"){width="57.00000%"} ![*Differential distributions for the cross section $\sigma$ with respect to $\cos\theta^*$ (left) and for the single spin asymmetry $A_L$ with respect to the $p_T$ (right) of the emitted top quark, for the three different energy options within the SM (dashed) and the 4DCHM (solid) for $M_{Z'_{2,3,5}}$= 2122, 2214, 2831 GeV and $\Gamma_{Z'_{2,3,5}}$= 452, 319, 91 GeV.*[]{data-label="differential"}](bench1-1000-AL.pdf "fig:"){width="57.00000%"} We expect that such deviations are all detectable within experimental errors, which are generally claimed to be at the level of percent or even smaller for both the cross section and the asymmetry [@Amjad:2013tlv; @Asner:2013hla; @Janot:2015yza; @Khiem:2015ofa]. Concerning the differential behaviour, the cross section deviations are larger in the backward region while for $A_L$ they are slightly bigger for small $p_T$. Whether or not the differential behaviour can be fully established, also the integrated cross sections and single spin asymmetry do deviate from their SM values: namely, we have, for this particular benchmark point, $|\sigma^{\rm 4DCHM}-\sigma^{\rm SM}|/\sigma^{\rm SM}=4, 9, 53\% $ and $|A_{L}^{\rm 4DCHM}- A_{L}^{\rm SM}|/A_{L}^{\rm SM}=9, 10, 17\%$ for $\sqrt{s}=370, 500, 1000$ GeV, respectively. Such dynamics at differential level is very typical over a wide collection of kinematic observables and the fact that we have chosen here $\sigma$ and $A_L$ as reference measures is not coincidental, as we shall see that they are affording the largest corrections. But let us now concentrate on the integrated values of the cross sections and asymmetries in order to disentangle the various sources of deviations with respect to the SM expectations. In doing this exercise, we do not enforce selection cuts, as we are working with on-shell top quarks whereas these are applied to their decay products. However, we do not expect that finite efficiencies due to enforcement of selection cuts will affect our conclusions. ![*Predicted deviations for the cross section versus $A_{FB}$ for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM (top panel) and the corresponding ones with removed $Z'$ exchange in the $s$-channel (bottom panel). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AFB"}](Rxs_RAFB_370.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{FB}$ for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM (top panel) and the corresponding ones with removed $Z'$ exchange in the $s$-channel (bottom panel). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AFB"}](Rxs_RAFB_500.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{FB}$ for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM (top panel) and the corresponding ones with removed $Z'$ exchange in the $s$-channel (bottom panel). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AFB"}](Rxs_RAFB_1000.png "fig:"){width="33.00000%"}\ ![*Predicted deviations for the cross section versus $A_{FB}$ for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM (top panel) and the corresponding ones with removed $Z'$ exchange in the $s$-channel (bottom panel). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AFB"}](Rxs_RAFB_nozp_370.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{FB}$ for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM (top panel) and the corresponding ones with removed $Z'$ exchange in the $s$-channel (bottom panel). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AFB"}](Rxs_RAFB_nozp_500.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{FB}$ for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM (top panel) and the corresponding ones with removed $Z'$ exchange in the $s$-channel (bottom panel). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AFB"}](Rxs_RAFB_nozp_1000.png "fig:"){width="33.00000%"} The results of the aforementioned scan mapped in $\sigma$ and $A_{FB}$ for the three customary choice of the $e^+e^-$ CM energy are found in Fig. \[xs\_AFB\]. Herein, we can appreciate the importance of the interference between the SM gauge bosons and the $Z'$s. In fact, the shown correlations between the expected deviations in $\sigma$ and $A_{FB}$ are dramatically different depending on whether we include or not the propagation of the $Z'$ states, especially for the cross section. The effect of $Z'$ exchange in the cross section is very important already at $\sqrt{s}$=370 GeV. In fact, the interference tends to compensate the lowering of the cross section due to the coupling modification (see bottom panels of Fig. \[xs\_AFB\]) and finally gives a positive contribution which grows with energy, just like the interference does, when approaching the mass value of the new resonances (as previously said, there are mainly two nearly-degenerate $Z'$s contributing to the process, namely $Z'_2$ and $Z'_3$). Deviations up to 50% are expected in the total cross section at $\sqrt{s}$=1000 GeV while the effect on the $A_{FB}$ is less evident. The relatively different effect is understood, as for this observable we are dividing by the total cross section and this washes out the large $Z'$ interference dependence, which is similar in both the forward and backward hemispheres. The overall size of the deviations does not change when we enforce a larger cut of 1 TeV on the mass of the extra fermions, thus assuming that no extra fermions will be observed at LHC Run 2 with mass larger than 1 TeV. Anyhow, this stronger mass cut slightly reduces the deviations on $A_{FB}$ but it affects $\sigma$ very little. Let us now extract the sensitivity to the relevant parameters of a typical CHM, herein realised via the 4DCHM, from the various $e^+e^-\to t \bar t$ observables. In Fig. \[colour\_xi\] we plot, by using different colours, the predicted deviations for the cross section at $\sqrt{s}$= 370, 500, 1000 GeV in the 4DCHM compared with the SM as functions of $m_\rho=f g_\rho$, the typical mass of the $Z'$s up to EW corrections, and $\xi=v^2/f^2$, the compositeness parameter. For each point we have selected the configuration yielding the maximal deviation defined as $\Delta= (\sigma^{\rm 4DCHM}- \sigma^{\rm SM})/\sigma^{\rm SM}$. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. ![*Predicted deviations for the cross section of the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM as functions of $m_\rho=f g_\rho$ and $\xi=v^2/f^2$. For each point we have selected the configuration yielding the maximal deviation defined as $\Delta= (\sigma^{\rm 4DCHM}- \sigma^{\rm SM})/\sigma^{\rm SM}$. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. Bounds on the masses of the extra fermions are the same as in Fig. \[tLR\].*[]{data-label="colour_xi"}](XS_mrho_xi_370.pdf "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section of the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM as functions of $m_\rho=f g_\rho$ and $\xi=v^2/f^2$. For each point we have selected the configuration yielding the maximal deviation defined as $\Delta= (\sigma^{\rm 4DCHM}- \sigma^{\rm SM})/\sigma^{\rm SM}$. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. Bounds on the masses of the extra fermions are the same as in Fig. \[tLR\].*[]{data-label="colour_xi"}](XS_mrho_xi_500.pdf "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section of the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM as functions of $m_\rho=f g_\rho$ and $\xi=v^2/f^2$. For each point we have selected the configuration yielding the maximal deviation defined as $\Delta= (\sigma^{\rm 4DCHM}- \sigma^{\rm SM})/\sigma^{\rm SM}$. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. Bounds on the masses of the extra fermions are the same as in Fig. \[tLR\].*[]{data-label="colour_xi"}](XS_mrho_xi_1000.pdf "fig:"){width="33.00000%"}\ We see that, by requiring a deviation larger than 2% to be detected, a 500 GeV machine is sensitive to new spin-1 resonances with mass up to 3.5 TeV. Of course there could be a configuration of fermion parameters such that the width of the $Z'$ is sufficiently large to give a smaller deviation. In this respect the ones in Fig. \[colour\_xi\] must be interpreted as the maximal sensitivities for each given CM energy. However, by combining different observables, the reach in mass would improve no matter the actual width. Concerning the spin asymmetries, $A_L$ deserves particular attention. In fact, while the double spin asymmetry $A_{LL}$ shows the same behaviour as $A_{FB}$ albeit with smaller deviations (see Fig. \[xs\_ALL\] (top)), the single spin asymmetry $A_L$ is sensitive to the relative sign of the left- and right-handed couplings of the $Z$ and $Z'$s to the top pair. It is unique in offering the chance to separate $Z'_2$ and $Z'_3$ as the two 4DCHM objects contributing to this asymmetry in opposite directions. In Fig. \[xs\_ALL\] (bottom) the expected affects are shown. Notice that, for $\sqrt{s}=1000$ GeV, where the interferences of $Z'_2$ and $Z'_3$ with $\gamma,Z$ are largest, the two contributions to $A_L$ appear visible in opposite directions and the deviations can reach 50%. ![*Predicted deviations for the cross section versus $A_{LL}$ (top) and $A_{L}$ (bottom) for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_ALL"}](Rxs_RALL_370.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{LL}$ (top) and $A_{L}$ (bottom) for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_ALL"}](Rxs_RALL_500.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{LL}$ (top) and $A_{L}$ (bottom) for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_ALL"}](Rxs_RALL_1000.png "fig:"){width="33.00000%"}\ ![*Predicted deviations for the cross section versus $A_{LL}$ (top) and $A_{L}$ (bottom) for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_ALL"}](Rxs_RAL_370.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{LL}$ (top) and $A_{L}$ (bottom) for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_ALL"}](fig5.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{LL}$ (top) and $A_{L}$ (bottom) for the process $e^+e^-\to t\bar t$ at 370, 500, 1000 GeV in the 4DCHM compared with the SM. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_ALL"}](Rxs_RAL_1000.png "fig:"){width="33.00000%"} This effect is emphasised if electron and positron beam polarisations are available. In fact, the $Z'_2$ and $Z'_3$ interferences have opposite sign. For a possible beam configuration in presence of polarisation, we use the following definition, according to [@MoortgatPick:2005cw]: $$\sigma_{P,P'}=\frac 1 4[(1- P P')(\sigma_{-,+}+\sigma_{+,-}+(P-P ')(\sigma_{+,-}-\sigma_{-,+})]$$ with $\sigma_{-,+(+,-)}=\sigma(e^-_L,e^+_R)(\sigma(e^-_R,e^+_L))$ and $P(P')$ the polarisation degree for electrons(positrons). Similar expressions hold for the asymmetries. In Fig. \[xs\_AL\_pol\] the correlated deviations for $\sigma$ and $A_L$ at $\sqrt{s}$=500 GeV for $P'(e^+)=+0.3$ and $P(e^-)=-0.8$ (left), $P'(e^+)=-0.3$ and $P(e^-)=+0.8$ (center) and for unpolarised beams (right) are shown. Corrections to the cross section are slightly larger in the case of polarised beams when negative whereas they are similar when positive. Somewhat unintuitively, for the case of the asymmetry, they are largest for the unpolarised case when negative whereas they are comparable when positive. This can be understood by recalling that an initial state polarisation does not automatically select one in the final state, as all helicity combinations in the latter are always possible whichever is enforced in the former. Furthermore, for the asymmetry, one should be reminded of the fact that this observable is normalised to the total cross section. Therefore, it is apparent that the potential benefits of the corrections seen in Fig. 2, wherein 4DCHM effects are largest on the chiral coefficient of the top quark which is smallest, combined with the fact that $s$-channel exchange of $Z'$s becomes dominant with increasing energy, does not translate into a preferred beam configuration to be adopted in order to highlight the 4DCHM effects. Results are shown here for 500 GeV, but the pattern remains similar ar both lower and higher CM energies. However, as we shall see in the next Section, beam polarisation plays a key role in disentangling the presence of two competing effects, due to the $Z'_2$ and $Z'_3$ states, which largely cancel in the unpolarised case. ![*Predicted deviations for the cross section versus $A_{L}$ for the process $e^+e^-\to t\bar t$ at 500 GeV in the 4DCHM compared with the SM for $P'(e^+)=+0.3$ and $P(e^-)=-0.8$ (left), $P'(e^+)=-0.3$ and $P(e^-)=+0.8$ (center) and for unpolarised beams (right). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AL_pol"}](Rxs_RAL_500_-08.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{L}$ for the process $e^+e^-\to t\bar t$ at 500 GeV in the 4DCHM compared with the SM for $P'(e^+)=+0.3$ and $P(e^-)=-0.8$ (left), $P'(e^+)=-0.3$ and $P(e^-)=+0.8$ (center) and for unpolarised beams (right). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AL_pol"}](fig6_center.png "fig:"){width="33.00000%"} ![*Predicted deviations for the cross section versus $A_{L}$ for the process $e^+e^-\to t\bar t$ at 500 GeV in the 4DCHM compared with the SM for $P'(e^+)=+0.3$ and $P(e^-)=-0.8$ (left), $P'(e^+)=-0.3$ and $P(e^-)=+0.8$ (center) and for unpolarised beams (right). The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is the same of Fig. \[tLR\].* []{data-label="xs_AL_pol"}](Rxs_RAL_500_unp.png "fig:"){width="33.00000%"} \[top-selection\] Disentangling the 4DCHM effects ================================================= It is interesting to disentangle the various effects onsetting the 4DCHM deviations. In Fig. \[split\] we plot the various contributions to the $\sigma$ and to $A_L$ for a particular benchmark point with $M_{Z'_{2,3,5}}= 3087, 3143, 4252$ GeV and $\Gamma_{Z'_{2,3,5}}= 53, 85, 90$ GeV, as function of $\sqrt{s}$ (now up to CLIC energies, to emphasise the presence of the poles due to the relevant $Z'$ states in $s$-channel). We call $|{\rm SM}|^2$($|{\rm 4DCHM}|^2$) the full SM(4DCHM) results, while we split the NP contributions as follows: 1. $|{\rm SM}'|^2$ is due to the square of the $\gamma,Z$ diagrams of the SM with the couplings rescaled; 2. $|Z'_2|^2$ is due to the square of the $Z'_2$ diagram; 3. $|Z'_3|^2$ is due to the square of the $Z'_3$ diagram; 4. $|Z'_5|^2$ is due to the square of the $Z'_5$ diagram; 5. Int(SM,$Z'_2$) is due to the interference between the diagrams in 1 and 2; 6. Int(SM,$Z'_3$) is due to the interference between the diagrams in 1 and 3; 7. Int(SM,$Z'_5$) is due to the interference between the diagrams in 1 and 4; 8. Int($Z'_2,Z'_3$) is due to the interference between the diagrams in 2 and 3; 9. Int($Z'_2,Z'_5$) is due to the interference between the diagrams in 2 and 4; 10. Int($Z'_3,Z'_5$) is due to the interference between the diagrams in 3 and 4. (Notice that 1 to 10 sum to $|{\rm 4DCHM}|^2$.) It is quite evident the importance of the interference between $Z'_{2,3}$ and the SM gauge bosons, as they are always amongst the largest contributors to the total 4DCHM cross section (left plot of Fig. \[split\]), only second to the rescaled SM contribution (at low CM energy) or the contributions due to the $Z'_{2,3}$ resonances (at high CM energy). What is most remarkable (right plot of Fig. \[split\]) is that these two contributions tend to cancel in the single spin asymmetry, a reflection of the opposite signs and similar strength that the $Z'_{2,3}tt$ vertices have in the two different chiral coefficients. ![*Contributions to the unpolarised cross section $\sigma$ and single spin asymmetry $A_L$ as functions of $\sqrt{s}$ for the SM and a 4DCHM benchmark point corresponding to $M_{Z'_{2,3,5}}= 3087, 3143, 4252$ GeV and $\Gamma_{Z'_{2,3,5}}= 53, 85, 90$ GeV.* []{data-label="split"}](split1_xs_unpol.pdf "fig:"){width="50.00000%"} ![*Contributions to the unpolarised cross section $\sigma$ and single spin asymmetry $A_L$ as functions of $\sqrt{s}$ for the SM and a 4DCHM benchmark point corresponding to $M_{Z'_{2,3,5}}= 3087, 3143, 4252$ GeV and $\Gamma_{Z'_{2,3,5}}= 53, 85, 90$ GeV.* []{data-label="split"}](split1_AL_unpol.pdf "fig:"){width="50.00000%"} To render this manifest, for the same benchmark point, we have studied the effects of initial beam polarisation. In Fig. \[splitpol\] the two extreme cases $P=1$, $P'=-1$ and $P=-1$, $P'=1$ are considered. While these will not be achieved experimentally, they are useful in order to single out the 4DCHM effects. After all, the various components of the matrix element plotted in Figs. \[split\]–\[splitpol\] (except $|{\rm SM}|^2$ and $|{\rm 4DCHM}|^2$) have no meaning per se, as they cannot be separated experimentally either. Anyhow, the two plots in the figure make evident the aforementioned features of the $Z'_{2,3}tt$ vertices, as either polarisation preferentially selects one or the other of the $Z'_2$ and $Z'_3$ contributions in $A_L$, more so in the case of the 4DCHM interferences with the SM that the 4DCHM contributions alone. ![*Contributions to the polarised cross section $\sigma$ and single spin asymmetry $A_L$ as functions of $\sqrt{s}$ for the SM and a 4DCHM benchmark point corresponding to $M_{Z'_{2,3,5}}= 3087, 3143, 4252$ GeV and $\Gamma_{Z'_{2,3,5}}= 53, 85, 90$ GeV. Here $ P=1$, $P'=-1$ (top) and $P=-1$, $P'=1$ (bottom).* []{data-label="splitpol"}](split1_xs_mp.pdf "fig:"){width="45.00000%"} ![*Contributions to the polarised cross section $\sigma$ and single spin asymmetry $A_L$ as functions of $\sqrt{s}$ for the SM and a 4DCHM benchmark point corresponding to $M_{Z'_{2,3,5}}= 3087, 3143, 4252$ GeV and $\Gamma_{Z'_{2,3,5}}= 53, 85, 90$ GeV. Here $ P=1$, $P'=-1$ (top) and $P=-1$, $P'=1$ (bottom).* []{data-label="splitpol"}](split1_AL_mp.pdf "fig:"){width="45.00000%"}\ ![*Contributions to the polarised cross section $\sigma$ and single spin asymmetry $A_L$ as functions of $\sqrt{s}$ for the SM and a 4DCHM benchmark point corresponding to $M_{Z'_{2,3,5}}= 3087, 3143, 4252$ GeV and $\Gamma_{Z'_{2,3,5}}= 53, 85, 90$ GeV. Here $ P=1$, $P'=-1$ (top) and $P=-1$, $P'=1$ (bottom).* []{data-label="splitpol"}](split1_xs_pm.pdf "fig:"){width="45.00000%"} ![*Contributions to the polarised cross section $\sigma$ and single spin asymmetry $A_L$ as functions of $\sqrt{s}$ for the SM and a 4DCHM benchmark point corresponding to $M_{Z'_{2,3,5}}= 3087, 3143, 4252$ GeV and $\Gamma_{Z'_{2,3,5}}= 53, 85, 90$ GeV. Here $ P=1$, $P'=-1$ (top) and $P=-1$, $P'=1$ (bottom).* []{data-label="splitpol"}](split1_AL_pm.pdf "fig:"){width="45.00000%"}\ In order to further understand the dependence of the deviations induced by 4DCHM effects onto the SM upon the contribution of $Z'$ mediation, we plot in Fig. \[xs\_GammaZ3\_500\] the ratios of the cross section in the two models at $\sqrt{s}=500$ GeV as function of the $Z'_3$ width. We use different colours for the contributions coming from different $Z'$ masses. It is clear that even for masses $M_{Z'}>5 \sqrt{s}$ we get $\sim$ 5% deviations in the cross section coming from the interference while the square of the $Z'_3$ contribution is only sizable at small masses. Finally, the effects are modulated somewhat by the $t^\prime$ mass, as this governs to some extent the actual size of the $Z'_3$ width. (The plot for the $Z'_2$ case is rather similar, so we refrained from presenting it here.) ![ *Predicted deviations for the cross section of the process $e^+e^-\to t\bar t$ at 500 GeV in the 4DCHM with respect to the SM as function of the $Z'_3$ width. The points correspond to $f=0.75-1.5$ TeV, $g_\rho=1.5-3$. The colour code is as follows. Red: all points; green: bounds on extra fermions as in Fig. \[tLR\]; black, cyan and purple are as green with an additional bound on $M_{Z'}>$ 2, 2.5 and 3 TeV, respectively.*[]{data-label="xs_GammaZ3_500"}](RXS_multiple_bound_500.png){width="45.00000%"} \[conclude\] Conclusions ======================== To summarise, we have exploited a calculable version of a CHM, the so-called 4DCHM, which allows one to generate the full spectrum of masses and couplings of all the NP particles present in it alongside relevant mixing with the SM states, in order to test the sensitivity of future $e^+e^-$ colliders to deviations in the cross section and (charge and spin) asymmetries of $t\bar t$ production from the SM values. Such a NP scenario, unlike more rudimentary implementations of CHMs, accounts for both the rescaling of the $Ztt$ coupling and the presence of the $Z'tt$ ones (specifically of three such states although only two play a phenomenologically significant role), which enter the physical observables via interferences with the SM as well as like resonances (albeit through their tails, as we have assumed $\sqrt s<M_{Z'}$, whatever the $Z'$ state). Effects are sizable in several such observables, both at exclusive and inclusive level, irrespectively of the CM energy of the collider, though they typically grow with the latter owing to the presence of such additional neutral gauge bosons in the $s$-channel propagators, to the extent that they are in general larger than the deviations induced by the rescaling of the $Ztt$ coupling. Therefore, altogether, such phenomena should be accessible at any realisation of a future $e^+e^-$ collider currently considered, with or without polarisation of the beams. In fact, such a feature is not a key to their extraction, rather it would serve the purpose of disentangling the various 4DCHM components in action. Contrast this with the fact that the 4DCHM would in general (i.e., over most of its parameter space) escape the scope of the LHC, both at standard and high luminosity, as neither the additional gauge bosons nor the additional fermions present in such a CHM may be accessible at the CERN machine, either directly (i.e., as visible objects) or indirectly (i.e., through effects onto SM observables). Further, under these circumstances, wherein a detection of new $Z'$s from a CHM cannot either be established with enough significance at the LHC or else the CERN machine cannot resolve nearby resonances (as typically predicted by theories like the one considered here, of pNGBs emerging from a $SO(5)\to SO(4)$ breaking), future leptonic colliders also afford one with the ability to combine the aforementioned (charge and spin) asymmetries together with the total cross section for the process $e^+e^-\to t \bar t$, thereby enabling one to increase significances, to the extent of possibly claiming an indirect discovery of a CHM structure of EWSB, even for $Z'$ masses well beyond the kinematic reach of the leptonic accelerator. In short, realistic CHMs, wherein the additional spin-1 and spin-1/2 states are not integrated out as customarily done in more simplistic realisations, are prime candidates for experimental scrutiny even beyond the LHC era, should this fail to reveal such new objects. We have based our conclusions on a numerical study performed with on-shell top (anti)quarks, so they should eventually be validated by a proper analysis which accounts for their decay as well as parton shower and hadronisation in presence of detector effects. However, we are confident that, thanks to the cleanliness of a leptonic collider and its consequent efficiency in reconstructing the (anti)top quarks, the most salient features of our results will be preserved. To eventually enable such more sophisticated studies, a full implementation of the 4DCHM is available on the HEPMDB. Acknowledgements {#acknowledgements .unnumbered} ================ SM is financially supported in part by the NExT Institute and further acknowledges funding from the Japan Society for the Promotion of Science (JSPS) while part of this research was carried out in the form of a Short Term Fellowship for Research in Japan (Grant Number S14026). He is also grateful to the Theoretical Physics Group at the Department of Physics of the University of Toyama for their kind hospitality during the tenure of the JSPS award. The work of GMP has been supported by the Swiss National Science Foundation (SNF) under contract 200021-160156. The authors are grateful to Patrick Janot and Francois Richard for helpful comments and suggestions, and to the hospitality of the Galileo Galilei Institute in Florence, where part of this work has been carried out during the workshop “Prospects and Precision at the LHC at 14 TeV”. The coordinates for the FCC-ee contour appeared in Figure \[grojean\] were provided by Patrick Janot via private communication, to which the authors are especially grateful. [^1]: The sensitivity to variations of the $Zt t$ coupling through one-loop EW effects entering both $gg$ and $q\bar q\to t\bar t$ in the full 4DCHM was found to be negligible by a 4DCHM remake of the calculation of Refs. [@Moretti:2006nf; @Moretti:2012mq]. [^2]: The most general Lorentz-invariant vertex function describing the interaction of a neutral vector boson $X$ with two top quarks can be written in terms of ten form factors which reduce to four when both top quarks are on-shell (hence, this is true for $t\bar t$ but not for $t\bar t X$ production). [^3]: [For example, in our qualitative exercise we have paid little or no attention to the use of appropriate correlation matrices in the two cases.]{} [^4]: Moreover, at any $e^+ e^-$ collider, all top EW couplings, including $Wtb$, will be measured allowing for a full separation between axial and vector couplings and between the $Ztt$ and $\gamma tt$ components. [^5]: While a complete calculation of the EW oblique observables is beyond the scope of this work, these choices of $f$ and $m_{X,T,B}$ have been made following the guidance of [@Grojean:2013qca], and can be considered as a safe estimation, in order to satisfy EWPTs.

Boston Ujima Project Taking its name from the Swahili Kwanzaa principle for “collective work and responsibility,” the Boston Ujima Project is working to organize Greater Boston area neighbors, workers, business owners, and investors to create a community-controlled economy. Specific strategies it seeks to employ include the creation of a “Good Business and Real Estate” certification, a community controlled investment fund, a worker empowerment network, and an alternative local currency. In the summer of 2016, the group held its first Ujima Solidarity Summit, at which over 175 people pooled over $20,000 to invest in five black and immigrant-owned local businesses.

<?php namespace Medusa\Tree; abstract class PersistentBalancedTreeTest extends \PHPUnit_Framework_TestCase { abstract protected function createEmpty(); /** * @test */ public function shouldAddKeyWithValue() { $t = $this->createEmpty()->add(1, 'value'); $this->assertEquals('value', $t->lookup(1)); } /** * @test */ public function shouldRemoveKey() { $t = $this->createEmpty()->add(1, 'value')->remove(1); $this->assertFalse($t->contains(1)); } /** * @test * @expectedException \RuntimeException * @expectedExceptionMessage not found */ public function lookupOnNonExistingKeyShouldThrowException() { $this->createEmpty()->lookup(1); } /** * @test */ public function shouldReplaceKey() { $t = $this->createEmpty() ->add(1, 'first') ->add(1, 'last'); $this->assertEquals('last', $t->lookup(1)); } /** * @test */ public function addShouldNotModifyPreviousVersions() { $t1 = $this->createEmpty()->add(1, 'first'); $t1->add(1, 'last'); $this->assertEquals('first', $t1->lookup(1)); } /** * @test */ public function removeShouldNotModifyPreviousVersions() { $t = $this->createEmpty()->add(1, 'first'); $t->remove(1); $this->assertTrue($t->contains(1)); } /** * @test */ public function shouldBeBalanced() { for ($i = 0; $i < 10; $i++) { $numItems = mt_rand(0, 500); $t = $this->createFromArray(range(1, $numItems)); $this->assertHeightIsLogarithmic($numItems, $t->height()); } } private function assertHeightIsLogarithmic($numItems, $height) { $expected = ceil(log($numItems + 1, 2)); $this->assertLessThanOrEqual($expected, $height); } protected function createFromArray(array $values) { $t = $this->createEmpty(); foreach ($values as $value) { $t = $t->add($value, $value); } return $t; } /** * @test */ public function shouldContainValues() { $t = $this->createEmpty() ->add(1, 'one') ->add(2, 'two') ->add(3, 'three'); $this->assertContainValues([1 => 'one', 2 => 'two', 3 => 'three'], $t); } private function assertContainValues($expected, $tree) { $values = []; foreach ($tree as $key => $value) { $values[$key] = $value; } $this->assertEquals($expected, $values); } }

package starter import ( "bufio" "errors" "os" "path/filepath" "strings" ) var errNoEnv = errors.New("no ENVDIR specified, or ENVDIR does not exist") func reloadEnv() (map[string]string, error) { dn := os.Getenv("ENVDIR") if dn == "" { return nil, errNoEnv } fi, err := os.Stat(dn) if err != nil { return nil, err } if !fi.IsDir() { return nil, err } var m map[string]string filepath.Walk(dn, func(path string, fi os.FileInfo, err error) error { // Ignore errors if err != nil { return nil } // Don't go into directories if fi.IsDir() && dn != path { return filepath.SkipDir } f, err := os.Open(path) if err != nil { return nil } defer f.Close() envName := filepath.Base(path) scanner := bufio.NewScanner(f) if scanner.Scan() { if m == nil { m = make(map[string]string) } l := scanner.Text() m[envName] = strings.TrimSpace(l) } return nil }) if m == nil { return nil, errNoEnv } return m, nil }

Alterations in cell-wall glycosyl linkage structure of Arabidopsis murus mutants. Methylation (glycosyl-linkage) analyses of the cell walls from Arabidopsis (Arabidopsis thaliana L., Heynh.) murus mutants revealed variations in the linkage structure compared to wild type. Linkage analyses revealed new features for mutations whose defective gene has not been identified. For example, the low-rhamnose mur8 mutant also shows deficiencies in 4-GalA linkages. No change in the 2-Rha to 2,4-Rha ratio indicates the mutant had lower amounts of rhamnogalacturonan I, but no alteration in its fine structure. For all mur mutants, methylation analysis revealed that changes in other polysaccharides occur indirectly as a result of mutation. All mutants were resolved by Principal Components Analyses applied to normalized mole% values for the total set of linkage groups. The 'loadings' responsible for discrimination of mutant and wild type revealed variation in linkage groups otherwise difficult to discern and, in certain instances when the gene is known, resolved the specific deficiency from indirect effects altering other sugar linkage distributions.

Pipeline Hydro-testing The objective of hydrostatic testing of a pipeline is to find the possible flaws in the constructed pipeline. The test develops certain amount of stress for a given time to allow these possible flaws to open out as leakages. B.G.Technical Limited in collaboration with data from our client is able to determine the maximum text pressure for a given pipeline. In other words, test pressure are designed by our engineers to provide a sufficient gap between itself and the operating pressure. By carrying out this operation, the pipeline integrity can be determined and verified. These includes; Existing flaw in the pipeline material Stress corrosion cracking(SCC) and actual mechanical properties of the pipe Active corrosion cell, and Localized hard spots that may cause failure in the presence of hydrogen in pipelines. B.G.Technical Limited has certified equipment, well trained and certified personnel that have designed and executed hydro-testing operations for various pipeline. Our mission is to implement creative solution and demonstrate a passion to exceed customer goal and satisfaction, improve quality and reduce cost at minimum safety risk.

Integrated circuits and other electronic components can be assembled in a semiconductor package. The semiconductor package may be integrated into an electronic system, such as a consumer electronic device. Such a system can consume power and, thus, it can be subject to electric noise and/or other interference issues. A common solution includes the assembly of decoupling capacitors that can permit a degree of electrical noise and/or interference isolation between a board substrate (such as a motherboard) and an integrated circuit (e.g., a CPU) in the semiconductor package. Although several options are available for decoupling capacitors (e.g., die side capacitors, land side capacitors, board edge capacitors, and board backside capacitors), package design and/or cost considerations can render some of those options non-viable. Therefore, much remains to be improved in the design of the arrangement of decoupling capacitors and real estate utilization in semiconductor product assemblies including semiconductor packages and/or substrates that support a semiconductor package.

Q: Access VBA nested for loop only works in first record I have an Access 2010 database, where one of the tables has a list of Beneficiaries, and Intermediaries. For QC, I need to calculate the ownership of all Beneficiaries, and omit the ownership of entities that act as links between the bottom Beneficiaries and top Intermediaries. So I have a table with 4 columns of intermediaries. I want the following steps to occur: start with column "IMY_Up1", select the first intermediary ID number look through the second "IMY_Up2" column to see if that ID exists there. If it does - edit the "Linked IMY" column to "Yes", if it does not exist in that column - edit the "Linked IMY" column to "No". Issue I'm facing: Current Code - Loops through accurately (Locals window shows 'i' and 'j' step through as expected). But only the first row has it's "Linked_IMy" value updated to "No". Attempted Fix: put in 'Do While' loops. But this causes loop to continue to run, and no 'i' or 'j' value is reached in the Locals window. My ultimate question: How can I change my code so it steps through and works as desired? Do I need to re-design the whole thing, and if so, how should I start? Here is the VBA code: Option Compare Database Option Explicit Public Sub modFieldlengthRegulate() Dim i As Integer 'set "i" as integer for IMY_Up1 loop Dim j As Integer 'set "j" as integer for IMY_Up2 loop Dim db As DAO.Database 'imy database Dim rs As DAO.Recordset 'QC_LoopTestTable as recordset Set db = CurrentDb 'imy database Set rs = db.OpenRecordset("QC_LoopTestTable") 'QC_LoopTestTable as recordset For i = 0 To rs.RecordCount - 1 'set up for IMY_Up1 loop rs.MoveFirst 'always start at first row 'Do While Not rs.EOF 'Set rs.Fields("IMY_Up1").Value = refSelect 'wanted to see what value it was assigning, but causes errors, so comment out For j = 0 To rs.RecordCount - 1 'set up for IMY_Up2 loop rs.MoveFirst 'Do While Not rs.EOF 'Set rs.Fields("IMY_Up2").Value = compareSelect 'wanted to see what value it was assigning, but causes errors, so comment out If (rs.Fields("IMY_Up2").Value = rs.Fields("IMY_Up1").Value) Then rs.Edit rs.Fields("Linked_IMY") = "Yes" rs.Update Else: rs.Edit rs.Fields("Linked_IMY") = "No" rs.Update End If 'Loop Next j 'Loop Next i rs.Close 'close the recordset as part of the last step Set rs = Nothing 'close the recordset as part of the last step db.Close 'close the database as part of the last step End Sub A: Use the Power of SQL A simple SELECT QC_LoopTestTable.ID ,QC_LoopTestTable.IMY_Up1 ,QC_LoopTestTable.IMY_Up2 ,IIf(IsNull([QC_LoopTestTable_1].[id]), "No", "Yes") AS Linked_IMY FROM QC_LoopTestTable LEFT JOIN QC_LoopTestTable AS QC_LoopTestTable_1 ON QC_LoopTestTable.IMY_Up2 = QC_LoopTestTable_1.IMY_Up1; does the same much cleaner and faster (if IMY_Up1 and IMY_Up2 are indexed). This fetchesQC_LoopTestTableand joins with itself (QC_LoopTestTable AS QC_LoopTestTable_1) where Up2 = Up1. If there is no match the result for the copied table (QC_LoopTestTable_1) isNULLwhat can be tested (Iif-Statement) and the corresponding value is (Yes/No) is used. If you want to store the result ofLinked_IMY you can use a similarUPDATEquery, but this is not recommendet (usually don't store computed values), because if you edit a record, it needs to be updated again. IfIMY_Up2matches multipleIMY_Up1those values will be double but can be filterd if necessary Why your code fails Your code is updating only first row, because you don't tell the recordset to move to the next record. Then you would need two independent recordsets to loop one in the other (Inner loop with rs.MoveFirst would set outer loop rs to first row too (same variablers)) After you found a match, the inner loop needs to exit (Exit Do) or the next row will cause the revert as it will end in Elsepart writes toLinked_IMY. AvoidIntegervariables as they fail above 2^15-1, useLonginstead. UseDo Until rs.eof ... Loopto loop through recordsets. Code could be like (just for demonstration, don't use): Dim db As DAO.Database Dim rs1 As DAO.Recordset Dim rs2 As DAO.Recordset Set db = CurrentDb Set rs1 = db.OpenRecordset("QC_LoopTestTable") Set rs2 = db.OpenRecordset("QC_LoopTestTable") Do Until rs1.eof Do Until rs2.eof If rs1.Fields("IMY_Up2").Value = rs2.Fields("IMY_Up1").Value Then ... End If rs2.MoveNext Loop rs1.MoveNext rs2.MoveFirst Loop

application Every Network Administrator or Security Administrator should have a few basic tools installed and ready to go at a moments notice. Advanced IP scanner is a reliable and freenetwork scanner. It offers complete analysis of your entire LAN, showing live IP addresses and giving you the ability to remotely control systems with RDP and Radmin. It’s installable or fully portable, so you can keep it in your Dropbox or NextCloud folder for convenient access.

--- abstract: 'We report on a simple and robust technique to generate a dispersive signal which serves as an error signal to electronically stabilize a monomode cw laser emitting around an atomic resonance. We explore nonlinear effects in the laser beam propagation through a resonant vapor by way of spatial filtering. The performance of this technique is validated by locking semiconductor lasers to the cesium and rubidium $D_2$ line and observing long-term reduction of the emission frequency drifts, making the laser well adapted for many atomic physics applications.' author: - 'Fabiano Queiroga, Weliton Soares Martins, Valdeci Mestre, Itamar Vidal, Thierry Passerat de Silans, Marcos Oriá, and Martine Chevrollier' title: | Laser stabilization to an atomic transition\ using an optically generated dispersive lineshape --- Introduction ============ The use of lasers in atomic physics often demands long term stability of the central frequency of the light emission. For metrological applications the stabilization technique [@Hall1999; @Salomon1988] should be very carefully chosen and applied, frequently controlling the laser linewidth and avoiding to introduce any artificial shift in the laser emission frequency. Moreover, locking to the center of an atomic or molecular transition usually requires modulation techniques and lock-in detection. On the other hand, for many scientific and technical applications one only needs to avoid frequency drifts and, sometimes, the desired laser frequency does not lay at the maximum of an atomic lineshape, but rather at a displaced frequency, as for instance, when operating an optical cooler [@Lett1989]. For such applications a few simple and reliable techniques were developed [@Cheron1994; @Corwin1998; @Pearman2002; @Debs2008; @Robins2002; @Gazazyan2007; @Martins2010] and allow on e to deal with lasers in various long run experiments. The main idea behind many of these techniques is to generate a dispersive lineshape that will produce an error signal. In particular, for the dichroic atomic vapor laser lock (DAVLL) [@Cheron1994] and its variants [@Corwin1998; @Martins2010], the stabilization frequency may easily be chosen around the center of the Doppler-broadened line. However, a relatively uniform external magnetic field is needed to generate the Zeeman split of the probed hyperfine transition and a double detection with well balanced photodetectors is also necessary.\ In this work we report on a simple method to generate a dispersive signal in a very direct way, and therefore of easy implementation. Our technique explores the dispersive signal obtained when a Gaussian-profile light beam is sent through an atomic vapor cell and is detected after spatial filtering by an aperture (Fig. \[setup\]). We call this method ANGELLS, an acronym for Atomic Non-linearly GEnerated Laser Locking Signal.\ ![(Color online) (a) Experimental setup. Part of the laser beam is used to generate a dispersive like curve that is fed to an electronic circuit used to control the laser frequency. DL, Diode laser. OI, Optical isolator. BS, Beam splitter. (b) Detail of the beam configuration for ANGELLS[]{data-label="setup"}](Figure1.eps){width="7.5cm"} Origin of the dispersive lineshape ================================== The third order susceptibility term of an induced atomic vapor polarization by a laser beam results on a non-linear refractive index term, proportional to the laser intensity. The total refractive index of the vapor can thus be written as $n(I)=n_0+n_2I$ and the radial intensity gradient of a Gaussian-profile beam will induce a radial refractive index gradient in the medium. This index gradient will in turn act as a lens for the gaussian beam, which will therefore suffer (self)-focusing or (self)-defocusing, depending on the sign of the nonlinear refractive index [@selffocus]. The nonlinear index changes sign across a sharp resonance of the nonlinear medium. If on one side of the resonance frequency the index increment is positive (maximum on the beam axis), the medium behaves as a converging lens and the power of a initially collimated beam transmitted through an aperture will increase (peak of the dispersive lineshape). On the other side of the resonance frequency the laser-induced increment is negative (minimum on the axis), the medium behaves as a divergent lens and the transmission through an aperture yields a correspondingly diminished signal (valley of the dispersive lineshape). In other words, the nonlinear medium acts as a lens which focal length depends on the laser frequency. For a hot atomic vapor, for instance, the non-linear refractive index can be written as [@n2]: $$n_2\propto\delta e^{-\delta^2/\delta_D^2},$$ where $\delta_D=\frac{k}{2\pi}\sqrt{2k_BT/M}$ is the Doppler width, $T$ is the vapor temperature, $k_B$ is the Boltzmann constant, $k$ is the light wavenumber, $M$ is the atomic mass and $\delta$ is the laser frequency detuning relative to the atomic transition. For red detuning frequencies ($\delta<0$), $n_2$ is negative while for blue detuning ($\delta>0$), $n_2$ is positive. The power transmitted through the aperture is thus modulated when the frequency is scanned around [*an atomic transition*]{}, resulting in a dispersive-like lineshape with [*Doppler width*]{}.\ Experiment ========== In our technique, the nonlinear medium is a resonant atomic vapor, placed in the laser beam path past a converging lens to enhance nonlinear effects with higher light intensity radial gradients. Our experimental setup is sketched in Fig. \[setup\]. A 852 nm cw tunable semiconductor laser beam is splitted by a 90/10 beam splitter. The lower-intensity beam ($\sim50 \mu W$), of approximately Gaussian spatial profile (no spatial filter needed) and of slightly saturating intensity, is focused by a 150 mm-focal-length lens. A warm (40 to $\approx$ 60$^\circ$C, corresponding to densities of $2\times10^{11} at/cm^3$ - $10^{12} at/cm^3$) atomic cesium vapor [@cesium] contained in a 1-mm-long optical cell [@cell] is placed close ($\approx$ 20 mm) to the focus of the laser beam. We detect the transmission of the laser beam through an aperture adjusted so as to capture $\sim20\%$ of the beam power (typically 2-mm aperture for a beam of diameter 6 mm). When the frequency is scanned around the Cs $6 S_{1/2}, F=4 \longrightarrow 6 P_{3/2},F'=3,4,5$ Doppler transition, the nonlinear refraction turns from self-focusing to self-defocusing. This gives rise to a dispersive-like lineshape superimposed to a non-zero offset corresponding to the out-of-resonance aperture transmission (no vapor-induced modifications). Very small structures on these spectra are attributed to non-linear effects due to the beam reflection on the cell windows. The comparable dimensions of the beam diameter and the cell thickness makes the prevention of this high-order interaction difficult. However, this does not pose any additional problem to lock the laser at any position in the broad range inside the Doppler width.\ The error signal is the subtraction of a reference voltage (corresponding to a frequency within the Doppler line) from the photodetector amplifier voltage. Such an error signal is amplified and sent to the control of the laser frequency to correct for laser frequency drifts. In semiconductor lasers, the frequency is changed mostly through the injection current, the junction temperature or, in the case of extended cavity configuration, the external diffraction grating angle. We worked with a DFB laser diode resonant with the Cs D$_2$ line and a Fabry-Pérot semiconductor laser with extended cavity, emitting around the Rb D$_2$ line. The electronic correction signal is fed back in the junction current in the DFB or in the piezoelectric actuator in the extended-cavity laser [@DF]. For the sake of simplicity, we have operated both systems with a home-made electronic circuit having only proportional and integral gains.\ ![Schematics of the circuit to choose and lock the laser to an atomic frequency.[]{data-label="circuit"}](Figure2.eps){width="7.5cm"} A scheme of the locking circuit is shown in Figure \[circuit\]. A voltage ramp generator allows one to scan the laser frequency (through current or cavity PZT modulation) around the atomic resonance. We choose a locking frequency with the help of a reference saturated absorption (SA) spectrum carried out in an extra vapor cell and exhibiting characteristic sub-Doppler features (see Fig. \[locked\]a). We use the SA signal obtained in this additional cell as frequency reference (Fig. \[locked\]a) as well as to monitor the locking performance (Fig. \[locked\]c). The locking procedure follows some basic steps: the ramp is turned off and the offset finely tuned until the laser frequency is at the desired locking point [**($\omega_L$)**]{}, marked by dots in Figs. \[locked\]a and \[locked\]b. The error signal is then brought to zero by adjusting the reference voltage (Fig. \[locked\]b) and a switch closes the loop, ultimately locking the laser at the desired frequency (Fig. \[locked\]c). Modifying the reference voltage allows one to lock the laser at any point within the Doppler width and thus to explore the different hyperfine transitions shown in the SA spectrum. Notice that the reference voltage brings the error signal around zero and so compensates for the non-resonant background signal.\ ![(Color online) (a) Cs saturated absorption (SA) spectrum from an extra reference cell (not shown in Fig. \[setup\]), (b) dispersion curve for the error signal as a function of frequency detuning relative to the atomic resonance, and (c) the ANGELLS-frequency-locked as well as an unlocked SA signal. The chosen frequency of stabilization ($\omega_L$) is marked by a red dot in spectra (a) and (b)[]{data-label="locked"}](Figure3.eps){width="8.0cm"} Results ======= Figure \[locked\]c exhibits the SA signal with the laser locked at the selected frequency, over a period of a few minutes, as well as the SA signal for an unlocked laser. The system remains locked for hours even after we have strongly and repeatedly hit our home-made optical table. The short-term rms frequency width is the same for the locked and the unlocked laser, i.e. of the order of 2 MHz or less, as measured using the saturated absorption line flank as a frequency discriminator. The long-term frequency fluctuations of the locked laser remains limited to less than 2 MHz rms, while the frequency of the laser unlocked for a few minutes fluctuates in excess of 20 MHz.\ ![(Color online) Error signal as a function of frequency detuning relative to atomic resonance (a) for different temperatures of the atomic vapor and (b) when the cell (Cs vapor) is placed a few millimeters before ($z<0$, dashed line) and after ($z>0$, solid line) the beam minimum waist.[]{data-label="dispersion"}](Figure4.eps){width="8.0cm"} We checked the stabilization sensitivity to vapor density and cell alignment along the beam. Although the vapor temperature has been varied between 45 and 63 $^\circ$C, the lineshape of the generated signal is stable against temperature changes as shown in Fig. \[dispersion\]a. The Doppler-profile center position changes very little ($\approx 2$MHz/$^\circ$C) over this 20 $^\circ$C temperature variation. Each lineshape in Fig. \[dispersion\]a has been recorded at a given temperature (values indicated in the figure frame), fluctuating less than 1 $^\circ$C from its reference value. Thus, the laser frequency locking, particularly at the Doppler center, is not affected by small temperatures fluctuations of the vapor which lead to frequency drifts of the order of magnitude or less than the rms frequency width, as evidenced in Fig.\[locked\]c. Even to lock the laser at frequencies other than at the line center, we have only monitored the cell temperatur e, without active control. More noticeable modifications appear on the profile wings, that do not play a role in the stabilization process inside the Doppler width. Similarly, the error signal remains approximately unchanged over $\approx$ 2-mm displacements along the beam, around the optimal position of the cell ($\approx$ 20 mm on either side from focal point). Another characteristic of using the ANGELLS technique is the possibility of choosing the sign of the error signal slope by purely optical means, as shown in Figure \[dispersion\]b. The dispersive curve gets inverted when the vapor is displaced *across the focal position* (see Fig.\[setup\]). We also emphasize here the fact that semiconductor lasers are well known to exhibit very stable amplitude [@AmpNoise], allowing us to disregard amplitude noise in the detected signal. For lasers with higher intensity fluctuations a second photodetector may be used to ’normalize’ the frequency error signal.\ Conclusion ========== In summary, we have presented an opto-electronic stabilization method based on the direct generation of an optical dispersive-like signal. The ANGELLS technique has proved to be an easy and robust locking method against diode laser frequency drifts. For similar performance, the set-up is simpler than traditional locking techniques, not requiring magnetic fields or beam modulation. The set-up is flexible: different combinations of laser power, beam diameter, focalization, cell length and vapor density have been used, the values given in the article corresponding to those used for the presented results. ACKNOWLEDGMENT: This work was partially funded by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, contract 472353/2009-8) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). F.Q., W.S.M., I.V. and M.C. acknowledge grants by CNPq. [99]{} See, for instance, J.L. Hall, L.-S. Ma, M. Taubman, B. Tiemann, F.-L. Hong, O. Pfister, J. Ye, IEEE Trans. on Instr. and Meas. **48**, 583 (1999) C. Salomon, D. Hils, J. Hall, J. Opt. Soc. Am. B **5**, 1576 (1988) The dispersive force in an optical molasses is maximized at a frequency red shifted half a linewidth from the cyclic cooling transition frequency. See, for instance, P.D. Lett, W.D. Phillips, S.L. Rolston, C.E. Tanner, R.N. Watts, C.I. Westbrook, J. Opt. Soc. Am. B **6**, 2084 (1989) B. Chéron, H. Gilles, J. Havel, O. Moreau, H. Sorel, J. Phys. III **4**, 401 (1994) K.L. Corwin, Z.-T. Lu, C.F. Hand, R.J. Epstein, C.E. Wieman, Appl. Opt. **37**, 3295 (1998) C.P. Pearman, C.S. Adams, S.G. Cox, P.F. Griffin, D.A. Smith, I.G. Hughes, J. Phys. B: At. Mol. Opt. Phys. **35**, 5141 (2002) J. E. Debs, N.P. Robins, A. Lance, M.B. Kruger, J.D. Close, Appl. Opt. **47**, 5163 (2008) N.P. Robins, B.J.J. Slagmolen, D.A. Shaddock, J.D. Close, M. B. Gray, Opt. Lett. **27**, 1905 (2002) E.A. Gazazyan, A.V. Papoyan, D. Sarkisyan, A. Weis, Laser Phys. Lett. **4**, 801 (2007) W. S. Martins, M. Grilo, M. Brasileiro, O. di Lorenzo, M. Oriá, M. Chevrollier, Appl. Opt. **49**, 871 (2010) See, e. g., T. Ackemann, T. Scholz, Ch. Vorgerd, J. Nalik, L.M. Hoffer, G.L. Lippi, Opt. Commun. **147**, 411 (1998) C.F. McCormick, D.R. Solli, R.Y. Chiao, J.M. Hickmann, Phys. Rev. A **69**, 023804 (2004) We have performed similar experiments of laser stabilization using an atomic Rb vapor to lock a 780 nm diode laser to different transitions of the two rubidium isotopes. The cell length was chosen to have a thickness small compared to the lens focal length. Stabilization was also observed with longer cells (10 mm and 20 mm), however thin cells help enhance dispersive effects over absorptive ones. Our home-made external cavity is tuned thanks to a low-voltage piezoelectric actuator (displacement of about 6$\mu$m/volt). K. Peterman, *Laser diode modulation and noise* (Kluwer Ac., Dordrecht,1991)

The first F1 race around the beautiful Mugello track, the Tuscan Grand Prix, was very different from pre-race expectations. Not in its outcome – Lewis Hamilton headed a Mercedes 1-2…

*Müller MA, Meyer B, Corman VM, et al. Presence of Middle East respiratory syndrome coronavirus antibodies in Saudi Arabia: a nationwide, cross-sectional, serological study. Lancet Infect Dis 2015; **15:** 559--64*---In this Article, the affiliation for the authors Malak Al-Masri, Raafat F Alhakeem, Abdullah M Assiri, and Ziad A Memish should have been "Ministry of Health, Riyadh, Saudi Arabia". Additionally, the affiliation for Abdulhafeez Turkestani should have been "Makkah Regional Health Affairs, Ministry of Health, Makkah, Saudi Arabia" only. These corrections have been made to the online version as of May 19, 2015.

<?php /* * Copyright 2014 Google Inc. * * Licensed under the Apache License, Version 2.0 (the "License"); you may not * use this file except in compliance with the License. You may obtain a copy of * the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, WITHOUT * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the * License for the specific language governing permissions and limitations under * the License. */ class Google_Service_ServiceUser_LabelDescriptor extends Google_Model { public $description; public $key; public $valueType; public function setDescription($description) { $this->description = $description; } public function getDescription() { return $this->description; } public function setKey($key) { $this->key = $key; } public function getKey() { return $this->key; } public function setValueType($valueType) { $this->valueType = $valueType; } public function getValueType() { return $this->valueType; } }

7

Welcome to Weird Science DC Comics, the DC Comics site for the common man and woman. We're not high falutin, just a bunch of dummies who love comics just like you...we just spend an insane amount of time working on this site for no pay. I told you...dummies! So, sit a spell and read our Reviews, News and Articles and if you are really brave, listen to the Weird Science DC Comics Podcast. We triple dog dare you! Monday, January 19, 2015 Justice League United #8 Review and *SPOILERS* Rerun In last issue of Justice League United, we saw some more space fighting and eventually the bad guy winning....... Well, Byth did take Ultra and as he was traveling towards the open point in time where Ultra would become Infinitus, Martian Manhunter tried to telepathically communicate with the child and Byth managed to kick him out of the kid's brain. All this and Hawkman is still on his side... yeah, I'd call that winning and I think Charlie Sheen would too. Now if your looking for a grand story here where the heroes come up with a plan immediately and stop Byth from entering the time hole, well you're reading the wrong book. What we have instead is some more time travel and what I'd say is about two minutes in real time that our heroes do something. Doesn't that just sound like fun? Let's check it out. Explain It!: Our story begins in the 31st century, where Dream Girl has become leader in Brainiac 5's absence and she leads the Legion against Infinitus's attack on Earth. This is a very strange scene for me because it seems that the remaining Legionnaires want to go back in time and help take down Infinitus before he's ever created and Dream Girl being elected leader tells them that they need to stay and fight......... That is until they actually do go and fight, then Dream Girl's tune changes immediately and she has the Legion retreat back into the past to help the rest of the team. This was so strange to me because I thought we'd get some future action and right when it should have happened, Dream Girl goes "fuck it, let's time travel". I'm not kidding here, that was half the book. Back in the past, we pick up where we left off last issue with Martian Manhunter, Supergirl and Mon-El trying to stop Byth's ship before he can take Ultra into the energy time portal hole thing and Hawkman sporting his space suit goes out to buy Byth some time. Well so much for badass space suit Hawkman, because the remaining Legion members come back in time and blast him..... and I think the book is about to explode from the amount of characters that have been crammed into it. In the end, after Martian Manhunter tries to connect with Ultra again and fails, Supergirl races after the ship but is too late and the ship and her enter the portal. At first it seems like she might have stopped Byth somehow but all those warm feelings of good triumphing over evil are soon stomped out of existence when we see Infinitus form out of the portal. That's it for this issue of Justice League United and I don't want you to think that I skipped over a bunch of stuff with the Explain It!, the issue really was that short. I mean we have a nineteen page count on this book but nothing really happens at all. Like I said in the recap, the action that went down in the present time, I would really put at about two minutes. The rest was us finding out that Dream Girl was elected the leader of the Legion and then her saying the hell with the future and abandoning it. As you'd imagine, Neil Edwards art is as strong as it always is and everyone in this book looks great........... and that's saying something because it seems like we now have about fifty characters flying around doing things. I'd like to know if Jeff Lemire is just screwing with Edwards by continuously adding characters the way he does. See you next month, where hopefully we get to see a full story. Bits and Pieces: We get a big reveal at the end of this book, but the rest of the issue was a complete waste. We've got more characters added to the story and at this point I think the amount would be somewhere in the shit ton category....... I believe that's the technical term. Really though, nothing happened in this book that you haven't seen before in the last two issues. It really felt like a rerun and not the good kind like Fred Berry in What's Happening!! Comics Podcast Network We Be Geeks Network Batman Podcast Network Recent Comments Rant & Rave Line Want to be on the Podcast? Have a Rant and/or a Rave? Don't like Eric's Jerk off Voice? I guess that's a rant...call the Rant and Rave Line at (641) 715-3900 and enter extension 452328 to leave a message for the podcast. Don't forget about that pound sign!!!

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "https://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html><head><title></title> <meta http-equiv="Content-Type" content="text/xhtml;charset=UTF-8"/> <meta name="generator" content="Doxygen 1.8.17"/> <link rel="stylesheet" type="text/css" href="search.css"/> <script type="text/javascript" src="variables_1.js"></script> <script type="text/javascript" src="search.js"></script> </head> <body class="SRPage"> <div id="SRIndex"> <div class="SRStatus" id="Loading">Loading...</div> <div id="SRResults"></div> <script type="text/javascript"><!-- /* @license magnet:?xt=urn:btih:cf05388f2679ee054f2beb29a391d25f4e673ac3&amp;dn=gpl-2.0.txt GPL-v2 */ createResults(); /* @license-end */ --></script> <div class="SRStatus" id="Searching">Searching...</div> <div class="SRStatus" id="NoMatches">No Matches</div> <script type="text/javascript"><!-- /* @license magnet:?xt=urn:btih:cf05388f2679ee054f2beb29a391d25f4e673ac3&amp;dn=gpl-2.0.txt GPL-v2 */ document.getElementById("Loading").style.display="none"; document.getElementById("NoMatches").style.display="none"; var searchResults = new SearchResults("searchResults"); searchResults.Search(); /* @license-end */ --></script> </div> </body> </html>

import { deepEqual } from 'assert'; import drop from '../drop'; test('#drop', () => { const array = [1, 2, 3, 4, 5]; const string = 'Hello World'; deepEqual(drop(2, array), [3, 4, 5]); deepEqual(drop(array.length + 1, array), []); deepEqual(drop(6, string), 'World'); });

Introduction {#sec1} ============ Electron transfer in proteins plays an important role in a wide range of metabolic processes at the cellular level.^[@ref1],[@ref2]^ Many factors have been shown to influence this electron transfer, including the distance separating the electron donor and acceptor,^[@ref3]−[@ref5]^ the extent of secondary structure,^[@ref6],[@ref7]^ dipole moment,^[@ref8]−[@ref10]^ and the nature of the constituent amino acid side chains.^[@ref11]−[@ref14]^ Of particular significance is the suggestion that peptides can undergo electron transfer via either a bridge-assisted superexchange or an electron hopping mechanism.^[@ref15]^ While electron superexchange is a one step process that is exponentially dependent on distance, the hopping model involves a multistep process for electron translocations across long distances, whereby the charge temporarily resides on the bridge between redox centers.^[@ref16],[@ref17]^ Consequently, electron hopping through a peptide can be facilitated by redox-active amino acid side chains in the sequence that act as "stepping stones" for electron transfer.^[@ref18],[@ref19]^ Studies on model peptides have confirmed this, where the rate of electron transfer increases significantly with the introduction of electron rich side-chains into the peptide.^[@ref11]^ For example, Kimura and co-workers demonstrated that linearly spaced electron rich naphthyl groups within synthetic peptides increase the photocurrent by efficient electron hopping between the moieties, compared to reference peptides containing one or no naphthyl groups.^[@ref20]^ An electron rich tryptophan side chain has also been shown to act as a "relay station" to facilitate multistep electron transfer in an azurin metallo-protein isolated from **Pseudomonas aeruginosa**.^[@ref21]^ Multiple sequence alignment of genomes from the respiratory oxidoreductase enzyme NDH1, have revealed the conservation of specific aromatic amino acids from simple prokaryotes through to man, that may serve as candidates for transient charge localization between metal clusters.^[@ref22]^ The majority of research conducted thus far has focused on aromatic amino acids as the source of electron rich "stepping stones". Recent work with an Aib (α-aminoisobutyric acid) rich hexapeptide, constrained into a 3~10~-helix by a triazole-containing covalent tether linking its *i* to *i* + 3 residues,^[@ref23]^ has shown that backbone rigidity also plays a significant role in defining the rate of electron transfer in peptides. Increased rigidity restricts backbone torsional motion, resulting in an additional reorganization energy barrier to electron transfer. In the study reported here, a series of alkene containing peptides, both linear (see **4**, **5**, **6**, and **9**, Figures [1](#fig1){ref-type="fig"} and [2](#fig2){ref-type="fig"}) and also a series of alkene tethered peptides (see **1** and **7**, Figures [1](#fig1){ref-type="fig"} and [2](#fig2){ref-type="fig"}), is used to begin to unravel the interplay of peptide backbone rigidity and the nature of the amino acid side chains in defining the rate of electron transfer, where until now these effects have been considered without factoring in the other variable. Electrochemical and theoretical studies are presented on peptides constrained into both a 3~10~-helix (see **1** and **2**, Figure [1](#fig1){ref-type="fig"}) and a β-strand (see **7** and **8**, Figure [2](#fig2){ref-type="fig"}). The alkene group in the peptides is shown to promote electron transfer, with its influence on backbone rigidity and its role as an electron rich "stepping stone" discussed to explore the generality and connectivity of these effects. {#fig1} {#fig2} Experimental Methods {#sec2} ==================== Chemicals {#sec2.1} --------- Fmoc-Aib-OH, Boc-Aib-OH, Boc-Ser-OH, Fmoc-OSu, 2-chlorotrityl chloride polystyrene resin, 1-hydroxy-7-azabenzotrizole (HOAt) and 2-(1*H*-7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyl uronium hexafluorophosphate methanaminium (HATU) were purchased from GL Biochem (Shanghai) Ltd., China. Dichloromethane (DCM), diethyl ether (Et~2~O), ethyl acetate (EtOAc), methanol and ethanol were purchased from Ajax Finechem Pty Ltd. (Australia). Piperidine, acetonitrile, propan-2-ol and *N*,*N*-dimethylformamide (DMF) were purchased from Merck, Australia. Anhydrous *N*,*N*-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), tetrahydrafuran (THF), Second-generation Grubbs' catalyst, Pd/C catalyst, ethyl vinyl ether, 2,2,2-trifluoroethanol (TFE), trifluoroacetic acid (TFA), 4 M HCl/dioxane solution, *N*,*N*′-dicyclohexylcarbodiimide (DCC), dimethylaminopyridine (DMAP), cysteamine and diisopropylethylamine (DIPEA) were purchased from Sigma-Aldrich, Australia. NaOH was purchased from Chem Supply, Australia. Single-walled carbon nanotubes (P2-SWCNTs) were purchased from Carbon Solutions, Inc., USA. Boc-Ser(Al)-OH^[@ref24]^ and ferrocenylmethylamine^[@ref25],[@ref26]^ were prepared as published. All solvents and reagents were used without purification unless noted. High-Performance Liquid Chromatography {#sec2.2} -------------------------------------- The synthetic peptides were analyzed and purified by reverse phase HPLC, using an HP 1100 LC system equipped with a Phenomenex C18 column (250 × 4.6 mm) for analytical traces and a Phenomenex C18 column (250 × 21.2 mm) for purification, a photodiode array detector, and a Sedex evaporative light scattering detector. Water/TFA (100/0.1 by v/v) and ACN/TFA (100/0.08 by v/v) solutions were used as aqueous and organic buffers. NMR Spectroscopy {#sec2.3} ---------------- ^1^H NMR spectra were recorded in DMSO-*d*~6~ or CDCl~3~-*d* solutions using a Varian Gemini-300 NMR. ^13^C NMR and two-dimensional NMR experiments utilizing COSY, ROESY, HSQC and HMBC, were obtained on a Varian Inova 600 MHz spectrometer. Chemical shifts are reported in ppm (δ) using TMS (0.00 ppm) as the internal standard. Signals are reported as s (singlet), d (doublet), t (triplet) or m (multiplet). Mass Spectroscopy {#sec2.4} ----------------- Low resolution mass spectral data were analyzed using a Finnigan MAT LCQ spectrometer with MS/MS and ESI probe, utilizing XCalibur software. High resolution mass spectral data were analyzed using an Ultimate 3000 RSL HPLC (Thermo Fisher Scientific Inc., MA) and an LTQ Orbitrap XL ETD using a flow injection method, with a flow rate of 5 μL/min. The HPLC flow is interfaced with the mass spectrometer using the Electrospray source (Thermo Fisher Scientific Inc., MA). Mass spectra were obtained over a range of 100 \< *m*/*z* \< 1000. Data were analyzed using XCalibur software (Version 2.0.7, Thermo Fisher Scientific). FTIR Spectroscopy {#sec2.5} ----------------- Infrared spectra were collected on a PerkinElmer Spectrum 100 FT-IR spectrometer, with attenuated total reflectance (ATR) imaging capabilities, fitted with a ZnSe crystal, with an average reading taken from 4 scans at 4 cm^--1^ resolution. Peptide Synthesis {#sec2.6} ----------------- The linear hexapeptides (**3**,^[@ref23]^**4**, **5** and **6**) were synthesized using solid phase peptide synthesis on 2-chlorotrityl chloride resin using Fmoc-Aib-OH, Fmoc-protected allyl serine, and HATU/DIPEA coupling conditions as detailed in the [Supporting Information](#notes-1){ref-type="notes"}. Cleavage from the resin was followed by C-terminal coupling with ferrocenylmethylamine, and the *N*-terminal Boc group was removed to give the free amine for coupling to a single-walled carbon nanotube (SWCNTs)/Au electrode assembly. The 3~10~-helical (**1**) and β-strand (**7**) macrocycles were prepared by ring closing metathesis of the appropriate dienes as detailed in the [Supporting Information](#notes-1){ref-type="notes"}. Peptide **1** involves linking the *i* to *i* + 3 residues using a strategy previously reported by O'Leary and co-workers.^[@ref24]^ In this study the geometry of a related sequence was confirmed by X-ray crystallography.^[@ref24]^ For both of these peptides a single alkene isomer was obtained which was assigned the (*E*)-configuration based on the alkene coupling constant^[@ref27]^ (15.8 Hz for **7**). The C-terminal ferrocenyl group and *N*-terminal free amine were introduced as above. The saturated analogues (**2** and **8**) were prepared by hydrogenation of the macrocyclic alkenes and the linear peptide **9** was prepared by simple peptide coupling in solution. All peptides (**1**--**9**) were purified using reverse phase HPLC prior to attachment to the SWCNTs/Au electrode by HATU/DIPEA. ### General Procedure for N-Boc Cleavage {#sec2.6.0.1} The *N*-Boc protected peptides **1**--**9** were dissolved in trifluoroethanol (TFE), and 4 M HCl in 1,4-dioxane was added. The reaction solution was stirred at rt for 20--30 min, and the solvent removed *in vacuo*. ### Peptide **1** {#sec2.6.0.2} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.49 (s, 1H, N*H*, Aib4), 8.38 (d, 1H, N*H*, *J* = 7.9 Hz, residue2), 8.12 (bs, 3H, N*H*~3~, Aib1), 7.87 (s, 1H, N*H*, Aib3), 7.72 (s, 1H, N*H*, Aib6), 7.45 (d, 1H, N*H*, *J* = 8.2 Hz, residue 5), 7.20 (br s, 1H, N*H*, Fc), 5.73--5.61 (m, 2H, C*H*=C*H*), 4.55 (td, 1H, Cα*H*, *J* = 8.3, 5.1 Hz,), 4.41 (s, 1H, Cα*H*), 4.20--3.20 (m, 19H, Cp, 5 × C*H*~2~), 1.53--1.32 (m, 24H, 8 × C*H*~3~); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 174.74, 174.27, 173.16, 171.62, 169.67, 168.72, 157.97, 157.75, 131.00, 126.08, 86.45, 69.45, 69.31, 68.31, 68.00, 66.98, 65.88, 56.46, 56.41, 56.37, 56.19, 56.13, 54.78, 52.58, 37.85, 26.11, 26.00, 25.61, 25.34, 24.92, 24.41, 24.30, 23.36, 23.28, 23.22, 23.11; HRMS \[M\]^+^~calcd~ = 782.34561, \[M\]^+^~found~ = 782.34567. ### Peptide **2** {#sec2.6.0.3} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.54 (s, 1H, N*H*, Aib3), 8.18 (bs, 3H, N*H*~3~, Aib1), 8.05 (s, 1H, N*H*, Aib4), 7.62 (s, 1H, N*H*, Aib6), 7.57 (d, 1H, N*H*, *J* = 6.4 Hz, residue2), 7.34 (d, 1H, N*H*, *J* = 6.7 Hz, residue5), 7.26 (t, 1H, N*H* (Fc), *J* = 5.8 Hz), 4.42 (m, 1H, Cα*H*), 4.14 (m, 1H, Cα*H*), 4.20--3.30 (m, 19H, Cp, 2 × CαHC*H*~2~, 3 × C*H*~2~), 1.73--1.33 (m, 28H, 2 × C*H*~2~, 8 × C*H*~3~); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 175.14, 174.58, 173.33, 171.20, 169.38, 168.87, 86.45, 71.42, 69.40, 69.33, 68.74, 68.55, 68.32, 67.02, 66.96, 66.91, 56.46, 56.34, 56.20, 56.18, 55.90, 55.66, 53.31, 48.56, 37.87, 26.76, 26.46, 26.10, 25.50, 24.35, 24.32, 23.53, 23.50, 23.45, 23.33, 23.21, 23.01; HRMS \[M\]^+^~calcd~ = 783.36126, \[M\]^+^~found~ = 783.3611. ### Peptide **3** {#sec2.6.0.4} ^1^H NMR (600 MHz, DMSO-*d*~6~), ^13^C NMR (150 MHz, DMSO-*d*~6~) as previously reported.^[@ref23]^ ### Peptide **4** {#sec2.6.0.5} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.65 (s, 1H, N*H*), 8.29 (d, 1H, N*H*, *J* = 7.3 Hz), 8.12 (br s, 3H, N*H*~3~), 7.63 (s, 1H, N*H*), 7.59 (s, 1H, N*H*), 7.54 (t, 1H, N*H*, *J* = 6.0 Hz), 7.38 (s, 1H, N*H*), 5.90 (ddt, 1H, C*H*=CH~2~, *J* = 17.1, 10.6, 5.3 Hz), 5.29 (ddd, 1H, CH=C*H*H, *J* = 17.3, 3.4, 1.6 Hz), 5.19 (dd, 1H, CH=CH*H*, *J* = 10.5, 1.6 Hz), 4.56 (dd, 1H, Cα*H*, *J* = 13.0, 7.5 Hz), 4.22--3.92 (m, 13H, Cp, C*H*~2~, OC*H*~2~), 3.79 (dd, 1H, CHC*H*HCO, *J* = 10.1, 5.4 Hz), 3.64 (dd, 1H, CHCH*H*CO, *J* = 10.1, 8.0 Hz), 1.50--1.29 (m, 30H, 10 × C*H*~3~); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 174.76, 174.24, 173.80, 173.46, 171.81, 169.70, 134.80, 116.73, 86.73, 71.07, 68.98, 68.79, 68.72, 68.62, 68.35, 66.97, 66.84, 56.34, 56.16, 56.04, 55.99, 55.95, 53.25, 37.78, 28.98, 26.00, 25.36, 25.04, 24.97, 24.79, 24.47, 24.08, 23.46, 23.34; LRMS \[M\]^+^~calcd~ = 768.3747, \[M\]^+^~found~ = 768.3764. ### Peptide **5** {#sec2.6.0.6} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.71 (s, 1H, N*H*), δ 8.28 (d, 1H, N*H*, *J* = 6.9 Hz), δ 8.14 (br s, 3H, N*H*), δ 7.63--7.58 (m, 3H, N*H*), δ 7.31 (br s, 1H, N*H*), δ 5.90 (ddd, 1H, OCH~2~C*H*, *J* = 22.3, 10.5, 5.2), δ 5.28 (d, 1H, OCH~2~CH,C*H*H, *J* = 17.2 Hz), δ 5.18 (d, 1H, OCH~2~CH,CH*H*, *J* = 10.5 Hz), δ 4.54 (dd, 1H, Cα*H*, *J* = 13.0, 6.9 Hz), δ 4.27--4.08 (m, 9H, Cp), 4.06--3.99 (m, 2H, OC*H*~2~CH), δ 3.95--3.87 (m, 2H, C*H*~2~Fc), δ 3.90 (m, 1H, Cα*H*), δ 3.78 (dd, 1H, CαHC*H*H, *J* = 10.0, 5.5 Hz), δ 3.63 (m, 1H, CαHCH*H*), δ 1.48--1.31 (m, 24H, 8 × C*H*~3~), δ 1.30--1.27 (m, 3H, C*H*~3~ alanine); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 175.5, 174.5, 172.5, 172.3, 170.3, 135.3, 117.2, 83.4, 71.4, 69.2, 56.8, 56.6, 56.5, 56.3, 53.8, 50.8, 50.3, 26.6, 26.2, 25.5, 25.1, 24.39, 24.30, 23.9, 23.7; HRMS \[M\]^+^~calcd~ = 754.3585, \[M\]^+^~found~ = 754.3588. ### Peptide **6** {#sec2.6.0.7} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.60 (s, 1H, N*H*), 8.24 (d, 1H, N*H*, *J* = 6.9 Hz), 8.12 (s, 3H, N*H*~***3***~), 7.73 (s, 1H, N*H*), 7.60 (d, 1H, N*H*, *J* = 6.3 Hz), 7.50 (s, 1H, N*H*), 7.32 (t, 1H, N*H*, 5.7 Hz), 5.84 (m, 2H, 2 × C*H*=CH~2~), 5.30--5.10 (m, 4H, 2 × CH=C*H*~2~), 4.56 (dd, 1H, Cα*H*, *J* = 13.2, 6.8 Hz), 4.25--3.60 (m, 20H, Cp, Cα*H*, 5 × C*H*~2~), 1.55--1.25 (m, 24H, 8 × C*H*~3~); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 175.00, 173.94, 173.30, 171.74, 169.57, 169.14, 134.87, 134.74, 116.80, 116.29, 109.51, 86.41, 73.00, 71.07, 70.83, 69.35, 68.83, 68.70, 68.53, 68.30, 68.14, 67.06, 67.02, 66.98, 66.94, 56.36, 56.10, 55.95, 54.54, 53.32, 37.80, 25.66, 25.33, 25.13, 25.01, 24.13, 24.06, 23.46, 23.31; LRMS \[M\]^+^~calcd~ = 810.3852, \[M\]^+^~found~ = 810.3834. ### Peptide **7** {#sec2.6.0.8} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.30 (d, 3H, N*H* Tyr, *J* = 3.4 Hz), δ 8.20 (d, 1H, N*H* Gly, *J* = 8.7 Hz), δ 7.99 (t, 1H, N*H* Fc, *J* = 5.8 Hz), δ 7.93 (d, 1H, N*H* Leu, *J* = 8.0 Hz), δ 6.96 (d, 2H, Ar*H*, *J* = 7.9 Hz), δ 6.72 (d, 2H, Ar*H*, *J* = 8.7 Hz), δ 5.64--5.60 (dt, 1H, OCH~2~C*H*, *J* = 15.8, 4.3 Hz), δ 5.54--5.50 (m, 1H, OCH~2~CHC*H*), δ 4.67--4.60 (m, 2H, OC*H*~2~CH), δ 4.41--4.37 (ddd, 1H, Cα*H* Gly, *J* = 11.8, 8.8, 2.7 Hz), δ 4.23--4.18 (m, 1H, Cα*H* Tyr), δ 4.16--4.10 (m, 1H, Cα*H* Leu), δ 4.16--4.04 (m, 9H, Cp), δ 4.00--3.91 (ddd, 2H, C*H*~2~Fc, *J* = 30.9, 14.8, 5.8 Hz), δ 3.05--3.02 (dd, 1H, CαHC*H*HPh, *J* = 13.1, 5.7 Hz), δ 2.71--2.67 (dd, 1H, CαHCH*H*Ph, *J* = 12.9, 10.6 Hz), δ 2.35 (d, 1H, OCH~2~CHCHC*H*, *J* = 15.5 Hz), δ 2.27--2.21 (m, 1H, OCH~2~CHCHC*H*), δ 1.54--1.48 (m, 1H, CαHCH~2~C*H*(CH~3~)~2~), δ 1.36--1.27 (m, 2H, CαHC*H*~2~CH(CH~3~)~2~), δ 0.84--0.82 (m, 6H, CαHCH~2~CH(C*H*~3~)~2~); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 170.5, 166.4, 156.0, 129.8, 129.2, 127.3, 114.9, 86.0, 72.9, 69.4, 69.3, 68.2, 67.3, 67.2, 67.1, 65.8, 52.6, 52.5, 50.8, 43.5, 37.3, 36.0, 33.6, 23.6, 22.8, 22.7; HRMS \[M + H\]^+^ calculated for C~32~H~40~FeN~4~O~4~, 600.23916, found 600.23935; IR 1635 cm^--1^, 1686 cm^--1^ (shoulder) (Amide I Band); 1513 cm^--1^, 1529 cm^--1^ (Amide II Band); 3292 cm^--1^ (Amide A Band). ### Peptide **8** {#sec2.6.0.9} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.32 (d, 3H, N*H* Tyr, *J* = 4.1 Hz), δ 8.11 (d, 1H, N*H* Gly, *J* = 9.1 Hz), δ 7.96 (t, 1H, N*H* Fc, *J* = 5.8 Hz), δ 7.80 (d, 1H, N*H* Leu, *J* = 7.8 Hz), δ 7.00 (d, 2H, Ar*H*, *J* = 7.7 Hz), δ 6.79 (d, 2H, Ar*H*, *J* = 8.6 Hz), δ 4.35--4.25 (m, 3H, OC*H*HC*H*~2~CH~2~, Cα*H* Gly, Cα*H* Tyr), δ 4.19--4.01 (m, 11H, Cp, C*H*~2~), OCH*H*C*H*~2~CH~2~, Cα*H* Leu), δ 3.97--3.92 (dd, 2H, C*H*~2~Fc, *J* = 15.8, 6.1 Hz), δ 3.08--3.05 (dd, 1H, CαHC*H*HPh, *J* = 12.8, 5.8 Hz), δ 2.65--2.61 (m, 1H, CαHCH*H*Ph), δ 1.78--1.70 (m, 1H, OCH~2~C*H*HCH~2~), δ 1.61--1.47 (m, 3H, OCH~2~CH~2~C*H*HC*H*H, CαHCH~2~C*H*(CH~3~)~2~), δ 1.43--1.21 (m, 5H, OCH~2~CH*H*CH*H*CH*H*, CαHC*H*~2~CH(CH~3~)~2~), δ 0.83--0.81 (m, 6H, CαHCH~2~CH(C*H*~3~)~2~); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 171.1, 170.2, 166.4, 156.3, 130.1, 126.2, 115.5, 86.1, 73.0, 69.4, 69.3, 68.7, 67.3, 67.2, 67.1, 66.2, 52.6, 50.8, 50.7, 43.6, 40.0, 37.3, 36.2, 31.2, 26.8, 23.6, 22.8, 22.7, 21.7; HRMS \[M + H\]^+^ calculated for C~32~H~42~FeN~4~O~4~, 602.25500, found 602.25488; IR 1636 cm^--1^ (Amide I Band); 1511 cm^--1^ (Amide II Band); 3293 cm^--1^ (Amide A Band). ### Peptide **9** {#sec2.6.0.10} ^1^H NMR (600 MHz, DMSO-*d*~6~) δ 8.60 (d, 1H, N*H* Leu, *J* = 8.2 Hz), δ 8.21 (d, 1H, N*H* Gly, *J* = 8.2 Hz), δ 8.11 (t, 1H, N*H* Fc, *J* = 5.9 Hz), δ 8.02 (d, 3H, N*H* Tyr, *J* = 4.1 Hz), δ 7.16 (d, 2H, Ar*H*, *J* = 8.5 Hz), δ 6.88 (d, 2H, Ar*H*, *J* = 8.6 Hz), δ 6.06--6.00 (dtt, 1H, OCH~2~C*H*CH~2~, *J* = 15.8, 10.4, 5.2 Hz), δ 5.77--5.69 (m, 1H, CαHCH~2~C*H*CH~2~), δ 5.37 (ddd, 1H, OCH~2~CHC*H*H, *J* = 17.3, 10.3, 1.6 Hz), δ 5.25 (dd, 1H, OCH~2~CHCH*H*, *J* = 10.5, 1.4 Hz), δ 5.08 (dd, 1H, CαHCH~2~CHC*H*H, *J* = 17.1, 1.4 Hz), δ 5.00 (d, 1H, CαHCH~2~CHCH*H*, *J* = 10.2 Hz), δ 4.53 (d, 2H, OC*H*~2~CHCH~2~, *J* = 5.2 Hz), δ 4.46--4.37 (m, 2H, Cα*H* Leu, Cα*H* Gly), δ 4.19--3.94 (m, 12H, Cp, Cα*H* Tyr, C*H*~2~Fc), δ 3.06--3.03 (dd, 1H, CαHC*H*HPh, *J* = 14.4, 4.7 Hz), δ 2.86--2.83 (dd, 1H, CαHCH*H*Ph, *J* = 14.4, 8.1 Hz), δ 2.45--2.30 (m, 2H, CαHC*H*~2~CHCH~2~), δ 1.66--1.59 (td, 1H, CH~2~C*H*(CH~3~)~2~, *J* = 13.5, 6.7 Hz), δ 1.50--1.45 (m, 2H, C*H*~2~CH(CH~3~)~2~), δ 0.90--0.86 (m, 6H, CαHCH~2~CH(C*H*~3~)~2~); ^13^C NMR (150 MHz, DMSO-*d*~6~) δ 171.1, 170.1, 167.6, 157.3, 134.0, 133.7, 130.6, 126.6, 117.3, 114.6, 85.9, 71.5, 70.9, 70.3, 68.3, 68.1, 67.5, 67.4, 67.3, 67.2, 67.1, 53.2, 52.0, 51.0, 48.5, 41.1, 40.0, 37.4, 36.3, 36.0, 23.9, 22.9, 21.6; HRMS \[M + H\]^+^ calculated for C~34~H~44~FeN~4~O~4~, 628.27065, found 628.26923; IR 1641 cm^--1^ (Amide I Band); 1512 cm^--1^ (Amide II Band); 3277 cm^--1^ (Amide A Band). Electrochemistry {#sec2.7} ---------------- All electrochemical measurements were taken with a CHI 650D electrochemical analyzer (CH Instruments, Inc.) with ohmic-drop correction at room temperature. A peptide modified gold surface formed the working electrode^[@ref23]^ (geometric area of 0.33 cm^2^), with a platinum mesh and Ag/AgCl wire used as the counter and reference electrodes, respectively. The Ag/AgCl reference electrode was calibrated after each experiment against the ferrocene/ferricenium couple. Ferrocene-derivatized peptide electrodes were electrochemically characterized in 0.1 mol L^--1^ tetra-*n*-butylammonium hexafluorophosphate (TBAPF~6~)/CH~3~CN solutions. The digitized, background-subtracted curves were analyzed using a Data Master 2003 program. Computational Methods {#sec2.8} --------------------- The lowest energy conformers for all of the *N*-protected peptides were determined in Gaussian 09, with tight convergence criteria using a hybrid B3LYP method with 6-31G\*\* basis set for all C, H, N, O atoms, and Lanl2dz basis set for the Fe atom in order to define the backbone conformations of all peptides. The geometry of each diabatic state was optimized using the latest constrained density functional theory (cDFT)^[@ref28]^ as implemented in NWChem 6.1.1^[@ref29]^ using the B3LYP density functional method with 6-31G\*\* basis set for all C, H, N, O atoms, and Lanl2dz basis set for the Fe atom. Diabatic potential profiles were determined by assuming that during an electron transfer step the nuclear configuration changes smoothly between the optimized geometries of the diabatic states in which the excess electron is localized before and after electron transfer.^[@ref30]^ Thus, the energy of each of the two diabatic states along the electron transfer reaction coordinate was taken as the energy for geometries linearly interpolated between the optimized geometries of the two diabatic states, with the excess electron localized to the part of the molecule corresponding to the diabatic state in question. In these calculations, the solvent effects were taken into account approximately by the COSMO approach. The Löwdin electron population analysis for uncharged and charged amino acids was conducted by respectively placing the charge of 0 and +1 on the individual residue within the linear helical peptide, namely an Aib or a modified serine with electron rich alkene side-chain, using the B3LYP density functional method with 6-31G\*\* basis set for all C, H, N, O atoms, and Lanl2dz basis set for the Fe atom.^[@ref7]^ Results and Discussion {#sec3} ====================== Peptide Design {#sec3.1} -------------- Aib residues were incorporated into peptides **1**--**6** in order to promote the formation of a unifying 3~10~-helical secondary structure.^[@ref23]^ The peptides **1**, **4**, **5**, and **6** also contain alkenes as potential hopping sites for electron transfer, where this group is part of the macrocycle of **1**. The peptides **2** and **3** lack an alkene and hence provide suitable controls. The diene of **6** is positioned in the *i* and *i* + 3 residues, to locate the alkenes on the same side of the molecule in the helix in a proximal arrangement to promote electron transfer. This diene also allows cyclization by ring closing metathesis (RCM) to introduce a covalent tether to further constrain the peptide backbone into a 3~10~-helix and to rigidify the backbone into this geometry. The β-strand constrained peptides (**7** and **8**) have the covalent tether linking the *i* and *i* + 2 residues. Such a 17-membered ring, with an aryl group at the *N*-terminus is known to stabilize a β-strand geometry with the associated rigidification of the backbone.^[@ref27]^ The linear diene **9** was also prepared as a control for the electrochemical studies. Conformational Analysis of Peptides {#sec3.2} ----------------------------------- The geometry of peptides **1**--**6** was confirmed as 3~10~-helical by ^1^H NMR spectroscopy. In particular, strong N*H* (*i*) to N*H* (*i* + 1) ROESY correlations were found for peptides **1**--**6**, together with Cα*H* (*i*) to N*H* (*i* + 1) and medium range Cα*H* (*i*) to N*H* (*i* + 2) correlations, as shown in Figure [3](#fig3){ref-type="fig"} and the [Supporting Information](#notes-1){ref-type="notes"}. A Cα*H* (*i*) to N*H* (*i* + 2) cross peak is only possible for a 3~10~-helix,^[@ref31]^ as the distance between these two hydrogen atoms is in the order of 3.5 Å, whereas in an α-helix the distance between Cα*H* (*i*) to N*H* (*i* + 2) atoms is approximately 4.5 Å, and near the limit of detection.^[@ref32]^ An absence of Cα*H* (*i*) to N*H* (*i* + 4) correlations was noted for all peptides, thus excluding the possibility of an α-helical structure, which is characterized by (*i* to *i* + 4) hydrogen bonds.^[@ref33]^ Strong correlations were also evident for Cβ*H*~2~ (*i*) and N*H* (*i*) in peptides **1** and **2**.^[@ref34]^ Hence the cumulative ^1^H NMR data confirms the presence of 3~10~-helical structures for each of peptides **1**--**6**. {#fig3} The conformations of peptides **7**--**9** were confirmed as β-strand by a combination of ^1^H NMR and IR spectroscopy. Cα*H* (*i*) to N*H* (*i* + 1) and Cβ*H* (*i*) to N*H* (*i* + 1) ROESY correlations were found for all three peptides, indicative of a β-strand geometry^[@ref35]^ (see [Supporting Information](#notes-1){ref-type="notes"}). Furthermore, ^1^H NMR *J*~N*H*Cα*H*~ coupling constants^[@ref35]^ of 8--10 Hz were observed for these peptides. Amide I and II bands, used extensively in peptide/protein structural determination, were found to be in the range assigned to a β-strand conformation^[@ref36]^ for all three tripeptides. Amide A (N--H stretching) frequencies between 3277 and 3293 cm^--1^ were also observed in the IR spectra of peptides **7**--**9**, indicative of the presence of hydrogen bonding within ordered β-sheets^[@ref37]^ (see [Supporting Information](#notes-1){ref-type="notes"}). {#fig4} The lowest energy conformers for the *N*-protected analogues of **1**--**9** (see peptides **10**--**18**, Figures [4](#fig4){ref-type="fig"} and [6](#fig6){ref-type="fig"}) were determined by molecular modeling in order to further define the backbone geometries. The *N*-protected peptides were used in these studies, as free amines are known to give rise to unrealistic electrostatic interactions, resulting in unstable lowest energy conformers.^[@ref38]^ The lowest energy conformers for the *N*-protected helical hexapeptides **10**--**15** (see Figure [4](#fig4){ref-type="fig"}) were calculated. The resulting models indicate that the backbone lengths (from first to last carbonyl carbons) are almost identical, differing by no more than 0.04 Å. The mean hydrogen bond lengths in the constrained helical peptides **10** and **11** is 2.10 Å, which is in accordance with similar 3~10~-helical structures,^[@ref23],[@ref24],[@ref34]^ and 2.12 Å in the unconstrained helical peptides **12**--**15** (see [Supporting Information](#notes-1){ref-type="notes"}), also similar to those reported elsewhere.^[@ref23],[@ref24],[@ref34]^ The most significant difference in the intramolecular hydrogen bond lengths for each of the helical peptides is only 0.15 Å, between residues 2 and 5 in peptides **10** and **15**, which correspond to the *i* and *i* + 3 positions of the constraint. The average dihedral angles for residues 1--6 in each of the *N*-Boc protected analogues, deviate from an ideal 3~10~-helix by no more than 3.6° and 5.9° for Φ and ψ, respectively. Figure [5](#fig5){ref-type="fig"} shows the lowest energy conformer for **15**, revealing that the side-chains are positioned on the same side of the molecule, with the terminal alkenes separated by 6 Å. {#fig5} {#fig6} The calculated lowest energy conformers for the *N*-protected β-strand peptides **16**, **17** and **18**, (see Figure [6](#fig6){ref-type="fig"}) indicate that the backbone length (from first to last carbonyl carbons) are once again almost identical, with the backbone length of the constrained peptides differing by only 0.05 Å. The largest variation in backbone length is 0.30 Å, between the linear analogue (**18**) and the unsaturated peptide (**16**). All other dimensions critical to the characterization of a β-strand conformation, such as N*H* (*i*) to N*H* (*i* + 1), Cα*H* (*i*) to N*H* (*i* + 1) and Cβ*H*~2~ (*i*) to N*H* (*i* + 1) distances (see [Supporting Information](#notes-1){ref-type="notes"}) are in accordance with literature values.^[@ref39]^ Figure [7](#fig7){ref-type="fig"} shows the lowest energy conformers for peptides **16** and **17**, highlighting the structural difference between the side-chains of the saturated and unsaturated molecules. A combination of the molecular modeling studies and the ^1^H NMR and IR data demonstrates that peptides **10**--**15** share remarkably similar 3~10~-helical conformations, while peptides **16**--**18** exhibit a common β-strand geometry. Thus, the prominent structural differences between each of these peptides and hence the analogues (**1**--**6** and **7**--**9**) are simply the variation in the number of electron rich alkenes, the presence (or absence) of the side-bridge constraint, and the associated effect that this has on backbone rigidity as discussed below. {#fig7} Electrochemical Analysis of Intramolecular Electron Transfer {#sec3.3} ------------------------------------------------------------ Each of the peptides **1**--**9** was separately attached to vertically aligned single-walled carbon nanotube array/gold (SWCNTs/Au) electrodes^[@ref40]^ in order to study their electron transfer kinetics. SWCNTs/Au electrodes were used in this study to provide a high surface concentration of redox probes, with an associated significant increase in sensitivity and reproducibility of the electrochemical measurement over bare Au electrodes.^[@ref40]^ Analysis of the electrochemical results for the helical peptides **1**--**6** reveal a pair of redox peaks in each cyclic voltammogram, characteristic of a one-electron oxidation/reduction reaction (Fc^+^/Fc) (see Figure [8](#fig8){ref-type="fig"}). The formal potentials (*E*~0~) and apparent electron transfer rate constants (*k*~app~) were estimated using Laviron's formalism,^[@ref41]^ and given in Table [1](#tbl1){ref-type="other"}. ###### Electron Transfer Rate Constants (*k*~app~), Surface Concentrations and Formal Potentials (*E*~o~) for the Helical Peptides (**1**--**6**) peptide surface concentration ( × 10^--10^ mol cm^--2^) *E*~o~ (V vs AgCl/Ag) *k*~app~*/*s^--1^ --------- ------------------------------------------------- ----------------------- ------------------- 1 4.37 ± 0.43 0.844 17.49 ± 1.46 2 4.19 ± 0.35 0.881 31.88 ± 2.82 3 9.79 ± 0.21 0.508 62.90 ± 5.35 4 4.02 ± 0.41 0.380 260.38 ± 25.32 5 4.12 ± 0.48 0.379 307.11 ± 30.61 6 3.58 ± 0.37 0.375 388.44 ± 37.94 {#fig8} A comparison of the data for the peptides **1**, **4** and **5** provides some insight into the influence of backbone rigidity, where these peptides share a common 3~10~-helical geometry and the presence of a single alkene. Peptide **1** is constrained and hence rigidified by its tether. Peptide **4** contains five Aib residues, while peptide **5** would be the most flexible of the three with an Ala residue in place of one Aib at the site of cyclization in **1**. The data on these compounds reveals an electron transfer rate constant for the macrocyclic peptide **1** of 17 s^--1^, a clear 15--20 fold lower than that of peptides **4** and **5**. Peptide **4** gave the next lowest electron transfer rate constant (260 s^--1^), with the most flexible peptide **5** displaying a value of 307 s^--1^. Thus, there is a clear correlation between the electron transfer rate constant and the flexibility of the peptide backbone. Increased rigidity impedes electron transfer, presumably by restricting the precise torsional motions required by a hopping mechanism, that lead to facile intramolecular electron transfer along the peptide.^[@ref23],[@ref42]^ A dramatic shift to the positive in the formal potential of the constrained peptide **1**, compared to those of the linear analogues **4** and **5**, was also observed. The difference between the formal potentials of the constrained (**1**) and unconstrained (**4** and **5**) peptides was a significant 465 mV. This is similar to results from our previous study involving a hexapeptide that was also stapled *i* to *i* + 3, but by a triazole containing linker introduced by an alternative Huisgen cycloaddition strategy (480 mV).^[@ref23]^ Such a marked disparity between the formal potentials of these linear and macrocyclic peptides is further evidence of the additional backbone rigidity imparted by the side-bridge constraint. The observed effect on electron transfer is the result of cyclization and the associated rigidification, rather than by the makeup of the component macrocycle. A comparison of the data for the three linear hexapeptides (**3**, **4**, and **6**) provides a measure of the influence of the electron rich alkene side-chains on the rate of electron transfer somewhat in isolation from the effects of backbone rigidity. Peptide **6**, with alkenes at both the *i* and *i* + 3 positions, exhibited the largest electron transfer rate constant of 388 s^--1^. The peptide containing one alkene side chain (**4**) gave an electron transfer rate constant of 260 s^--1^. Peptide **3**, which lacks an alkene side chain in its sequence, gave a much reduced electron transfer rate constant of 62 s^--1^. The electron transfer rate constant clearly increases with the increasing number of electron rich alkenes in the peptides, which presumably facilitate electron transfer, by way of a hopping mechanism utilizing the alkenes as "stepping stones". It is important to note that the relative rigidity of the backbones of peptides **3**, **4**, and **6** may also contribute to the rate of electron transfer, which would be expected to decrease with increasing numbers of Aib units through the series as discussed above and elsewhere.^[@ref23]^ A comparison of the data for peptides **5** and **6** sheds further light on this suggestion. These two peptides contain the same number of Aib units and differ only in the number of alkenyl groups to act as potential "stepping stones". The observed electron transfer rate constant for **6** was 388 s^--1^, 20% higher compared to that for **5** (307 s^--1^). This clearly demonstrates the ability of the alkene groups to facilitate electron transfer through the peptide by acting as a "stepping stone". It is thus clear that a combination of both the electronic properties and the extent of backbone rigidity determines the rate of electron transfer in peptides. ###### Electron Transfer Rate Constants (*k*~app~), Surface Concentrations and Formal Potentials (*E*~o~) for the β-Strand Peptides (**7--9**) peptide surface concentration ( × 10^--10^ mol cm^--2^) *E*~o~ (V vs AgCl/Ag) *k*~app~/*s*^--1^ --------- ------------------------------------------------- ----------------------- ------------------- **7** 9.21 ± 0.89 0.676 11.72 ± 1.16 **8** 7.13 ± 0.68 0.827 23.62 ± 2.13 **9** 5.56 ± 0.31 0.408 421.36 ± 41.51 {#fig9} A comparison of the unsaturated and saturated macrocyclic peptides **1** and **2** provides further insights into the role of these two effects on the efficiency of electron transfer. Unlike the linear peptides **4**, **5** and **6**, the planar alkene of **1** is able to influence both the backbone rigidity and potentially the electronic properties with its inclusion in a ring. One might expect this alkene to enhance backbone rigidity, while at the same time providing a potential "stepping stone" for electron transfer. These effects are opposing, with the first expected to decrease the electron transfer rate and the second to increase it. Interestingly, the unsaturated macrocycle **1** gave an approximate 2-fold decrease in the electron transfer rate relative to **2**, with values of 17 and 31 s^--1^, respectively. This observation is reinforced for the two β-strand constrained peptides, the unsaturated macrocycle **7** and the saturated analogue **8** which displayed electron transfer rates of 11 and 23 s^--1^, respectively (see Tables [1](#tbl1){ref-type="other"} and [2](#tbl2){ref-type="other"}). Clearly, increasing backbone rigidity in both secondary structures (3~10~-helix and β-strand) decreases the efficiency of electron transfer. Curiously, the saturated helical peptide **2** exhibited a formal potential shift to the positive of 37 mV compared to the unsaturated analogue **1**. The saturated β-strand peptide **8** recorded an even greater formal potential shift to the positive of 151 mV relative to its unsaturated analogue **7** (see Figure [9](#fig9){ref-type="fig"}). Thus, oxidation/reduction of the ferrocene moiety in both of the saturated peptides is energetically less favorable than in the corresponding unsaturated peptides. However, the observed electron transfer rate constants for both saturated peptides are almost double that of their unsaturated counterparts. As noted here for **1**, **2**, **7**, **8**, and elsewhere,^[@ref23]^ peptides constrained by a side-chain tether give rise to a significant increase in the formal potentials relative to their linear analogues, reflecting the associated increase in backbone rigidity. Thus, any formal potential shift to the positive is usually combined with a reduction in the electron transfer rate constant. Therefore, while the effect of backbone rigidity appears to be the dominant factor in this case, it would also be expected that the electron rich alkene in the tether of peptides **1** and **7** should enhance electronic coupling. However, further investigation is required to substantiate this notion, and this is developed further in the following computational study section. Computational Study on Intramolecular Electron Transfer {#sec3.4} ------------------------------------------------------- High level theoretical calculations, using the latest constrained density functional theory (cDFT), were conducted on β-strand models **19**, **20**, and **21** in order to provide further insights into the relative roles of backbone rigidity and electron rich side-chains on intramolecular electron transfer (see Figure [10](#fig10){ref-type="fig"}). These peptides are analogous to **7**, **8** and **9**, but with ferrocene units included at both termini to act as both donor and acceptor. Diabatic states were constructed by individually localizing an overall charge of +1 on each of the amino acids and ferrocene units,^[@ref28]^ as shown in Figure [10](#fig10){ref-type="fig"}. Reorganization energies (λ) for electron transfer along the backbone were calculated, together with electronic coupling constants (*H*~ab~) in order to provide an insight into the overall intramolecular electron transfer dynamics. {#fig10} A trend between the electronic coupling constants (*H*~ab~) and the number of double bonds in each side-chain is evident. The structure with the greatest number of electron rich side-chains (unconstrained peptide **21**) has the largest coupling constant (0.106 eV). This is sequentially followed by the unsaturated peptide **19** (0.087 eV), and the saturated peptide **20** (0.049 eV) (see Table [3](#tbl3){ref-type="other"}). Significantly, the electronic coupling constant for unsaturated **19** (0.087 eV) is almost double that of the saturated analogue **20** (0.049 eV). This clearly indicates that the electron rich alkene in the tether of the unsaturated peptide does indeed enhance electronic coupling. ###### Electronic Coupling Constants (*H*~ab~), the Number of Double Bonds in Each Side-Chain and Average Reorganization Energies (λ) for Peptides **19**--**21**, and the Formal Potentials (*E*~o~) and Electron Transfer Rate Constants (*k*~app~) for Their Analogues, Peptides **7**--**9** peptide formal potential (*E*~o~) (V vs AgCl/Ag) *H*~ab~ (eV) number of C=C in side chains average reorganization energy (λ) (eV) *k*~app~/s^--1^ ---------------- ------------------------------------------ -------------- ------------------------------ ---------------------------------------- ----------------- **20** (**8**) 0.827 0.049 0 0.65 23 **19** (**7**) 0.676 0.087 1 0.74 11 **21** (**9**) 0.408 0.106 2 0.35 421 Furthermore, the formal potential observed experimentally for the unsaturated peptide **7** is significantly lower than that observed for the saturated **8** (see Table [3](#tbl3){ref-type="other"}). This lower potential is clearly attributable to the effect of the electron rich alkene since the only structural difference between these constrained peptides is the presence or otherwise of the electron rich π-bond in the side-chain of **7**. In contrast, the higher reorganization energy calculated for the derivative of **7** (unsaturated analogue **19** (0.74 eV)), relative to the derivative of **8** (saturated analogue **20** (0.65 eV)), is likely the direct consequence of the lack of rotational freedom available in the side-chain of the unsaturated peptide. This leads to an increase in the rigidity of the backbone and consequently to the lower rate of electron transfer observed for unsaturated **7**, compared to saturated **8**. Additionally, a large difference of up to 0.49 eV is apparent between the reorganization energies of the constrained peptides (**19** and **20)**, and those of the unconstrained **21** (see [Table S13, Supporting Information](#notes-1){ref-type="notes"}). The unconstrained peptide **21** gave rise to the highest calculated (*H*~ab~) and the lowest calculated (λ) based on Marcus theory,^[@ref43]^ which suggests that oxidation/reduction of the ferrocene moiety is energetically more favorable in the linear peptide, than in either of the constrained compounds. This supports the earlier experimental observation where the linear peptide **9** exhibited the lowest formal potential relative to the two constrained peptides **7** and **8** (by between 268 and 419 mV), and the highest electron transfer rate constant (an 18--38 fold increase) relative to **7** and **8** (see Table [3](#tbl3){ref-type="other"}). This is indicative of the additional backbone rigidity imparted by the constraint. Thus, the influence of the electron rich alkenes and any effects arising from a change in backbone rigidity can be studied in isolation using a combination of experimental and theoretical studies. Both factors clearly contribute to the rate of electron transfer in peptides. Electron population analysis (EPA) was conducted to further elucidate the role of electron rich side-chains as "stepping stones" for electron transfer. The amino acid residues used in the synthesis of the linear helical peptides (**4**, **5** and **6**), namely, an Aib and a modified serine with electron rich alkene side-chain were considered. A Löwdin analysis of the charge distribution from the cDFT calculations on the charged and uncharged amino acid residues is shown in Table [4](#tbl4){ref-type="other"}. Approximately 88% of the extra charge is distributed on the amide region when the positive charge (+1) was injected into the Aib residue. This emphasizes the significant contribution made by the amide region to intramolecular electron transfer through the peptide backbone, clearly demonstrating the participation of a through-bond hopping mechanism.^[@ref7]^ However, when the positive charge (+1) was injected into the modified serine residue, only 68% of the extra charge was distributed on the amide region, with the electron rich alkene side-chain holding approximately 20% of the extra charge localized on the residue (see Table [4](#tbl4){ref-type="other"}). Thus, these results confirm the role of the electron rich alkene side-chain as a "stepping stone" for electron transfer. ###### Löwdin Analysis of the Charge Distribution on Uncharged and Charged Amino Acid Residues (1) Aib and (2) Modified Serine with Electron Rich Alkene Side-Chain {#fx1} Conclusion {#sec4} ========== Electrochemical studies are reported on a series of peptides (**1**--**9**) in order to elucidate the effect of backbone rigidity and the nature of the amino acid side chains in defining the rate of electron transfer. Aib residues were incorporated into peptides **1**--**6** to promote the formation of a unifying 3~10~-helical secondary structure, with the number of alkenes in their side-chains varying from 0 to 2. The backbones of peptides **1** and **2** were further constrained into a 3~10~-helix with a side chain tether introduced by RCM. The side-chain of **1** contains a single C=C double bond, while peptide **2** is fully saturated. Peptides **7**--**9** share a common β-strand conformation, with **7** (unsaturated) and **8** (saturated) further rigidified into this geometry via cyclization by RCM. Electrochemical studies conducted on peptides **1**, **4** and **5**, each containing a single alkene in their structure, revealed a direct link between backbone rigidity and the efficiency of electron transfer. The significant difference in the formal potentials of the constrained **1** and unconstrained **4** and **5**, (465 mV) is in accordance with our previous study (480 mV).^[@ref23]^ This demonstrates a general observation, where a tether hinders electron transfer in peptides by restricting backbone flexibility. Further studies on the linear peptides **3**--**6**, containing between 0 and 2 electron rich side-chains in their structure, confirmed the ability of the alkene to facilitate electron transfer through the peptide, while nullifying the effects of backbone rigidity. The macrocyclic helical peptides reveal a formal potential shift to the positive and subsequent reduction of the electron transfer rate constant for unsaturated **1**, relative to saturated **2**. Comparable results were also evident for the unsaturated (**7**) and saturated (**8**) β-strand peptides. The only structural difference between the unsaturated and saturated peptides is the presence or otherwise of the electron rich π-bond in the side-chain, so the lower the electron transfer rate constants observed for both unsaturated peptides (**1** and **7**) are likely a direct consequence of the lack of rotational freedom about this double bond, which results in further rigidification of the peptide backbone. High level calculations performed on peptides **19** and **20** (analogues of **7** and **8**) confirmed that the reorganization energy is greater in the unsaturated peptide (**19**), thus supporting the observed lower electron transfer rate constant of **7**, relative to saturated **8**. However, the lower formal potential observed experimentally for the unsaturated **7**, suggests that oxidation/reduction of the ferrocene moiety is energetically more favorable in **7**. Theoretical calculations show that the derivative of the unsaturated peptide **7** (**19**), exhibited a higher electronic coupling constant than its saturated counterpart **20**, which helps to explain this paradox, while further demonstrating the ability of the alkene to facilitate electron transfer. Thus, the theoretical electronic coupling constants and reorganization energies, together with the formal potentials and electron transfer rate constants observed experimentally for the macrocyclic peptides, reveal for the first time an interplay between electron rich alkene side-chains and backbone rigidity, with both factors clearly shown to contribute to the efficiency of electron transfer in peptides. Additional high level calculations were also performed on the amino acid residues used in the synthesis of the linear helical peptides (**4**, **5** and **6**), namely, an Aib and a modified serine with electron rich alkene side-chain. Injection of a positive charge into the modified serine residue shows that approximately 20% of the extra charge is localized on the electron rich side-chain, so confirming the role of the alkene as a "stepping stone" for electron transfer. These findings provide a new approach to fine-tune the electronic properties of peptides through chemical modification of the backbone to increase/decrease rigidity, and through the inclusion of electron rich side-chains. Such structurally diverse peptides with controllable electronic functions open new avenues in the design and fabrication of efficient components for molecular-based electronic devices. Synthesis of peptides, ROESY spectra of peptides **1**, **4**, **5**, **6**, **7**, **8** and **9**, IR spectra for peptides **7**--**9**, computational models of peptides **10**, **11**, **13**, **14**, **15**, **16**, **17** and **18**, electrochemical measurements, diabatic potential profiles and reorganization energies in the three model peptides **19**, **20** and **21**, ^1^H NMR spectra for target peptides and their key synthetic intermediates. This material is available free of charge via the Internet at <http://pubs.acs.org>. Supplementary Material ====================== ###### ja507175b_si_001.pdf The authors declare no competing financial interest. We would like to thank Miss Kyra Middlemiss for her assistance with the synthesis of helical peptide precursors. The financial support of this work by the Australian Research Council is gratefully acknowledged. The computational aspects of this work were supported by an award under the National Computational Merit Allocation Scheme for J.Y. on the National Computing Infrastructure (NCI) National Facility at the Australian National University.

This application proposes to adapt and pilot test an efficacy-based, manualized intervention to enhance the mental health benefits for children attending publicly funded, inner city, after-school programs. The proposed study is consistent with objectives of the R34 mechanism (1. Development and Pilot Testing of New or Adapted Interventions, and 2. Adaptation and Pilot Testing for Effectiveness) towards a planned program of research to study how mental health consultation and support can strengthen the benefits of after-school programs for inner city children's academic, social, and behavioral functioning. Despite extensive problems facing urban communities during after-school hours, few empirical studies have examined children's use of time, quantity and quality of programs available, participation rates, and the potential mental health benefits of programs. We propose to collaborate with a large, publicly funded provider of after-school programs - Chicago Park District's Park Kids program - toward three research goals. Children (n=318) in grades 1 to 8 who attend one of the participating programs will be enrolled in the study. First, we will collaborate with after-school program staff toward the adaptation and application of a manualized, efficacy-based intervention [unreadable] (Pelham, 1985) to meet the needs, capabilities, and constraints of their program, and we will provide training and ongoing support. Second, we will develop and implement a fidelity measure of staff adherence to the intervention. Third, we will use random-effects regression models to pilot test the impact of the intervention at three (experimental) after-school sites compared to three (comparison) after-school-as-usual sites on four domains of children's outcomes (Hoagwood et al., 1996): symptoms (children's externalizing and internalizing problems), functioning (children's academic, social, and behavioral outcomes), environmental outcomes (staff psychological climate), and satisfaction (parent and staff). This proposal responds to recent national concerns about after-school care, and the need for alternative venues for mental health service delivery in inner cities (Stephenson, 2000; Surgeon General's report). [unreadable] [unreadable]

Toxomerini The Toxomerini are a tribe of hoverflies. References Category:Hoverflies

Table of Contents 1 Introduction (Page No. - 20) 1.1 Objectives of the Study 1.2 Market Definition 1.2.1 Market Scope 1.3 Years Considered for the Study 1.4 Stakeholders 2 Research Methodology (Page No. - 23) 2.1 Research Data 2.1.1 Secondary Data 2.1.2 Primary Data 2.1.2.1 Breakup of Primary Profiles 2.1.2.2 Key Industry Insights 2.2 Market Breakup and Data Triangulation 2.3 Market Size Estimation 2.3.1 Top-Down Approach 2.3.2 Bottom-Up Approach 2.4 Market Forecast 2.5 Assumptions for the Study 2.6 Limitations of the Study 3 Executive Summary (Page No. - 30) 4 Premium Insights (Page No. - 33) 4.1 Attractive Growth Opportunities in the Cloud Infrastructure Services Market 4.2 Market By Deployment Model, 2019 4.3 North America: Market By Service Type and Country 5 Cloud Infrastructure Services Market Overview (Page No. - 35) 5.1 Introduction 5.2 Market Dynamics 5.2.1 Drivers 5.2.1.1 Changing Market Trends and Agility 5.2.1.2 Increasing Iaas Benefits 5.2.1.3 Increased Cost-Savings and ROI 5.2.1.4 Edge Computing Going Mainstream 5.2.2 Restraints 5.2.2.1 Concern Over Data Losses 5.2.2.2 Reluctance of Employees to Upgrade Existing Skills 5.2.3 Opportunities 5.2.3.1 Increase in the Adoption of Hybrid Cloud Services 5.2.3.2 Rise in the Number of SMEs to Create New Revenue Opportunities for Cloud Vendors 5.2.4 Challenges 5.2.4.1 Increased Need to Manage Regulatory and Compliance Policy Needs 5.2.4.2 Compatibility Issues With Legacy Systems 5.2.4.3 Fear of Vendor Lock-In 5.3 Industry Trends 5.3.1 Use Case 1: IBM 6 Cloud Infrastructure Services Market By Service Type (Page No. - 40) 6.1 Introduction 6.2 Compute as a Service 6.2.1 On-Demand Billing of Computing Resource to Drive the Demand for Compute as a Service 6.3 Storage as a Service 6.3.1 Simplified Implementation, Ease of Maintenance, and Maximum Return on Investment to Drive the Demand for Storage Services 6.4 Disaster Recovery and Backup as a Service 6.4.1 Need to Protect Data From Any Disaster to Drive the Demand for Disaster Recovery and Backup as a Service 6.5 Networking as a Service 6.5.1 Network as a Service to Enable Enterprises Optimize Network Streams 6.6 Desktop as a Service 6.6.1 Freedom of Accessing Desktops From Anywhere, Anytime, and Anyhow to Drive the Adoption of Desktop as a Service 6.7 Managed Hosting 6.7.1 Need to Reduce Redundancy and Latency in Orchestrating Storage and Keeping Full Control Over Content to Drive the Demand for Managed Hosting 7 Cloud Infrastructure Services Market By Deployment Model (Page No. - 55) 7.1 Introduction 7.2 Public Cloud 7.2.1 Lower Capital Expenditure and Higher Scalability Benefits to Drive the Demand for Public Cloud 7.3 Private Cloud 7.3.1 Concerns Over Security and Privacy to Drive the Deployment of Iaas on Private Cloud 7.4 Hybrid Cloud 7.4.1 Scalability, Security, and Cost-Effectiveness to Drive the Deployment of Infrastructure as a Service on Hybrid Cloud 8 Cloud Infrastructure Services Market By Organization Size (Page No. - 63) 8.1 Introduction 8.2 Small and Medium-Sized Enterprises 8.2.1 Reduced Cost of Implementation With Flexible Pricing Models Led to Higher Adoption of Iaas Among Small and Medium-Sized Enterprises 8.3 Large Enterprises 8.3.1 Benefit of Scaling Up Or Down the Infrastructure System as Per Business Requirements to Drive the Adoption of Iaas Among Large Enterprises 9 Cloud Infrastructure Services Market By Vertical (Page No. - 67) 9.1 Introduction 9.2 Banking, Financial Services and Insurance 9.2.1 Unrivaled Level of Agility, Security, and Scalability to Drive the Demand for Iaas in Banking, Financial Services and Insurance Vertical 9.3 It and Telecommunications 9.3.1 Need to Enhance Customer Satisfaction and Provide Faster Time-To-Market for Satisfying Changing Customer Needs to Drive the Adoption of Infrastructure as a Service in It and Telecommunications Vertical 9.4 Government and Public Sector 9.4.1 Need to Increase Citizen Engagement and Government Favourable Policies of Digital Technologies to Drive the Adoption of Infrastructure as a Service in Government and Public Sector 9.5 Retail and Consumer Goods 9.5.1 Growing Competition to Increase Market Shares and Profit Margins to Drive the Adoption of Infrastructure as a Service in the Retail and Consumer Goods Vertical 9.6 Manufacturing 9.6.1 Growing Need to Optimize Product Manufacturing and Delivery Processes to Drive the Adoption of Infrastructure as a Service in the Manufacturing Vertical 9.7 Energy and Utilities 9.7.1 Growing Need to Manage Complex Operations and Ensuring Reliability of Power System to Boost the Adoption of Infrastructure as a Service in the Energy and Utilities Vertical 9.8 Media and Entertainment 9.8.1 Focus of Organizations on Maintaining Large Pool of Content With Low Capex to Drive the Adoption of Infrastructure as a Service in the Media and Entertainment Vertical 9.9 Healthcare and Life Sciences 9.9.1 Need to Streamline Patient Health and Enhance Medical Staff Productivity to Drive the Demand for Infrastructure as a Service in the Healthcare and Life Sciences Vertical 9.10 Others 10 Cloud Infrastructure Services Market By Region (Page No. - 78) 10.1 Introduction 10.2 North America 10.2.1 United States 10.2.1.1 Deployment of Infrastructure as a Service to Improve Scalability of Storage and Networks Among Enterprises Fueling the Market Growth in the United States 10.2.2 Canada 10.2.2.1 Greater Flexibility in Resource Allocation, Agility, and Scalability to Drive the Growth of the Cloud Infrastructure Services Market in Canada 10.3 Europe 10.3.1 United Kingdom 10.3.1.1 Need to Deliver Consistent Customer Service Experience to Drive the Adoption of Infrastructure as a Service in the United Kingdom 10.3.2 Rest of Europe 10.4 Asia Pacific 10.4.1 China 10.4.1.1 Increasing Investments By Organizations Toward Implementing Cloud Technology-Based Solutions to Fuel the Adoption of Infrastructure as a Service in China 10.4.2 Rest of Asia Pacific 10.5 Middle East and Africa 10.5.1 Kingdom of Saudi Arabia 10.5.1.1 Focus of Organizations on Lowering Costs of It Service Operations and Enhance Efficiency to Drive the Growth of the Cloud Infrastructure Services Market in Kingdom of Saudi Arabia 10.5.2 Rest of Middle East and Africa 10.6 Latin America 10.6.1 Brazil 10.6.1.1 Focus of Organizations on Reducing Capex to Drive the Growth of the Cloud Infrastructure Services Market in Brazil 10.6.2 Mexico 10.6.2.1 Digital Transformation in the Telecommunication Vertical to Propel the Adoption of Infrastructure as a Service in Mexico 10.6.3 Rest of Latin America 11 Competitive Landscape (Page No. - 113) 11.1 Introduction 11.2 Competitive Scenario 11.2.1 New Product/Service Launches 11.2.2 Business Expansions 11.2.3 Acquisitions 11.2.4 Partnerships 11.3 Competitive Leader Mapping 11.3.1 Visionary Leaders 11.3.2 Innovators 11.3.3 Dynamic Differentiators 11.3.4 Emerging Companies 12 Company Profiles (Page No. - 120) 12.1 Introduction (Business Overview, Services, Key Insights, Recent Developments, SWOT Analysis, MnM View)* 12.2 AWS 12.3 Microsoft 12.4 Google 12.5 IBM 12.6 Alibaba Cloud 12.7 Rackspace 12.8 Oracle 12.9 Fujitsu 12.10 VMware 12.11 Centurylink 12.12 Dimension Data 12.13 DXC 12.14 Verizon 12.15 Tencent 12.16 AT&T 12.17 NEC 12.18 Joyent 12.19 Virtustream 12.20 Digitalocean 12.21 Skytap 12.22 OVH 12.23 Bluelock 12.24 Navisite *Details on Business Overview, Products & Services, Key Insights, Recent Developments, SWOT Analysis, MnM View Might Not Be Captured in Case of Unlisted Companies. 13 Appendix (Page No. - 169) 13.1 Discussion Guide 13.2 Knowledge Store: Marketsandmarkets� Subscription Portal 13.3 Available Customizations 13.4 Related Reports 13.5 Author Details List of Tables (122 Tables) Table 1 Factor Analysis Table 2 Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 3 Compute as a Service: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 4 North America: Compute as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 5 Europe: Compute as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 6 Asia Pacific: Compute as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 7 Middle East and Africa: Compute as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 8 Storage as a Service: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 9 North America: Storage as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 10 Europe: Storage as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 11 Asia Pacific: Storage as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 12 Middle East and Africa: Storage as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 13 Disaster Recovery and Backup as a Service: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 14 North America: Disaster Recovery and Backup as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 15 Europe: Disaster Recovery and Backup as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 16 Asia Pacific: Disaster Recovery and Backup as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 17 Middle East and Africa: Disaster Recovery and Backup as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 18 Networking as a Service:Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 19 North America: Networking as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 20 Europe: Networking as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 21 Asia Pacific: Networking as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 22 Middle East and Africa: Networking as a Service Market Size, By Country, 2017�2024 (USD Million) Table 23 Desktop as a Service: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 24 North America: Desktop as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 25 Europe: Desktop as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 26 Asia Pacific: Desktop as a Service Market Size, By Country, 2017�2024 (USD Billion) Table 27 Middle East and Africa: Desktop as a Service Market Size, By Country, 2017�2024 (USD Million) Table 28 Managed Hosting: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 29 North America: Managed Hosting Market Size, By Country, 2017�2024 (USD Billion) Table 30 Europe: Managed Hosting Market Size, By Country, 2017�2024 (USD Billion) Table 31 Asia Pacific: Managed Hosting Market Size, By Country, 2017�2024 (USD Billion) Table 32 Middle East and Africa: Managed Hosting Market Size, By Country, 2017�2024 (USD Billion) Table 33 Cloud Infrastructure Services Market Size, By Deployment Model, 2017�2024 (USD Billion) Table 34 Public Cloud: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 35 North America: Public Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 36 Europe: Public Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 37 Asia Pacific: Public Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 38 Middle East and Africa: Public Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 39 Private Cloud: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 40 North America: Private Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 41 Europe: Private Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 42 Asia Pacific: Private Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 43 Middle East and Africa: Private Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 44 Hybrid Cloud: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 45 North America: Hybrid Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 46 Europe: Hybrid Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 47 Asia Pacific: Hybrid Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 48 Middle East and Africa: Hybrid Cloud Market Size, By Country, 2017�2024 (USD Billion) Table 49 Cloud Infrastructure Services Market Size, By Organization Size, 2017�2024 (USD Billion) Table 50 Small and Medium-Sized Enterprises: Market Size By Region, 2017�2024 (USD Billion) Table 51 Large Enterprises: Market Size By Region, 2017�2024 (USD Billion) Table 52 Cloud Infrastructure Services Market Size, By Vertical, 2017�2024 (USD Billion) Table 53 Banking, Financial Services and Insurance: Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 54 It and Telecommunications: Market Size By Region, 2017�2024 (USD Billion) Table 55 Government and Public Sector: Market Size By Region, 2017�2024 (USD Billion) Table 56 Retail and Consumer Goods: Market Size By Region, 2017�2024 (USD Billion) Table 57 Manufacturing: Market Size By Region, 2017�2024 (USD Billion) Table 58 Energy and Utilities: Market Size By Region, 2017�2024 (USD Billion) Table 59 Media and Entertainment: Market Size By Region, 2017�2024 (USD Billion) Table 60 Healthcare and Life Sciences: Market Size By Region, 2017�2024 (USD Billion) Table 61 Others: Market Size By Region, 2017�2024 (USD Billion) Table 62 Cloud Infrastructure Services Market Size, By Region, 2017�2024 (USD Billion) Table 63 North America: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 64 North America: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 65 North America: Market Size By Organization Size, 2017�2024 (USD Billion) Table 66 North America: Market Size By Vertical, 2017�2024 (USD Billion) Table 67 North America: Market Size By Country, 2017�2024 (USD Billion) Table 68 United States: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 69 United States: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 70 United States: Market Size By Organization Size, 2017�2024 (USD Billion) Table 71 United States: Market Size By Vertical, 2017�2024 (USD Billion) Table 72 Canada: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 73 Canada: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 74 Canada: Market Size By Organization Size, 2017�2024 (USD Billion) Table 75 Canada: Market Size By Vertical, 2017�2024 (USD Billion) Table 76 Europe: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 77 Europe: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 78 Europe: Market Size By Organization Size, 2017�2024 (USD Billion) Table 79 Europe: Market Size By Vertical, 2017�2024 (USD Billion) Table 80 Europe: Market Size By Country, 2017�2024 (USD Billion) Table 81 United Kingdom: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 82 United Kingdom: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 83 United Kingdom: Market Size By Organization Size, 2017�2024 (USD Billion) Table 84 United Kingdom: Market Size By Vertical, 2017�2024 (USD Billion) Table 85 Rest of Europe: Market Size By Service Type, 2017�2024 (USD Billion) Table 86 Rest of Europe: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 87 Rest of Europe: Market Size By Organization Size, 2017�2024 (USD Billion) Table 88 Rest of Europe: Market Size By Vertical, 2017�2024 (USD Billion) Table 89 Asia Pacific: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 90 Asia Pacific: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 91 Asia Pacific: Market Size By Organization Size, 2017�2024 (USD Billion) Table 92 Asia Pacific: Market Size By Vertical, 2017�2024 (USD Billion) Table 93 Asia Pacific: Market Size By Country, 2017�2024 (USD Billion) Table 94 China: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 95 China: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 96 China: Market Size By Organization Size, 2017�2024 (USD Billion) Table 97 China: Market Size By Vertical, 2017�2024 (USD Billion) Table 98 Rest of Asia Pacific: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 99 Rest of Asia Pacific: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 100 Rest of Asia Pacific: Market Size By Organization Size, 2017�2024 (USD Billion) Table 101 Rest of Asia Pacific: Market Size By Vertical, 2017�2024 (USD Billion) Table 102 Middle East and Africa: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 103 Middle East and Africa: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 104 Middle East and Africa: Market Size By Organization Size, 2017�2024 (USD Billion) Table 105 Middle East and Africa: Market Size By Vertical, 2017�2024 (USD Billion) Table 106 Middle East and Africa: Market Size By Country, 2017�2024 (USD Billion) Table 107 Kingdom of Saudi Arabia: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Million) Table 108 Kingdom of Saudi Arabia: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 109 Kingdom of Saudi Arabia: Market Size By Organization Size, 2017�2024 (USD Billion) Table 110 Kingdom of Saudi Arabia: Market Size By Vertical, 2017�2024 (USD Million) Table 111 Rest of Middle East and Africa: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 112 Rest of Middle East and Africa: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 113 Rest of Middle East and Africa: Market Size By Organization Size, 2017�2024 (USD Billion) Table 114 Rest of Middle East and Africa: Market Size By Vertical, 2017�2024 (USD Million) Table 115 Latin America: Cloud Infrastructure Services Market Size, By Service Type, 2017�2024 (USD Billion) Table 116 Latin America: Market Size By Deployment Model, 2017�2024 (USD Billion) Table 117 Latin America: Market Size By Organization Size, 2017�2024 (USD Billion) Table 118 Latin America: Market Size By Vertical, 2017�2024 (USD Billion) Table 119 New Product Launches, 2018�2019 Table 120 Business Expansions, 2018�2019 Table 121 Acquisitions, 2016�2019 Table 122 Partnerships, 2018�2019 List of Figures (36 Figures) Figure 1 Cloud Infrastructure Services Market : Research Design Figure 2 Market Top-Down and Bottom-Up Approaches Figure 3 Market Top Segments, 2019�2024 Figure 4 Market By Region Figure 5 Increasing Number of Data Centers Across Regions and Rising Government Initiatives to Drive the Growth of the Market Figure 6 Public Cloud Segment to Hold the Highest Market Share in 2019 Figure 7 Storage as a Service Segment and the United States to Account for High Market Shares in the North American Cloud Infrastructure Services Market in 2019 Figure 8 Drivers, Restraints, Opportunities, and Challenges Figure 9 Disaster Recovery and Backup as a Service Segment to Grow at the Highest Growth Rate During the Forecast Period Figure 10 Hybrid Cloud Segment to Grow at the Highest Growth Rate During the Forecast Period Figure 11 Small and Medium-Sized Enterprises Segment to Grow at A Higher Growth Rate During the Forecast Period Figure 12 BFSI Vertical to have the Highest Market Size in 2019 Figure 13 Asia Pacific to Grow at the Highest Growth Rate During the Forecast Period Figure 14 North America: Market Snapshot Figure 15 Asia Pacific: Market Snapshot Figure 16 Key Developments By the Leading Players in the Market During 2016�2019 Figure 17 Global Cloud Infrastructure Services Market (Global) Competitive Leadership Mapping, 2019 Figure 18 AWS: Company Snapshot Figure 19 AWS: SWOT Analysis Figure 20 Microsoft: Company Snapshot Figure 21 Microsoft: SWOT Analysis Figure 22 Google: Company Snapshot Figure 23 Google: SWOT Analysis Figure 24 IBM: Company Snapshot Figure 25 IBM: SWOT Analysis Figure 26 Alibaba Cloud: Company Snapshot Figure 27 Alibaba Cloud: SWOT Analysis Figure 28 Oracle: Company Snapshot Figure 29 Fujitsu: Company Snapshot Figure 30 VMware: Company Snapshot Figure 31 Centurylink: Company Snapshot Figure 32 DXC: Company Snapshot Figure 33 Verizon: Company Snapshot Figure 34 Tencent: Company Snapshot Figure 35 AT&T: Company Snapshot Figure 36 NEC: Company Snapshot

February 16.14 "Walk to GTac's Golden Goose" Join the Health and Education Learning Project (HELP) and the Penokee Hills Education Project on a trek to the Golden Goose Red Zone. This trek will end at the GGRZ which is the Red Zone occupied by GTac operatives and designed and protected by Scott Walker and his Tea bagger devotees, Senators Tom "Taconite" Tiffany. Luther Olsen, Mike Ellis, Alberta Darling, and Bobby "Mr. Science" Cowles. THIS WINTER WALK WILL BE CONDUCTED ONLY ON LANDS OPEN TO THE PUBLIC. The walk will end at the borders of the Golden Goose Red Zone. Hopefully Cowles, Ellis, Olsen, Darling and their fearless leaders Walker and Taconite Tom will meet us at the border of their new intentional community building efforts in the Golden Goose Red Zone - Wisconsin's very own third world country. Area residents will enter the area deemed “closed to the public” by Gtac officials Wisconsin citizens working to protect the pristine environment of the Penokee Range in Northern Wisconsin from morally illegitimate mining exploration and socially unacceptable environment degradation will gather on Sunday, February 16 from 1- 3 PM to help bring public awareness to the proposed destruction of Wisconsin's natural resources. A 2 PM Press conference on Moore Park Siding, approximately 5 miles east of Mellen on Highway 77, will feature citizens who will enter the area deemed “closed to the public” by Gtac officials. Dubbed the “Hunt to Save the Golden Goose” now laying pristine golden eggs of clean water, forests, lakes, trout streams, asbestos-free air and unlimited prosperity in a growing tourist-based economy, this action will include citizens who have worked tirelessly to prevent a mine, once highlighted to be one of the world’s largest open pit mines by Gogebic Taconite, from destroying the livelihood of regional farmers, tourist-based businesses and resource harvesters. The mining project is headed by Gogebic Taconite (Gtac) Manager Bill Williams, currently under investigation for committing environmental crimes in Spain.. While pro-mining legislation prevailed in the GOP-dominated atmosphere of Tea Party politics and millions of dollars in lobbying contributions during the 2010-2012 election cycle, a wide majority of citizens in Northern Wisconsin oppose the project funded by the 18 th richest billionaire in the world, Chris Cline of Florida. Citizens from Northern Wisconsin, Iron and Ashland Counties, the Chippewa Federation and those with historic ties to the ceded territory in the Bad River Watershed, and others impacted by downstream degradation from the huge open pit operation have declared their intent to violate the alleged closing of Public Managed Forest Lands (MFL) under a special law introduced by pro-mining Senator Tom Tiffany (R-Hazelhurst). Tiffany said it was the intent of the original pro-mining, streamlined permitting process bill, known as SB-1, and written by Gogebic Taconite attorneys, to “allow degradation of the environment.” Senator Tiffany introduced further legislation to prevent citizens from monitoring mining exploration and charting sedimentation of trout streams and wetlands, reported by the public and confirmed by the Wisconsin Dept. of Natural Resources during drilling in the summer of 2013. The closure also allegedly prevents Chippewa Treaty citizens from observing and harvesting reserved resources.

Replacement of traditional light sources, such as incandescent light bulbs, by solid state light sources, such as light emitting diodes (LEDs), is often associated with a number of issues. For example, the light output provided by a LED typically has a different spectral composition than the light output of a traditional light source, for example based on an incandescent filament. Further, the spatial intensity distribution of the light output of a LED is typically different than the spatial intensity distribution of the light output provided by a traditional light source. Moreover, heat generated during operation of the LEDs may damage or deteriorate performance of the LEDs. Therefore, design of LED-based lighting devices typically involves considerations relating to heat management. WO 2010/080565A1 discloses a retrofit LED light bulb with additional features such as a backup battery, a camera, a detector/sensor, an audio device, a communication device, a camera, and/or a repeater. As LEDs are substantially smaller than incandescent and fluorescent light bulbs, there is space available in the LED light bulb for housing such extra features. The additional features are arranged within a shell behind the LEDs together with circuitry for converting line voltage into voltage suitable for the LEDs. The positioning of the extra features within the shell behind the LEDs may prevent optimal performance or operation of at least some of the extra features since input to the extra features from the surrounding environment, and/or output from the extra features to the surrounding environment, may be obstructed by the shell and the LEDs. It would be advantageous to provide alternative lighting devices which allow improved performance for at least one such additional feature without adversely affecting the optical performance of the lighting device.

Q: Why are uri chars (or at least spaces) being dropped on an html file upload? I have a file upload form and would like to use the filename on the server, however I notice that when I upload it the spaces are dropped. On the client/browser I can do something like this in an event called after the input type='file' element has changed: function process_svg (e) { var files = e.target.files || e.originalEvent.dataTransfer.files; console.log(files[0].filename); And if I upload a file with the name 'some file - type.ext' 'some file - type.ext' will be printed in the console. On the server (running bottle) however if I run: @route('/some_route') def some_route(): print(request.files['form_name_attr'].filename) I get 'somefile-type.ext.' I am guessing this has to do with uri escaping (or lack there of), but since you cannot change a file preupload how do you get around this and preserve it? Strangely I cannot find mention of this on google, in part I have had trouble thinking of appropriate search terms, but I'm also aware that this may not actually be native behaviour, but a bug elsewhere in my code. I do not think that is the case as I've issued these console.log and print statements at the end (right before the upload) and beginning (right when the server starts processing the request) and do not believe I really have any code to touch it in between, however if that is the case please let me know as I could be looking in the wrong direction. A: You want raw_filename, not filename. (Note that it may contain unsafe characters.) @route('/some_route', method='POST') def some_route(): print(request.files['form_name_attr'].filename) # "cleaned" file name print(request.files['form_name_attr'].raw_filename) # unmodified file name Found this in the source code for FileUpload.filename: Only ASCII letters, digits, dashes, underscores and dots are allowed in the final filename. Accents are removed, if possible. Whitespace is replaced by a single dash. Leading or tailing dots or dashes are removed. The filename is limited to 255 characters.

While Urawa Reds and Kawasaki Frontale battle to clinch the top seed for the J. League Championship on the final day of the regular season on Thursday, a more decisive tussle will be going on at the other end of the table. Four teams are in danger of taking the last remaining relegation place going into Thursday’s matches, with Nagoya Grampus, Albirex Niigata, Ventforet Kofu and Jubilo Iwata all striving to avoid joining already doomed Avispa Fukuoka and Shonan Bellmare in J2 next season. Grampus, one of only three clubs — along with Kashima Antlers and Yokohama F. Marinos — to have competed in J1 every season since the J. League was founded, currently occupy the final relegation spot on 30 points, with Albirex leading them only on goal difference. Ventforet are one point better off on 31, while Jubilo, currently on 33, look best placed to survive. Nothing will be decided until 3:30 p.m. on Thursday, however, and an intriguing set of fixtures makes it impossible to predict which of the four teams will go down. Nagoya, the side currently in the stickiest predicament, also has what looks like the easiest assignment, hosting a Bellmare side that has picked up only 24 points all season. Albirex face a Sanfrecce Hiroshima team that has made a mess of its J. League title defense, while Ventforet and Jubilo take on Sagan Tosu and Vegalta Sendai, respectively — both midtable teams. Wins for any of the relegation-threatened clubs is certainly a possibility, but so too is a repeat of the hapless performance that saw all four teams lose last Saturday. “I heard the results of the other games after the final whistle,” Albirex manager Koichiro Katafuchi said after his team’s 3-1 defeat to Gamba Osaka. “Fortunately, no one else managed to win — they all lost. We’re lucky that we’re in a position where it’s still in our own hands, so let’s just get ready for the next game.” Should goal difference come into play, Jubilo hold the advantage on minus-14, with Albirex on minus-15, Grampus on minus-18 and Ventforet lagging far behind on minus-25. “I was thinking about a lot of different things in the buildup to the game, but given the result, I think I got my tactics wrong,” Ventforet manager Satoru Sakuma said after Saturday’s 1-0 loss to Bellmare. For all four teams in Thursday’s final round of games, any further mistakes could prove fatal. Staging post: Urawa Reds clinched the second-stage title with a 1-0 win over Jubilo Iwata on Saturday, but the peculiarities of the current league format means the achievement brought the Saitama side absolutely no reward. Reds had already qualified for the J. League Championship by virtue of their guaranteed top-three finish in the overall table — which outranks stage wins — and captain Yuki Abe was more concerned about claiming the direct spot in the championship final that comes with finishing first. “We still have to play Yokohama F. Marinos, and each step from here on is vital,” said Abe, whose side leads Kawasaki Frontale by one point going into Thursday’s final regular-season game at home to Marinos. “It all starts from the Marinos game. We’ve won the second stage but nothing has been decided yet. All we want is a place in the championship game, and that’s what we’re striving for.” Thirteenth century: Gamba Osaka have only the Emperor’s Cup left to play for this season after missing out on the J. League Championship, but midfielder Yasuhito Endo achieved a personal landmark with his 100th career J1 goal on Saturday. Endo slotted home a penalty in Gamba’s 3-1 win over Albirex Niigata to make him the 13th player to achieve the feat and only the second midfielder, following in the footsteps of former Jubilo Iwata playmaker Toshiya Fujita. “Of course it makes me happy,” said the 36-year-old Endo. “It’s not something that many players have achieved. “If I hadn’t scored it before the end of this season, I just would have had to try for it next year. But I had chances that I didn’t take and being involved in goals is so important. I did it with a penalty, but I’m just happy that I did it.” Quotable: “I can retire without any regrets.” Sanfrecce Hiroshima’s Koji Morisaki enjoys his final home league game before hanging up his boots, after scoring in Sanfrecce’s 4-1 win over Avispa Fukuoka on Saturday.

Q: Python ternary execution order In python, if I use a ternary operator: x = a if <condition> else b Is a executed even if condition is false? Or does condition evaluate first and then goes to either a or b depending on the result? A: The condition is evaluated first, if it is False, a is not evaluated: documentation. A: It gets evaluated depending if meets the condition. For example: condition = True print(2 if condition else 1/0) #Output is 2 print((1/0, 2)[condition]) #ZeroDivisionError is raised No matter if 1/0 raise an error, is never evaluated as the condition was True on the evaluation. Sames happen in the other way: condition = False print(1/0 if condition else 2) #Output is 2

Gallium compounds, including gallium nitrate, gallium sulfate, and gallium maltolate, have been repeatedly shown to have anti-inflammatory activities when administered systemically (i.e., orally, intravenously, or by other means that introduce gallium into the bloodstream and allow for its distribution through the body). Particular efficacy for gallium has been reported in animal models of rheumatoid arthritis (Delbarre F, Rabaud M, COMPTES RENDUS DE L'ACADÉMIE DES SCIENCES, SERIES D 283:1469-1472, 1976; Matkovic V et al., CURRENT THERAPEUTIC RESEARCH 50:255-267, 1991; U.S. Pat. No. 5,175,006 to Matkovic et al.), multiple sclerosis (Whitacre C et al., JOURNAL OF NEUROIMMUNOLOGY 39:175-182, 1992), uveitis (Lobanoff M C et al., EXPERIMENTAL EYE RESEARCH 65:797-801, 1997), and Type 1 diabetes (Flynn J O et al., DIABETES 41:38A, 1992). Systemically administered gallium has also shown efficacy in the treatment of cancer and infectious disease (Bernstein L R, PHARMACOLOGICAL REVIEWS 50:665-682, 1998). Locally administered gallium is effective in treating psoriasis and related dermatologic disorders (U.S. Pat. No. 5,747,482 to Bernstein). It has now been surprisingly discovered that locally administered gallium can reduce pain, itching, allodynia, hyperalgesia, and related symptoms. Locally administered gallium is particularly effective in relieving neuropathic symptoms, especially peripheral neuropathic pain. Peripheral neuropathic pain is apparently caused by damage to peripheral neurons, and is typically characterized as “burning,” “shooting,” “stabbing,” or “electric-shock-like.” It may occur without external stimulation or, very commonly, it may be manifested as allodynia (an experience of pain from normally non-painful stimuli, such as from light touching) or hyperalgesia (an exaggerated sense of pain from a normally painful stimulation). The pain can be very intense and disabling; the pain from trigeminal neuralgia (neuropathy of the trigeminal nerve) is considered among the most severe types of pain known. At least two million adults are estimated to have neuropathic pain in the United States, with the great majority having peripheral rather than central neuropathic pain (Morely-Forster P, PAIN RESEARCH MANAGEMENT 11 Suppl A:5A-10A, 2006). Some of the most common causes of peripheral neuropathic pain are diabetes, HIV infection, postherpetic neuralgia, trigeminal neuralgia, cancer, and cancer treatments. Numerous other causes of peripheral neuropathic pain are also known, including trauma, non-HIV infections, drugs, toxins, surgery, and complex regional pain syndrome (also called causalgia or reflex sympathetic dystrophy syndrome). The etiology for many cases of peripheral neuropathic pain is never discovered. Some of the common causes of peripheral neuropathic pain are summarized below. Painful diabetic neuropathy: Diabetes afflicts about 21 million people in the United States (National Institute of Diabetes and Digestive and Kidney Diseases, NATIONAL DIABETES STATISTICS FACT SHEET: GENERAL INFORMATION AND NATIONAL ESTIMATES ON DIABETES IN THE UNITED STATES, 2005) and nearly 200 million people worldwide (Wild S et al., DIABETES CARE 27:1047-1053, 2004). Painful diabetic neuropathy is estimated to affect approximately 20-24% of diabetics, with pain being defined as a recording by the patient of at least 10 mm on a 100 mm visual analog pain scale (Schmader K E, THE CLINICAL JOURNAL OF PAIN 18:350-354, 2002). The pain occurs most commonly in the extremities. Cancer and cancer-associated iatrogenic neuropathic pain: Neuropathic pain is estimated to afflict about a third of cancer patients (Davis M P, Walsh D, AMERICAN JOURNAL OF HOSPICE PALLIATIVE CARE 21:137-142, 2004). In most cases the neuropathic pain is due to tumor tissue infiltrating or pressing on neurons, with other causes including nerve damage caused by surgery, chemotherapy, or radiotherapy. Treatments for breast cancer are particularly likely to cause neuropathic pain: nearly 50% of patients experience chronic pain following surgery for breast cancer, with most of the pain being neuropathic (Morely-Forster P, PAIN RESEARCH MANAGEMENT 11 Suppl A:5A-10A, 2006). HIV-infection related neuropathic pain: Neuropathic pain, generally due to distal sensory polyneuropathy, is estimated to afflict at least a third of those infected with HIV (Luciano C A et al., CURRENT OPINION IN NEUROLOGY 16:403-409, 2003). The cause is not always known, but may be due to HIV infection of neurons, the release of neurotoxins by macrophages, toxic reactions to drugs, opportunistic infections, or nutrient deficiencies. Neuropathic pain associated with HIV infection appears to be an under-recognized and under-treated condition. Postherpetic neuralgia: Herpes zoster infection (shingles) is estimated to strike about 800,000 people each year in the United States (Schmader K E, THE CLINICAL JOURNAL OF PAIN 18:350-354, 2002). Pain associated with shingles is itself neuropathic, at least in part. The incidence of subsequent postherpetic neuralgia (nearly always a peripheral neuropathy) is directly correlated with age and with the severity of the herpetic rash. For herpes zoster patients over 50 years old (the great majority of herpes zoster patients), postherpetic neuralgia occurs in 50-68% one month after rash healing, in 25-50% three months after rash healing, and in 15-35% six months after rash healing (the lower numbers being for those treated with antiviral drugs) (Schmader K E, THE CLINICAL JOURNAL OF PAIN 18:350-354, 2002). Peripheral neuropathic pain is clearly a widespread medical problem, occurring in millions of people worldwide, resulting from a wide range of causes. Current Treatments For Peripheral Neuropathic Pain Current preferred therapies for peripheral neuropathic pain include systemic antidepressants (particularly tricyclic antidepressants), anticonvulsants (including carbamazepine and gabapentin), opioid analgesics (including oxycodone, methadone, and dextromethorphan), and topical lidocaine and capsaicin. Few of these treatments produce even moderate pain relief for half the patients receiving them. Antidepressants: Antidepressants are commonly the first choice for treating neuropathic pain. A recent survey of the literature (Saarto T, Wiffen P J, THE COCHRANE DATABASE OF SYSTEMATIC REVIEWS 2005(3):CD005454, 2005) found that tricyclic antidepressants were the most effective, with amitriptyline being particularly effective. Amitriptyline, however, had an NNT (number needed to treat) value of 2 for moderate pain relief (that is, only 50% of those treated had at least moderate pain relief). In general, moderate pain relief for peripheral neuropathic pain was produced by tricyclic antidepressants in about 33-50% of patients, by serotonin noradrenaline reuptake inhibitors in about 20-25% of patients, and by selective serotonin reuptake inhibitors in about 14% of patients (Sindrup S H et al., BASIC & CLINICAL PHARMACOLOGY & TOXICOLOGY 96:399-409, 2005). Anticonvulsants: A number of anticonvulsants have been administered for the treatment of peripheral neuropathic pain, with gabapentin, carbamazepine, and phenytoin appearing to be the most effective. Again, however, the efficacy rates are fairly low. For moderate pain relief, gabapentin had an NNT of 3.2 in postherpetic neuralgia; in painful diabetic neuropathy it had an NNT of 3.8, while carbamazepine had an NNT of 2.3 and phenytoin had an NNT of 2.1 (Wiffen P et al., THE COCHRANE DATABASE OF SYSTEMATIC REVIEWS 2005 (3):CD001133, 2005). Other tested anticonvulsants appeared to be less effective. It is noted that anticonvulsants, as tricyclic antidepressants, frequently produce significant adverse effects in patients. Opioid analgesics: A recent meta-analysis of the efficacy and safety of opioid agonists in the treatment of non-malignant neuropathic pain showed marginal to no efficacy in short-term (24 hour) studies, and marginal efficacy in intermediate-term (8-56 day) studies (Eisenberg E et al., JAMA 293:3043-3052, 2005). The drugs studied were morphine, oxycodone, methadone, and levorphanol. A study of levorphanol found that patients with postherpetic neuralgia had an average 14% reduction in pain with a low dose, and a 33% reduction with a high dose, though 31% of the subjects dropped out of the study due to drug side effects (Rowbotham M C et al., NEW ENGLAND JOURNAL OF MEDICINE 348:1223-1232, 2003). All the opioid drugs commonly produced significant but non-life-threatening adverse effects. Topical lidocaine: A topically applied patch containing 5% lidocaine is commonly used to treat localized peripheral neuropathic pain. Clinical studies have shown that this treatment results in modest reductions of pain for many patients (e.g., Argoff C E et al., CURRENT MEDICAL RESEARCH AND OPINION 20 Suppl 2:S21-S28, 2004). One controlled study found an NNT of 2 in postherpetic neuralgia (Hempenstall K et al., PLoS MEDICINE 2:e164, 2005). To remain effective, the patches must be changed several times per day. The patches cause numbness of the contacted skin, and commonly cause skin irritation, and usually do not relieve severe pain. Topical capsaicin: An analysis of two studies on the use of topical capsaicin cream to treat postherpetic neuralgia found a low efficacy rate, with an NNT value of 3.26 (Hempenstall K et al., PLoS MEDICINE 2:e164, 2005). It is noted that placebo-controlled studies with capsaicin are compromised due to the clearly noticeable sensations (including pain) produced in the skin by capsaicin; thus, perceived efficacy of capsaicin may benefit from a placebo effect. Many other systemic and local treatments are used in attempts to relieve peripheral neuropathic pain, generally with no more than moderate success. Recently, subcutaneously injected botulinum-A toxin has been tried in a small number of patients with trigeminal neuralgia (Piovesan E J et al., NEUROLOGY 66:1458-1459, 2006) and in a single patient with postherpetic neuralgia (Liu H T et al., PAIN MEDICINE 7:89-91, 2006). The patient with postherpetic neuralgia reported pain relief for several weeks after numerous injections, followed by a recurrence of pain at pre-treatment levels. The patients with trigeminal neuralgia reported transient low to moderate pain relief following multiple injections, with side effects including muscle weakness. It is thus apparent that currently available treatments for peripheral neuropathic pain have only low to moderate efficacy, and many patients are left without significant pain relief. The lack of adequate pain relief for millions of people with peripheral neuropathic pain, as well as for those with other types of pain, represents a great unmet medical need.

Click on a zone to explore Select any of the 9 available zones from the house or the navigation above. RESIDENTIAL COMFORT GROUP (RCG) "Complete HVAC Solutions" Mestek's Residential Comfort Group (RCG) is the result of over 150 years of hydronic and HVAC heating experience. Comprised of 9 industry leading heating and air conditioning companies, RCG provides the solution for all of your heating and central air conditioning needs. Take the tour through our interactive house to find the answer to all your heating, cooling and even snow melt needs.

Factors influencing the formation of methemoglobin in desferrioxamine loaded erythrocytes. Desferrioxamine (DFO) in therapeutically useful amounts was incorporated into red blood cells (RBC) by means of a dialysis method. Entrapped DFO interacted with hemoglobin which was indicated by the formation of methemoglobin. This process was influenced to a great extent by the duration and temperature of the incubation steps. In contrast to added methylene blue the co-entrapment of ascorbic acid proved to be a very effective measure for protecting hemoglobin from oxidation and maintaining intracellular 2,3-diphosphoglycerate (2,3-DPG). Hypernormal values of 2,3-DPG could be obtained by the incubation in solutions containing phosphate, inosine, and pyruvate. Loaded RBC prepared in such a way should be characterized by a nearly normal oxygen-transport function and survival in vivo.

Sweeping criminal justice reform goes into effect in three months, and some local district attorneys are sharing concerns on social media. &amp;amp;amp;amp;amp;amp;amp;nbsp; Starting in January, judges across New York will have less discretion when a defendant first appears. There's no more cash bail for most misdemeanor and nonviolent felony arrests. The list includes criminally negligent homicide and unlawful imprisonment. If you're accused of one of those crimes you'll be issued an appearance ticket. The expectation is you'll go back to court for your next court date instead of possibly sitting and waiting in jail. "We shouldn't be locking people up just because they can’t afford to pay the bail when they are legally presumed innocent by the US constitution," said Emily Singletary, the co-founder and co-executive director of Unchained. Bail was intended as collateral to make sure people showed up at their court dates. Advocates say it disproportionately penalizes minorities and poor people. "The attorneys and the judges who are making these bail arguments, they could afford $2500 bail,” said Singletary. “It doesn't occur to them that, you know, a lot of the people that they're dealing with in court, nobody in their entire social network could come up with that." Gov. Andrew Cuomo says the changes mean 90 percent of people arrested and charged, but not yet convicted of a crime, will stay out of jail. Onondaga County District Attorney Bill Fitzpatrick says this could jeopardize public safety. Judges will not be able to consider a defendant's history. “The person who is going to be assaulted or killed by someone out on bail who any under normal, sane set of regulations would've been held pending trial,” said Fitzpatrick. “That's my biggest fear." The new laws don't eliminate bail all together. For cases where bail is acceptable, the new law requires multiple forms of bail to be set. That means the court could include credit cards or allow your family to help pay. The changes will not be retroactive. The criminal justice reforms also touch on enforcing trial deadlines and sharing evidence.

Clothing store adds 2nd location Vert & Vogue opening second shop: Vert & Vogue, the clothing boutique in Brightleaf Square, is opening a second location in downtown’s Five Points. According to property records, it looks like the new location is at 353 W. Main St. That appears to be the location that previously housed the downtown bar and lounge The Republic, which has closed permanently, according to the business’ Facebook page. In their second shop, the owners of Vert and Vogue plan to sell clothing for women and men as well as accessories, according to the shop’s Facebook page. *** Los Comales closed: The N.C. Department of Revenue has shut down the popular Los Comales restaurant locations in Durham because of unpaid taxes. Both of the Los Comales restaurant locations – one on North Roxboro Street and one on Witherspoon Boulevard -- were shut down on Wednesday, said Trevor Johnson, a spokesman for the revenue department. A sign was on the door of the North Roxboro Street location Monday stated that the restaurant’s personal property was seized for nonpayment of taxes. Johnson said department officials are expected to take the property to auction to pay the debt. The business had only recently opened its second location on Witherspoon Boulevard. And last year, it was one of the stops suggested in New York Times article “36 Hours in Durham, N.C.” However, Johnson said in an email that the business owed about $185,000 to the state. “Shutting down businesses is the last resort,” he said. “We work with the taxpayer(s) to make sure they are aware and understand what they are owed to the department.” Johnson said in some cases, businesses that have been shut down by the department are able to re-open if they can pay their debt. Attempts to reach the restaurant owner for comment Monday were not successful. *** Tour de Fat returning: New Belgium Brewing Co.’s 2014 Tour de Fat beer and bicycling tour will return to Durham at Diamond View Park on June 21. These daylong festivities are free in every city, but the proceeds from beer sales go to local nonprofits. The events kick off with a costumed bicycle parade that winds through city streets, ending in a city park with the festival. This year will also include some brewing education and feature a “Bicycle Revival” to inspire festival-goers to believe in the power of two-wheeled transportation. Have an item for The Buzz? Contact Laura Oleniacz at [email protected], or at 919-419-6636.

68 B.R. 604 (1986) In re Samuel SHARIYF, a/k/a Samuel Smith, Debtor-Appellant. Bankruptcy No. 86-00482K, Civ. A. No. 86-3042. United States District Court, E.D. Pennsylvania. December 16, 1986. *605 Gloria M. Gilman, Philadelphia, Pa., for debtor-appellant. Sheldon Jelin, Philadelphia, Pa., for Federal Nat. Mortg. Ass'n. *606 MEMORANDUM AND ORDER JAMES McGIRR KELLY, District Judge. This is an appeal from the order dated April 2, 1986, issued by United States Bankruptcy Judge William A. King, Jr. In this order, Judge King granted the appellee, Federal National Mortgage Association's (FNMA), motion, pursuant to 11 U.S.C. § 362(d), to modify the automatic stay of all judicial, administrative or other proceedings against the debtor and appellant, Samuel Shariyf. FNMA is the holder of a mortgage on the appellant's residence located at 7810 Williams Avenue, Philadelphia, Pennsylvania. Appellee's Brief at 3. In October of 1983, FNMA instituted an action in mortgage foreclosure against Mr. Shariyf for failure to make payments due on the mortgage. On June 24, 1985, seven days before his house was scheduled to be auctioned off at a sheriff's sale, Mr. Shariyf filed a petition under Chapter 13 of the Bankruptcy Code. Id. This filing resulted in the automatic stay of the foreclosure proceedings pursuant to 11 U.S.C. § 362(a). In accordance with standard bankruptcy practice a reorganization plan was formulated. The trustee in bankruptcy, James J. O'Connell, however, recommended dismissal of the bankruptcy action in light of the fact that "[p]ayments provided for by the (bankruptcy) plan are not being made", Standing Trustee's Motion for Dismissal at 1, and the fact that the "plan does not appear feasible." Id. Judge King, on December 12, 1985, granted this motion and dismissed Mr. Shariyf's bankruptcy action. Mr. Shariyf, however, on January 31, 1986, filed a second Chapter 13 bankruptcy petition resulting in a second automatic stay of foreclosure proceedings. On February 26, 1986, FNMA filed a motion, pursuant to 11 U.S.C. § 362(d),[1] to modify this automatic stay of proceedings. FNMA alleged that the appellant had violated § 109(f)[2] of the Bankruptcy Code and requested the Bankruptcy Court "to grant relief from the stay of proceedings for cause." Appellee's Motion to Modify the Stay of Proceedings Under Section 362(d) at 2. Judge King granted this motion, vacated the stay and permitted FNMA to proceed with the foreclosure action. This decision by Judge King has now been appealed to this court by Mr. Shariyf in accordance with 28 U.S.C. § 158(a). Mr. Shariyf alleges that Judge King's order dated April 2, 1986, should be reversed since: (1) the moving party (FNMA) failed to meet its burden to show cause for relief from the automatic stay, (2) the bankruptcy court erred by not receiving evidence and thereby making findings of fact, and (3) a violation of § 109(f) does not empower a bankruptcy court to modify the § 362(a) automatic stay. Appellant's Brief at 2. Before discussing each of these allegations of error it is important to note our scope of review in this matter. Since § 362(d) "commits the decision of whether to lift the stay to the discretion of the bankruptcy judge, his decision may be overturned only upon a showing of abuse of discretion." Matter of Holtkamp, 669 F.2d 505 (7th Cir.1982) (emphasis added). "Discretion, . . . is abused when the judicial action is arbitrary, fanciful or unreasonable, which is another way of saying that discretion is abused only where no reasonable man would take the view adopted *607 by the trial court. If reasonable men could differ as to the propriety of the action taken by the trial court, then it cannot be said that the trial court abused its discretion." Lindy Bros. Builders, Inc. v. Am. Radiator, etc., 540 F.2d 102, 115 (3d Cir.1976) (quoting Delno v. Market St. Ry., 124 F.2d 965, 967 (9th Cir.1942) (emphasis added). As noted above FNMA in its motion for modification of the automatic stay alleged that Mr. Shariyf violated § 109(f) of the Bankruptcy Code and that this violation constituted "cause" justifying modification of the stay under § 362(d). Appellant Shariyf, however, alleges on appeal that FNMA did not establish that Mr. Shariyf acted with a "fraudulent intent" which is required for a violation of § 109(f) to be found. This allegation is without merit. The appellant incorrectly assumes that Judge King granted the modification of the stay after concluding that the appellant had violated § 109(f). For the following reasons I find that Judge King found "cause" to vacate the automatic stay under § 362(d) not because § 109(f) was violated, but rather because appellant unintentionally failed to comply with the bankruptcy procedures which resulted in numerous delays in the proceedings. Section 109(f) calls for (1) the dismissal of a debtor in a bankruptcy action if a court concludes (2) that the debtor has willfully violated a court order. See supra note 2. Judge King, however, did not dismiss appellant's bankruptcy action but merely vacated the automatic stay of proceedings. Furthermore, Judge King in concluding that "cause" existed found that appellant Shariyf was not acting with fraudulent intent. More specifically Judge King stated: It seems to me that there is some cause here. Cause is not defined in 362, but it seems to me that where you have a debtor who certainly is struggling and trying to do the best he can in the situation, files, dismisses, and re-files, he is the gainer and the mortgage company is the loser. They are caught in this filing, no filing, and they are not getting paid, apparently. Transcript of Hearing on Motion for Modification of the Automatic Stay at 8, 9 (emphasis added). Judge King also made no mention of a violation of § 109(f) in the order vacating the automatic stay.[3] For these reasons I conclude that Judge King's finding of "cause" was based on Mr. Shariyf's unintentional noncompliance with the prior bankruptcy proceedings and not on a violation of § 109(f). To reverse the order modifying the stay, I must find that Judge King abused his discretion in making this decision. Bankruptcy courts presented with similar factual situations have both permitted modification or vacation of the stay and have also denied requests for a modification or vacation of the automatic stay. In In re Three Tuns, Inc., 35 B.R. 110 (Bkrtcy.1983), a motion for relief from the automatic stay was filed with the court. The petitioner in support of this motion established that the debtor had failed to make periodic payments on a $400,000 mortgage for over nineteen months. Judge Goldhaber, noting this failure to make payments, granted petitioner relief from the automatic stay. In our present case appellant Shariyf, before he filed for bankruptcy, had allegedly failed to make mortgage payments to the appellee for over two years. Appellee's Brief at 7. In In re Mannings, 47 B.R. 318 (Bkrtcy. 1985), a motion for modification of the automatic stay was denied by Judge Eisen even though the debtor had failed to make payments in accordance with the bankruptcy plan. Judge Eisen concluded that the debtors' allegations that circumstances which had prevented them from making payments under the plan had changed, warranted *608 denial of the motion to modify the stay. Finally, in In re Frascatore, 33 B.R. 687 (Bkrtcy.1983), Judge Goldhaber granted a motion to modify an automatic stay permitting foreclosure proceedings to go forward. Judge Goldhaber based his decision on the fact that the debtor had made only two mortgage payments in the last eleven months. In light of these various decisions, it does appear that reasonable men could differ as to the propriety of granting a modification to the automatic stay in the instant case. Therefore, it cannot be said that reasonable men would not take the position adopted by Judge King. In light of the applicable scope of review discussed above, I find that Judge King did not abuse his discretion in finding that appellant's unintentional noncompliance with the prior bankruptcy proceedings constituted "cause" under § 362(d). Appellant Shariyf next alleges that the bankruptcy court acted improperly by granting FNMA's motion to modify the automatic stay without considering evidence offered by the appellant and without making findings of fact. More specifically appellant alleges that Judge King violated Bankruptcy Rule 7052 which makes Fed.R. Civ.P. 52 applicable in all adversarial proceedings.[4] This allegation is without merit. Bankruptcy Rule 7001 defines the term, adversary proceeding, in significant detail but it fails to mention a hearing held to analyze the merits of a motion for modification of an automatic stay.[5] Furthermore, § 362(e) of the Bankruptcy Code mandates that a hearing be held whenever a § 362(d) motion is made. Judge King fully complied with this mandate by holding a hearing on this matter on April 2, 1986. I find that the court was not required to make findings of fact since the hearing held before Judge King was not an adversary proceeding as defined in Rule 7001. Furthermore, even if it had been considered an adversary proceeding, the hearing held before Judge King and his oral conclusions stated at that time satisfied Fed.R.Civ.P. 52(a) and § 362(e) of the Bankruptcy Code. Finally, appellant Shariyf alleges that the modification of an automatic stay is an improper remedy for violation of § 109(f). Mr. Shariyf argues that a violation of § 109 precludes one from being a debtor in a bankruptcy proceeding but does not, however, empower a bankruptcy court to modify an automatic stay. This reasoning, although possibly correct, is irrelevant. I have already determined that Judge King did not base his decision to vacate the automatic stay on a finding of a violation of § 109(f). For the above reasons, appellant Shariyf's appeal from the bankruptcy court's order dated April 2, 1986 is dismissed. NOTES [1] 11 U.S.C. § 362(d) provides in pertinent part: (d) On request of a party in interest and after notice and a hearing, the court shall grant relief from the stay provided under subsection (a) of this section, such as terminating, annulling, modifying, or conditioning such stay — (1) for cause, including the lack of adequate protection of an interest in property of such party in interest. Id. (emphasis added). [2] 11 U.S.C. § 109(f) provides in pertinent part: No individual may be a debtor under this title who has been a debtor in a case pending under this title at any time in the preceding 180 days if (1) the case was dismissed by the court for willful failure of the debtor to abide by Orders of the court. . . . Id. (emphasis added). [3] Judge King did discuss dismissing the case for a violation of § 109 but realized that this would further delay the proceedings. Transcript of Hearing on Motion to Modify Automatic Stay at 4. [4] Fed.R.Civ.P. 52 provides in pertinent part: (a) Effect. In all actions tried upon the facts without a jury or with an advisory jury, the court shall find the facts specially and state separately its conclusions of law thereon * * * * * * It will be sufficient if the findings of fact and conclusions of law are stated orally and recorded in open court following the close of the evidence or appear in an opinion or memorandum of decision filed by the court. Id. (emphasis added). [5] Specifically Rule 7001 states: An adversary proceeding is. . . . [a] proceeding in a bankruptcy court (1) to recover money or property, except a proceeding under § 554(b) or § 725 of the Code, Rule 2017, or Rule 6002, (2) to determine the validity, priority, or extent of a lien or other interest in property, other than a proceeding under Rule 4003(d), (3) to obtain approval pursuant to § 363(h) for the sale of both the interest of the estate and of a co-owner in the property, (4) to object to or revoke a discharge, (5) to revoke an order of confirmation of a chapter 11 or chapter 13 plan, (6) to determine the dischargeability of a debt, (7) to obtain an injunction or other equitable relief, (8) to subordinate any allowed claim or interest, except when subordination is provided in chapter 9, 11, or 13 plan, (9) to obtain a declaratory judgment relating to any of the foregoing, or (10) to determine a claim or cause of action removed to a bankruptcy court.

2009 - Sea Level Rise Research Summary (last update 4/2013) How to reconcile the strict limitations of scientific method with reasonable expectations based on probability and risk have confounded the human-caused global warming (AGW) argument. The reality is sea level will rise. However, there are other oceanic forces that will have economic consequences prior to major sea level rise. Storm strength, droughts, flooding, crop yields and thermal limits are also important considerations. Note: Tad Pfeffer has responded in an update to this report on September 15th regarding SLR above 5 meters: "...we believe it is reasonable to ponder very high rates of SLR in the next century. However, we also believe that it is problematic to project such a ‘hypothesis’ as a supported theory without proper testing by the scientific method." Contents Sea level rise since the last glacial episode. Image courtesy of Exploring the Submerged New World 2009 Expedition, Robert A. Rohde, Global Warming Art, NOAA-OER. This report addresses reasonable assumptions based on what is well understood and therefore addresses that which has a reasonable potential of occurrence. The response mechanisms are considered to be possibly non linear in nature and the paleo records indicate that hypothesized negative feedback mechanisms have not halted past warmings. A reasonable conclusion leans toward the likelihood of sea level rise above the AR4 estimations but also likely less than extreme scenarios of 5 meters SLR by 2100. This paper is a summary of the science combined with reasonable potentials that may be derived from the current understanding of climate system response. Understanding influences on Sea Level Rise: Global sea-level rise is the average increase in the level of the world’s oceans that occurs due to a variety of factors, the most significant being thermal expansion of the oceans and the addition of water by melting of land-based ice sheets, ice caps, and glaciers. Relative sea-level rise refers to the change in sea level relative to the elevation of the adjacent land, which can also subside or rise due to natural and even some human-induced factors which may alter coastal deposition of land based silt. Relative sea-level changes include both global sea-level rise and changes in the vertical elevation of the land surface. Land Subsidence' refers to to land lowering in elevation due to subsurface water or oil extraction. Rebounding refers to land rising due to decreased pressure that can be caused by ice melt or glacial retreat. Tectonic activity refers to land rise or fall due to tectonic movement. Is the rate of sea level rise accelerating? The IPCC expresses high confidence that the rate of observed sea level rise increased from the mid 19th to the mid 20th century. During the 20th century, sea level rose at an average rate of 4.8 to 8.8 inches per century (1.2-2.2 mm/year). (IPCC, 2007) Tide gauges show little or no acceleration during the 20th century. Satellite measurements estimate that sea level has been rising at a rate of 9 to 15 inches per century (2.4-3.8 mm/yr) since 1993, more than 50% faster than the rate that tide gauges estimate over the last century. (IPCC, 2007) SUMMARY What we know. Sea level will rise (reasonable confidence on 1-2 meters by 2100). The most immediate ocean based risk is likely to derive from storm damage cased by stronger storms and related flooding. Sea level will likely increase economic stressors in the coming century. The costs to coastal infrastructure will add to the overall economic stressors from other areas that are expected to be inter-dynamically connected to climate change. What we don't know. The speed of rise based on apparently accelerating positive feedbacks in the climate system. How much faster? The amount of sea level rise by 2100 has reasonable potential to be higher than currently estimated in the AR4 report. How much higher? The climate sensitivity may be higher than models currently indicate. How much higher? Sea Level Rise (SLR) Estimations As scientific awareness increased regarding global warming in the 70's and 80's additional funds were committed to learning more about our environment, its functions, and what influences climate. What affects sea level rise. Thermal expansion: It is estimated that up to half of the sea level rise is attributable to thermal expansion. As the ocean warms, it expands, thus increasing sea level. Ocean temperature continuing to increase. [in 2006 there was data suggesting that the oceans began to cool. It was later found the trend was continuing to warm (view NASA review of the analysis)] Ice melt from Arctic and glacial sources are already contributing to about half of the sea level rise. Antarctica is likely to begin contributing more in the future. But when is not yet strongly known. Scientifically Scientifically, this question can not be answered with any strong degree of confidence beyond the empirical understanding. That does not mean the question can not be addressed with methods of reasoning based on evidence and understanding of climate forcings and dynamics. Problems The problem with realistically assessing SLR is that key factors still need to be better understood. That which is unknown by science is not included, which tends to result in a potentially unrealistically conservative scientific view. Therefore the scientific analysis of SLR may yield conservative estimates of mostly linear processes and a potentially more realistic projection 'may' be less scientific and more considerate of probabilities while containing a wider range of uncertainty. So reality, or what will happen, is not as well understood in certain areas of the analysis. Science measures and then estimates. In the case of realistically estimating SLR, prescience is required in order to understand reasonably likely potentials. At the same time, guessing is not science. This is better understood in in risk analysis more like that used to model insurance actuary tables. Weighing the risk probability to economic loss potentials gives us a better way to consider relevance and uncertainty regarding seal level rise. The Problem of Understanding Projections Dr. Gavin Schmidt: “People don't seem to embrace global measures of temperature rise (~0.2ºC/decade) or sea level rise (> 3mm/yr) very strongly. They much prefer more iconic signs - The National Park formerly-known-as-Glacier, No-snows of Kilimanjaro, Frost Fairs on the Thames etc. As has been discussed here on many occasions, any single example often has any number of complicating factors, but seen as part of a pattern (Kilimanjaro as an example of the other receding tropical glaciers), they can be useful for making a general point. However, the use of an icon as an example of change runs into difficulty if it is then interpreted to be proof of that change.” Dr. Gavin Schmidt: “With respect to sea level, the Thames Barrier is a concrete example that has been frequently raised.” Dr. Gavin Schmidt: “The trends in its 'raising' have been linked to increasing sea levels and storm surges. But how often is it being raised? why? and does it give us any real insight into sea level rises on a wider basis? Looking into it, I was fortunate to get an exceptionally comprehensive set of data on the closings and reasons for them from Anthony Hammond at the Environment Agency in the UK. The results are interesting, but complicated….” Dr. Gavin Schmidt: “It is clear there has been a strong upswing in closings over time. The last year alone there were almost 3 times as many closing as during the first 5 years of operation put together. The three-year running mean is possibly a little clearer, showing two definite periods of more frequent closings, 1992 to 1995 and 2002 to the present.” Dr. Gavin Schmidt: “Is this a sign of increased sea level, increased storminess, increased river flow, or changes in river management policy? As always, local factors in short records are important. Over the two and half decades of barrier operation, understanding of the Thames river hydrology has grown and models are now more accurate than they used to be, allowing for more precision in decisions to raise the barrier. The decisions depend on three main factors, the river flow at Teddington (which is where the first weir is), the forecast high tide and the (more uncertain) accompanying surge. Thus if the river flow is strong, an unexceptional high tide could cause problems, while even an exceptional tide might not if the river is particularly low. In the data, closings are distinguished by whether they are due to tidal issues, or to the combined effect of tides and high river flow (fluvial), but there is not necessarily a clean distinction.” NCDC (National Climate Data Center) The GHG (Greenhouse Gas) Change Rate The GHG change rate weighed against the natural cycle, as observed from the paleo record, is estimated at between 7,000 and 14,000 times the natural variability rate so we are in unprecedented territory, therefore using paleo records to predict SLR rise rates fails. We are in new territory. The IPCC estimates are the most conservative and do not include the non linear response mechanisms already perceptible in the observations, but not verifiable due to a lack of comparative data. This is due to the first problem above that we are in new territory and therefore can not compare existing changes with high validity, to the paleo record as understood. The sea level rise rate has accelerated as expected. Each climate tipping point may or is expected to further increase the rate of sea level rise. TIPPING POINTS: Tipping Points Report Source: A group of US, British and German climate scientists compiled a report the the National Academy of Sciences describing the problems associated with expected tipping points. The tipping points will affect major aspects of accelerated climate change as well as ecosystems. Highly sensitive, smallest uncertainty Greenland Ice Sheet (more than 300 years): "Warming over the ice sheet accelerates ice loss from outlet glaciers and lowers ice altitude at the periphery, which further increases surface temperature ... The exact tipping point for disintegration of the ice sheet is unknown, since current models cannot capture the observed dynamic deglaciation processes accurately. But in a worst case scenario local warming of more than three degrees Celsius could cause the ice sheet to disappear within 300 years. This would result in a rise of sea level of up to seven meters." Arctic sea-ice (approximately 10 years): The National Snow and Ice Data Center has revised their estimates recently to 5-7 years. Current trends indicate 4-5 years the north pole will be ice free in summer. "As sea-ice melts, it exposes a much darker ocean surface, which absorbs more radiation than white sea-ice so that the warming is amplified. This causes more rapid melting in summer and decreases ice formation in winter. Over the last 16 years ice cover during summer declined markedly. The critical threshold global mean warming may be between 0.5 to 2 degrees Celsius, but could already have been passed. One model shows a nonlinear transition to a potential new stable state with no arctic sea-ice during summer within a few decades." Intermediately sensitive, large uncertainty West Antarctic Ice Sheet (more than 300 years): "Recent gravity measurements suggest that the ice sheet is losing mass. Since most of the ice sheet is grounded below sea level the intrusion of ocean water could destabilize it. The tipping point could be reached with a local warming of five to eight degrees Celsius in summer. A worst case scenario shows the ice sheet could collapse within 300 years, possibly raising sea level by as much as five meters." Boreal forest (approximately 50 years): "The northern forests exhibit a complex interplay between tree physiology, permafrost and fire. A global mean warming of three to five degrees Celsius could lead to large-scale dieback of the boreal forests within 50 years. Under climate change the trees would be exposed to increasing water stress and peak summer heat and would be more vulnerable to diseases. Temperate tree species will remain excluded due to frost damage in still very cold winters." Amazon rainforest (approximately 50 years): Current reports indicate the loss of the rainforest within 20-30 years. The region is expected to convert to a Savannah like ecosystem. "Global warming and deforestation will probably reduce rainfall in the region by up to 30 percent. Lengthening of the dry season, and increases in summer temperatures would make it difficult for the forest to re-establish. Models project dieback of the Amazon rainforest to occur under three to four degrees Celsius global warming within fifty years. Even land-use change alone could potentially bring forest cover to a critical threshold." El Niño Southern Oscillation (approximately 100 years): The 1998 El Nino event was the strongest in history. Since the climate system is warming the amplitude will be increased by virtue of the fact it is occurring on a stronger trendline. "The variability of this ocean-atmosphere mode is controlled by the layering of water of different temperatures in the Pacific Ocean and the temperature gradient across the equator. During the globally three degrees Celsius warmer early Pliocene ENSO may have been suppressed in favor of persistent El Niño or La Niña conditions. In response to a warmer stabilized climate, the most realistic models simulate increased El Niño amplitude with no clear change in frequency." Africa rainfall (approximately 10 years): "The amount of rainfall is closely related to vegetation climate feedback and sea surface temperatures of the Atlantic Ocean. Greenhouse gas forcing is expected to increase Sahel rainfall. But a global mean warming of three to five degrees Celsius could cause a collapse of the West African monsoon. This could lead either to drying of the Sahel or to wetting due to increased inflow from the West. A third scenario shows a possible doubling of anomalously dry years by the end of the century." Indian summer monsoon (approximately 1 year): The National Climate Data Center is already reporting that observations indicate this is now occurring. "The monsoon circulation is driven by a land-to-ocean pressure gradient. Greenhouse warming tends to strengthen the monsoon since warmer air can carry more water. Air pollution and land-use that increases the reflection of sunlight tend to weaken it. The Indian summer monsoon could become erratic and in the worst case start to chaotically change between an active and a weak phase within a few years." Lowly sensitive, intermediate uncertainty Atlantic thermohaline circulation (approximately 100 years): NASA has released a report showing that the thermohaline circulation is showing signs of slowing, but trend analysis is still preliminary. "The circulation of sea currents in the Atlantic Ocean is driven by seawater that flows to the North Atlantic, cools and sinks at high latitudes. If the inflow of freshwater increases, e.g. from rivers or melting glaciers, or the seawater is warmed, its density would decrease. A global mean warming of three to five degrees Celsius could push the element past the tipping point so that deep water formation stops. Under these conditions the North Atlantic current would be disrupted, sea level in the North Atlantic region would rise and the tropical rain belt would be shifted." END MSNBC REPORT Tipping Point Indicators The National Climate Data Center has been tracking increased intensity in global climate related events. These events are considered anomalies. By tracking significant anomalies we are better able to establish trends in climate change related to the current global warming event. Additional Uncertainty in Estimating Sea Level Rise Calculating potential SLR is extremely complex and there are significant uncertainties. Professor Stephan Ramstorf: “Although a full physical understanding of sea-level rise is lacking, the uncertainty in future sea-level rise is probably larger than previously estimated. A rise of over 1 m by 2100 for strong warming scenarios cannot be ruled out, because all that such a rise would require is that the linear relation of the rate of sea-level rise and temperature, which was found to be valid in the 20th century, remains valid in the 21st century. On the other hand, very low sea-level rise values as reported in the IPCC TAR now appear rather implausible in the light of the observational data.” Sea Level Rise JPL Sea Level Satellite Measurement Reports Satellites are now used to measure sea level as well as standard measurement techniques. The Jet Propulsion Laboratory has set up a page to track global climate change. On the key indicators page you can see the changes between the sea level rise rates of 1880-1990 and the right chart showing 1993 to present. JPL Sea Level Rise The rate of sea level rise has increased from an estimated 2mm per year to and estimated 3.4 mm per year. In consideration of known forcings and current understanding of feedback mechanisms it is estimated that this rate shall continue to increase as climate forcing increases and feedback mechanisms come into play. SLR is estimated to have risen at least 6 inches since 1880 SLR is estimated to have risen at least 2 inches since 1990 At the current rate we have seen a 50mm (5 cm)sea level rise since 1992. The current rate is 3.4 cm per decade. The Case For at least 59cm SLR (About 2 Feet) SCIENTIFIC ANALYSIS – Confidence = High The IPCC Sea Level Numbers Professor Stephan Ramstorf: The sea level rise numbers published in the new IPCC report (the Fourth Assessment Report, AR4) have already caused considerable confusion. Many media articles and weblogs suggested there is good news on the sea level issue, with future sea level rise expected to be a lot less compared to the previous IPCC report (the Third Assessment Report, TAR). Some articles reported that IPCC had reduced its sea level projection from 88 cm to 59 cm (35 inches to 23 inches) , some even said it was reduced from 88 cm to 43 cm (17 inches), and there were several other versions as well (see "Broad Irony"). These statements are not correct and the new range up to 59 cm is not the full story. IPCC AR4 2007: Models used to date do not include uncertainties in climate-carbon cycle feedback nor do they include the full effects of changes in ice sheet flow, because a basis in published literature is lacking. The projections include a contribution due to increased ice flow from Greenland and Antarctica at the rates observed for 1993-2003, but these flow rates could increase or decrease in the future. For example, if this contribution were to grow linearly with global average temperature change, the upper ranges of 10sea level rise for SRES scenarios shown in Table SPM-3 would increase by 0.1 m to 0.2 m. Larger values cannot be excluded, but understanding of these effects is too limited to assess their likelihood or provide a best estimate or an upper bound for sea level rise. The Case For at least .5 to 1.4 Meters SCIENTIFIC ANALYSIS – Confidence = High A Semi-Empirical Approach to Projecting Future Sea-Level Rise January 19, 2007 Stefan Ramstorf: A semi-empirical relation is presented that connects global sea-level rise to global mean surface temperature. It is proposed that, for time scales relevant to anthropogenic warming, the rate of sea-level rise is roughly proportional to the magnitude of warming above the temperatures of pre–Industrial holocene. This holds to good approximation for temperature and sea-level changes during the 20th century, with a proportionality constant of 3.4 millimeters/year per °C. When applied to future warming scenarios of the Intergovernmental Panel on Climate Change, this relationship results in a projected sea-level rise in 2100 of 0.5 to 1.4 meters above the 1990 level. The Case For at least .8 to 2 Meters SCIENTIFIC ANALYSIS – Confidence = Medium/High September 5, 2008 W. T. Pfeffer, J. T. Harper, S. O'Neel: On the basis of climate modeling and analogies with past conditions, the potential for multimeter increases in sea level by the end of the 21st century has been proposed. We consider glaciological conditions required for large sea-level rise to occur by 2100 and conclude that increases in excess of 2 meters are physically untenable. We find that a total sea-level rise of about 2 meters by 2100 could occur under physically possible glaciological conditions but only if all variables are quickly accelerated to extremely high limits. More plausible but still accelerated conditions lead to total sea-level rise by 2100 of about 0.8 meter. These roughly constrained scenarios provide a "most likely" starting point for refinements in sea-level forecasts that include ice flow dynamics. 3 Scripps Institution of Oceanography, University of California San Diego, San Diego, CA 92093, USA. Note: The following case (5 meter) address conceivable potentials based on current understanding of the paleo record and the current level of reasonable understanding of constraints v. potentials. The main differences are that in our current scenario (Anthropogenic Global Warming) Black Soot has been introduced due to human industrial processes, This is expected to act as an accelerator to ice sheet melt rates. Land use changes are also contributing to dynamic changes in the climate system. All systems affect each other, so that is where the main questions remain. That is, what will result from these dynamic interactions and feedback systems? HYPOTHETICAL SCENARIOS Here we address the potentials that reach beyond our current scientific understanding and ask the questions that need to be answered based on current understanding and indicators Questions Is climate sensitivity too low in the climate models? Some measurements are exceeding the models. Model sensitivity may not be accounting for the positive feedbacks properly (see UCAR and NASA)? Problems Some of the science used to project 5 meters SLR by 2100 are based on Meltwater Pulse 1a (see e.g. paper by Weaver et al., 2007). via Eric Steig on RealClimate: "This is the same event that gives Hansen his example of super-fast sea level rise. It occurred when Canada and most of Europe were covered by ice sheets, and when the Antarctic ice sheet extended to the edge of the shelf. If Antarctica tried to dump that much ice out now, all the icebergs would ground on the continental shelf. It, like Greenland, is in a far more stable configuration now than it was then. The conditions that produced Meltwater Pulse 1a ares simply not a good analogy for the present." The Case For 5 Meters Dr. James Hansen: “Sea level is already rising at a moderate rate. In the past decade, it increased by 3 centimetres, about double the average rate during the preceding century. The rate of sea level rise over the 20th century was itself probably greater than the rate in the prior millennium, and this is due at least in part to human activity. About half of the increase is accounted for by thermal expansion of ocean water as a result of global warming. Melting mountain glaciers worldwide are responsible for several centimeters of the increase.” Dr. James Hansen: “Greenland and Antarctica are also contributing to the rise in recent years. Gravity measurements by the GRACE satellites have recently shown that the ice sheets of Greenland and West Antarctica are each losing about 150 cubic kilometres of ice per year. Spread over the oceans, this is close to 1 millimetre a year, or 10 centimeters per century.” Runaway collapse Dr. James Hansen: “The current rate of sea level change is not without consequences. However, the primary issue is whether global warming will reach a level such that ice sheets begin to disintegrate in a rapid, non-linear fashion on West Antarctica, Greenland or both. Once well under way, such a collapse might be impossible to stop, because there are multiple positive feedbacks. In that event, a sea level rise of several meters at least would be expected.” Note: Sea Level Rise is expected to continue increasing beyond 2100. The year 2100 is merely being used as a benchmark for illustrating potential in a given time span. Alternative Theory for Negative Forcing Another theory is that additional warming will increase upper atmosphere cloud cover which may increase negative feedbacks enough to counter the warming caused by industrial GHG's. It works like this: Water is a greenhouse gas, warming the world increases water evaporation, which further warms the planet. It simultaneously increases cloud cover by virtue of the increased moisture in the atmosphere. This should counter some or all of the climate forcing imposed by the additional greenhouse gases. In general these models assume some degree of linearity as regards the acceleration combined with non linear feedback mechanisms weighted to the negative. Based on the forcing evidence there is strong reason to believe that the acceleration will be non linear and weighted to the positive. The last model described is the most negative weighted in consideration of its assumptions. The paleo record indicates that increased strong climate forcing yields increased temperatures such as in the Triassic and Eocene periods. Therefore it is reasonable to at least assume the possibility that negative feedbacks will not override the positive forcing levels imposed on the system. This means that it is more likely that increased moisture will increase tropospheric clouds, and not as many stratospheric clouds as some are projecting (ref. Dr. Richard Lindzen). This lends credence to the idea that H2O is a positive feedback with some negative feedback potential but not sufficient to override the positive forcing, thus resulting in an enhanced greenhouse effect in combination with observed feedbacks. This also seems probable since we have already observed upper atmospheric (stratosphere) cooling while lower atmosphere (troposphere) is warming. In summary, the paleo record indicates earth has been much warmer in the past. Therefore one can reasonably assume that positive forcing outweighs negative forcing and stratospheric clouds will not produce sufficient negative forcing. Sea Surface and Global Mean Temperatures Trends in ocean and land surface temperatures are important for multiple reasons. It relates to thermal expansion as well as tropical cyclone activity. This includes hurricanes and typhoons. The size of a body of water limits its rate of change to a degree. For example The Pacific ocean is larger and therefore has a slower rate of change. The Atlantic is smaller and can change temperature faster. The gulf of Mexico is very small, as oceanic bodies go, and can have a larger temperature variance range than the Atlantic. The ocean temperatures in the guld regularly breach the 28.5 C barrier thus providing the fuel for storm potential. The Pacific ocean western United States is still relatively cool compared to other ocean temperatures, due to stronger thermal inertia caused by mass of the body of water. There has been a developing pattern of increase in recent years as the global temps increase. In the Pacific, west coast America's: As the temperature variance begins to breach on a more regular basis the 28.5 C barrier and thermal depth increases, we can expect increased storm strength in storms forming off the western coast of the US, similar to the observations in Gulf and east coast regions. Summary While extremely difficult to accurately predict time scales and levels of sea level rise, certain assumptions are reasonably clear. The sea level Is rising Global warming is expected to accelerate in a non linear fashion. The climate trends are all leaning toward the upper end of the IPCC estimates. Estimating Sea Level Rise over time is extremely difficult. The confidence is high that sea level is rising and its rate of increase will increase. Fall Update to SLR Projections: Between January, 2007 and September 2008 the scientific estimation range of SLR (for 2100) rose from between .5–1.4 meters to .8–2 meters. The hypothesis of this report series remains that continued understanding of the dynamic processes will yield empirical knowledge of higher SLR over time. Thus indicating that our projected estimations of confidence in higher SLR will become further confirmed as the non linear processes are further understood. Thus it remains reasonable to assume the scientific SLR estimations will rise as evidenced and as expected in concert with natural and imposed negative forcing. The scientists quoted in this report will not scientifically estimate higher than the science allows and the upper range of that estimation is currently 2 meters SLR by 2100. Large uncertainties, at this time, reduce capacity to scientifically estimate beyond that range. However, some indicate the hypothesis is feasible. In a recent post about sea level rise, we highlighted a paper by the University of Colorado's Tad Pfeffer and others in which they show that one can rule out more than 2 meters of sea level rise in the next century. While we liked the paper very much, we also complained that Pfeffer and colleagues had created a bit of a straw man, by implying that it had been seriously proposed that Greenland's near term contribution to sea level rise could be much larger than that. In fact (we said), none of us in the climate science community ever took such ideas seriously, even if the popular press thought we did. Tad responds by pointing out that in fact there is published work attributing considerable likelihood to such extreme scenarios, and that there are numerous studies that at the very least strong imply it. He also reminded me that their paper actually rules out a contribution of more than about 50 cm from Greenland, significantly below some other recent published estimates. That makes their work even more important, since there are several publications that definitely consider upwards of one meter (from Greenland alone) by 2100 to be plausible. Pfeffer et al. conclude that that is simply not the case (at least in their informed view). Still, we remind readers that our chief complaint was that Pfeffer et al.'s work was taken by many in the media as a downward revision to sea level rise estimates, whereas in fact most informed estimates had put an upper limit well below that. See our earlier post on the IPCC Sea Level numbers. We have read with interest – and, we admit, surprise – the RealClimate post concerning our 5 September publication in Science entitled “Kinematic Constraints on 21st Century Sea Level Rise.” The source of our surprise, however, is probably not what the RealClimate authors imagine – we had fully expected a vigorous defense of very high rates of sea level rise (greater than 2 m/century), but not a denial that such rates had ever been hypothesized. We do not state anywhere in our paper that 2m or more of SLR by 2100 has been published as a peer reviewed and “informed estimate”. We do state that this has been ‘inferred’ and ‘argued’ as a “viable 21st century scenario”. We believe there is value in constraining the upper limits to the role of ice dynamics in future SLR. And, from what we know about historical rates of SLR in conjunction with what ‘we know we don’t know’ about ice dynamics, we believe it is reasonable to ponder very high rates of SLR in the next century. However, we also believe that it is problematic to project such a ‘hypothesis’ as a supported theory without proper testing by the scientific method. The question raised by RC is whether or not this hypothesis has circulated within the scientific community. In his 2007 paper (Environ. Res. Lett. 2(2007)) Hansen proposes a rate of sea level rise of “5 m this century.” This is hypothetical, but he is confident that it is a “far better estimate than a linear response”. This is accompanied by his statement that he finds it “almost inconceivable that BAU climate change would not yield a sea level change of the order of meters on the century timescale.” The provisional nature of his discussion is irrelevant; it is an explicit statement that 5 m of sea level rise in this century is a possibility he regards as viable, published in the scientific literature by the person who is arguably (and deservedly) the most visible and authoritative climate scientist in the world. No reader of this paper would assume that Hansen didn’t actually mean what he said. Hansen reinforced this idea in other publications and statements, including in his briefing to Congress on 23 June 2008 (“sea level rise of at least two meters is likely this century”). Our analysis specifically tested the likelihood of next-century sea level rise of more than 2 m, and Hansen explicitly hypothesized 5 m of sea level rise in this century. Hansen has gone on record with specific numbers, but other published studies including the 2006 Overpeck and Otto-Bliesner Science papers left the upper limit open ended, and certainly implied it could be quite high. The fact that this idea was present in the scientific community was confirmed for us by 8 scientific presentations we gave on this topic in the past year (5 in the US, including the Fall 2007 AGU and 3 in Europe). At none of those talks did anyone in the audience question what high forecasts we were referring to. The comments we got back on our work were overwhelmingly positive, and were along the lines that what we had presented was a good next step – both to move past the IPCC’s low sea level forecasts, and as a response to the persistent hypotheses of very high rates of sea level rise that were circulating. Criticisms, where they were voiced, were largely that we were underestimating the power of dynamics and that rates of sea level rise well in excess of 2 m/century might occur in spite of our conclusions. We agree that the media coverage of our paper (as well as others before it) has undesirable side effects. Wherever we had the opportunity we pressed media writers not to use terms like “exaggerated” or “high sea level forecasts debunked,” and we have consistently stressed that our results indicate a very significant sea level rise and are no justification for any kind of complacency. We have stressed that even our low end scenario of 0.8 m of SLR would have tremendous consequences. However, we stand by our statements that sea level rise at rates of substantially more than 2 m this century were in fact put forward as a likely possibility. Earlier this summer Andy Revkin published a piece in the New York Times about what he has termed the “Whiplash Effect”: confusion created in the public mind by media coverage of rapidly evolving scientific ideas. There has certainly been some whiplash in this case. However it is others who cracked the whip. We have simply refused to let go of the other end. Tad et al, thanks for commenting. There are a number of issues here, and so I think it’s best to start off with what we can probably all agree on. First, the more informed estimates of sea level rise become, the better off we will be, and so your assessment of some of the kinematic constraints is certainly a welcome addition to the literature. Second, as you clearly state, these numbers are significantly in excess of the ‘headline’ numbers that came out of the IPCC report. As you are also aware, IPCC punted on what the worst case scenario could be given non-linear dynamic ice feedbacks. Thus, it is clear to me that your constraints are a significant up-grading of possibilities in the future (and hence our surprise at the thrust of your press release and some of the coverage). However, scientists, like nature, abhor a vacuum. In the absence of any trustworthy glaciological constraints on the rates of future SLR, it is only natural that scientists will turn to the paleo-record and to heuristic attempts to get an idea of what is possible. It is clear that the paleo-record shows greater than meter/century rises during the deglaciation (MWP 1A), or even in the Holocene (Carlson et al, 2008). Therefore these possibilities cannot be neglected a priori. It is also clear that conditions during the last interglacial (LIG, 125 kya BP) that temperature changes were close to what is anticipated by the end of the century. At that time, equilibrium sea level rise was between 4 and 6 meters higher than at present (with maybe 2 or 3 meters coming from Greenland). Thus for climate conditions that are not too far away from the situation now, multi-meter sea level rise is certainly an eventual possibility (the rates of change at the LIG having not been constrained). And indeed, a simple heuristic calculation such as done by Hansen in the ERL paper easily gives numbers in the range of meters. These pieces of evidence show that discussion and further investigation of the possibilities of multi-meter sea level rise should be continued and cannot be ruled out a priori. However, stating that something is conceivable is not the same as making a prediction. The Overpeck and Otto-Bliesner papers made no prediction (or even projection) for SLR by 2100, and your implication that they were somehow negligent in not doing so is a little strange. Their study of equilibrium change cannot provide such a constraint and so you seem to be taking them to task for simply not assuming that SLR can be rapid. I would point out as well that their study’s conclusions that maybe 2 to 3 meters of sea level rise at LIG equilibrium came from Greenland (maybe even a little less taking the Wilerslev et al results into account) rather undermine the claim in your paper that people (unnamed) have predicted 2 and 5 meter rises from Greenland alone in the next century. I can find no evidence of this anywhere in the literature. I note you confuse global and Greenland-alone in your text above. Your main criticism seems to be reserved for Jim Hansen. Despite the fact he is my boss, he is certainly not immune from criticism on that score. However, you are, I think, wrong in this case and have misread him. The ERL paper that you provide as the only example of a specific 5m/century prediction, is curiously enough a discussion about how difficult it is for some in the glaciological community to publicly express their concerns about the state of the ice sheets and the implications (something I have also noticed). The ‘prediction’ you refer to is a simple doubling calculation to demonstrate that non-linear responses could produce multi-meter/century SLR in theory. And since we know that has happened in the past, that can’t actually be wrong. It was a calculation that had no information from the ice sheets, or the climate forcing or anything, therefore I think I am quite right in not describing it as an “informed estimate”. Jim has made his actually worst case scenarios abundantly clear in many interviews, in the Washington Post for instance: “sea level rise that can be measured by feet more than inches”, and in the ERL papers itself “measured in meters”, and in the quote you picked up on. It is not picking nits to point out that all of these statements are basically consistent with the 2m upper bound you came up with. Eric has made the point that perhaps you were reacting not to actually predictions, but to perceptions among the public, maybe engendered by misleading headlines. That there have been misleading headlines is clear, but I cannot find any related to Hansen’s ERL paper. Media misconceptions should of course be countered and true explanations given, but I see no evidence that the media on the whole has got this story wrong. If anything, the bulk of the coverage (which followed the IPCC report) was way too conservative, and commentators like Bjorn Lomborg get much more press with claims that sea level rise will be less than 10 inches by 2100, than anyone with claims that it will be 20 ft. To conclude, my main emotion here is disappointment. The issue of sea level rise, and the impact that may have in future seem to me to be one the key implications of climate change for which there are no winners and for which the costs may be enormous. It therefore deserves to be discussed and investigated much more widely than it has been (and as I said, your paper is a useful addition, though I doubt it will be the last word). That educational process is surely larger and more important than criticizing a single paragraph in a relatively obscure publication that got no media attention. Had your press release been more accurately titled as “Global Sea-Rise Levels By 2100 May Be Lower Than One Person Hypothesised But Much Larger Than What Was Reported Following The Publication Of The IPCC Report And If This Happens It Will Be Really Bad News” you would have done the community a much better service. Additional Materials El Nino Related Coastal Erosion "Heavy rains and high surf from storms associated with the 1998 El Nino event produced severe erosion along the California coast, leading to major property losses.” Source: Paul Neiman, Environmental Technology Laboratory, NOAA Primarily, SLR is not the main concern for those living in coastal regions, as it provides only slow coastal erosion. The main concern for those living on the beach is increased storm strength and event related erosion. East coast and Atlantic region storm strength is notably higher in recent decades and similar trends are noted on the west coast or Mexico and Southern California, where ENSO (El Nino Southern Oscillation) and PDO (Pacific Decadal Oscillation) are riding on top of the general uptrend in oceanic temperatures. Pacific Decadal Oscillation: JPL: The Pacific Decadal Oscillation (PDO) is a long-term ocean fluctuation of the Pacific Ocean. The PDO waxes and wanes approximately every 20 to 30 years. From TOPEX/Poseidon data (see below) together with other oceans and atmospheres data, scientists think we have just entered the 'cool' phase. The 'cool' phase is characterized by a cool wedge of lower than normal sea-surface heights/ocean temperatures in the eastern equatorial Pacific and a warm horseshoe pattern of higher than normal sea-surface heights connecting the north, west and southern Pacific. In the 'warm' or 'positive' phase, which appears to have lasted from 1977- 1999, the west Pacific Ocean becomes cool and the wedge in the east warms. The PDO current phase may also mitigate the amplification of the ENSO pattern by keeping the ocean temp in the eastern pacific .4 to .8 C cooler. There is still a possibility of A stronger ENSO canceling the PDO affect to a degree. It should be noted that the PDO during the last major El Nino Event 1998 was at the end of the positive phase for the eastern pacific, meaning it was entering negative/cool phase for that region of the pacific. Translated, that indicates that very strong El Nino events are still possible even in the cool phase of the PDO. About scientists whose material is included in this report: Stefan Ramstorf A physicist and oceanographer by training, Stefan Rahmstorf has moved from early work in general relativity theory to working on climate issues. He has done research at the New Zealand Oceanographic Institute, at the Institute of Marine Science in Kiel and since 1996 at the Potsdam Institute for Climate Impact Research in Germany (in Potsdam near Berlin). His work focuses on the role of ocean currents in climate change, past and present. In 1999 Rahmstorf was awarded the $ 1 million Centennial Fellowship Award of the US-based James S. McDonnell foundation. Since 2000 he teaches physics of the oceans as a professor at Potsdam University. Rahmstorf is a member of the Advisory Council on Global Change of the German government and of the Academia Europaea. He is a lead author of the paleoclimate chapter of the 4th assessment report of the IPCC. James E. Hansen James E. Hansen (born March 29, 1941 in Denison, Iowa) heads the NASA Goddard Institute for Space Studies in New York City, a part of the Goddard Space Flight Center in Greenbelt, Maryland, Earth Sciences Division. He is currently an adjunct professor in the Department of Earth and Environmental Sciences at Columbia University, and also serves as Al Gore's science adviser. Hansen is best known for his research in the field of climatology and his testimony on climate change to congressional committees in the 1980s that helped raise broad awareness of the global warming issue. He is also noted for publishing "an alternative scenario" for global warming which states that in the past few decades the warming effect produced by increased CO2 has been largely offset by the cooling effect of aerosols also produced in burning fossil fuels, and that most of the net warming so far is due to trace greenhouse gases other than CO2. He has been a critic of both the Clinton and current Bush Administration's stances on climate change. Gavin A. Schmidt Gavin Schmidt is a climate modeler at the NASA Goddard Institute for Space Studies in New York and is interested in modeling past, present and future climate. He works on developing and improving coupled climate models and, in particular, is interested in how their results can be compared to paleoclimatic proxy data. He also works on assessing the climate response to multiple forcings, such as solar irradiance, atmospheric chemistry, aerosols, and greenhouse gases. He received a BA (Hons) in Mathematics from Oxford University, a PhD in Applied Mathematics from University College London and was a NOAA Postdoctoral Fellow in Climate and Global Change Research. He serves on the CLIVAR/PAGES Intersection and the Earth System Modeling Framework Advisory Panels and is an Associate Editor for the Journal of Climate. He was cited by Scientific American as one of the 50 Research Leaders of 2004, and has worked on Education and Outreach with the American Museum of Natural History, the College de France and the New York Academy of Sciences. He has over 50 peer-reviewed publications. Tad Pfeffer Professor, University of Colorado – Specialty: Glaciology, continuum mechanics, heat transfer. Research Interests: My research interests are broadly focused on modern glacier physics, including ice mechanics and glacier dynamics, heat and mass transfer in snow and ice, atmosphere/glacier and ocean/glacier interactions. My approaches to these problems include field work in Alaska, Greenland, and the Canadian Arctic, experimental laboratory work, and mathematical and numerical modeling. Applications of this work include estimates of future sea-level change, analysis and modeling of iceberg calving dynamics of tidewater glaciers and ice streams, determination of the internal velocity field in ice, and reconstruction of Late Wisconsin advances of ice in the Hudson Strait region. Outstanding Award: 1997 American Geophysical Union Editor's Citation for Excellence in Refereeing for JGR-Solid Earth. Eric Steig Eric Steig is an isotope geochemist at the University of Washington in Seattle. His primary research interest is use of ice core records to document climate variability in the past. He also works on the geological history of ice sheets, on ice sheet dynamics, on statistical climate analysis, and on atmospheric chemistry. He received a BA from Hampshire College at Amherst, MA, and M.S. and PhDs in Geological Sciences at the University of Washington, and was a DOE Global Change Graduate fellow. He was on the research faculty at the University of Colorado and taught at the University of Pennsylvania prior to returning to the University of Washington 2001. He has served on the national steering committees for the Ice Core Working Group, the Paleoenvironmental Arctic Sciences initiative, and the West Antarctic Ice Sheet Initiative, all sponsored by the US National Science Foundation. He was a senior editor of the journal Quaternary Research, and is currently director of the Quaternary Research Center. He has published more than 60 peer-reviewed articles in international journals. Report prepared by: John P. Reisman John P. Reisman worked at the University of the World with Dr. James Grier Miller, Author of Living Systems Theory and Dr. Martin Chamberlain (Chancellor Emeritus, UCSD), researching educational systems. While there he wrote a simplified systems theory for understanding general systems operation and dynamics, and developed a methodology to help understand the health of a given system. He worked, with the assistance of Dr. Jonas Salk, developing The Learning Center/PATH Project, which was presented to the US Department of Education and EDUCOM and developed the TLC/PATH project for the Reagan administrations, 'School 2000' project. More recently he has conducted research and development efforts in energy efficient urban and industrial structures and was awarded a patent for a time management system he invented. John studied engineering and early in his career worked in the media industry in production. He worked for the Department of Defense while living at the NATO base in Iceland. After 9/11 He worked for the Transportation Security Administration (TSA) and Homeland Security. Most recently he has applied his examinations to climate and energy systems and inter-dynamic relationships.

Q: How can I test the background scan and launch the application in background with iBeacon-Android? I am using the pro library. But I just found doc for free library I cannot find any doc for pro version. Also, I don't know how to implement the background mode even using the pro sample. Here are the steps: Build the pro sample project start the iBeacon source(using iPad) and it can be detected start the application and then press home button the make it in background Turn off the iBeacon source Turn on the iBeacon source However, more than 5 minutes, the application does not launch So, can anyone verify the step I did? How can I test the background mode more easily? Also, for the BootstrapNotifier, is it just work only first time when the device reboot? After that, even I put application in background, the application will not launch when it detect iBeacon? A: Your testing method sounds fine. I think the issue is that the reference app for the pro library only auto launches the app on the first detection after boot. After that, it sends a notification instead, and tapping on that notification launches the app. This is purely for demonstration purposes. You can change it to auto launch on every detection if you wish. Simply alter the haveDetectedIBeaconsSinceBoot logic in this code: @Override public void didEnterRegion(Region arg0) { // In this example, this class sends a notification to the user whenever an iBeacon // matching a Region (defined above) are first seen. Log.d(TAG, "did enter region."); if (!haveDetectedIBeaconsSinceBoot) { Log.d(TAG, "auto launching MainActivity"); // The very first time since boot that we detect an iBeacon, we launch the // MainActivity Intent intent = new Intent(this, MainActivity.class); intent.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK); // Important: make sure to add android:launchMode="singleInstance" in the manifest // to keep multiple copies of this activity from getting created if the user has // already manually launched the app. this.startActivity(intent); haveDetectedIBeaconsSinceBoot = true; } else { // If we have already seen iBeacons and launched the MainActivity before, we simply // send a notification to the user on subsequent detections. Log.d(TAG, "Sending notification."); sendNotification(); } } The javadoc link was missing from the main documentation page when you posted this question. That is fixed now.

In today’s world of agile software development and fast release cycles, developers increasingly rely on third-party libraries and components to get the job done. Since many of those libraries come from long-running, open-source projects, developers often assume they’re getting well-written, bug-free code. They’re wrong. The major patching efforts triggered by the Heartbleed, Shellshock and POODLE flaws this year serve as examples of the effect of critical vulnerabilities in third-party code. The flaws affected software that runs on servers, desktop computers, mobile devices and hardware appliances, affecting millions of consumers and businesses. However, these highly publicized vulnerabilities were not isolated incidents. Similar flaws have been found in libraries such as OpenSSL, LibTIFF, libpng, OpenJPEG, FFmpeg, Libav and countless others, and these have made their way into thousands of products over the years. Among the reasons why these bugs end up in finished products is a belief by developers that the third-party code they choose to integrate is secure because it has already been used by many others. The shallow bugs myth “There is a myth that open source is secure because everyone can review it; more eyes reviewing it making all bugs shallow,” said Jake Kouns, CISO of Risk Based Security, a firm that specializes in tracking vulnerabilities. “The reality is that while everyone could look at the code, they don’t and accountability for quality is deferred. Developers and companies that consume third party libraries are not allocating their own resources to security test ‘someone else’s code.’ Right or wrong, everyone seems to think that someone else will find the vulnerabilities and what is published is secure.” The reality is that many open source projects, even the ones producing code that’s critical to the Internet infrastructure, are often poorly funded, understaffed and have nowhere close to enough resources to pay for professional code audits or the manpower to engage in massive rewrites of old code. OpenSSL is a prominent example of such a case, but far from the only one. After the critical Heartbleed bug was announced in April, it was revealed that the OpenSSL project had only one full-time developer and that the project was being primarily funded through contract-based work that other team members did in their spare time for companies in need of SSL/TLS expertise. The developers of OpenBSD criticized OpenSSL for maintaining old code for platforms that few people care about and decided to fork the project to create a cleaner version of the library dubbed LibreSSL. The flaws in open source libraries are often the result of one or more of these reasons: old code or low code maturity, insufficient auditing or fuzzing—a process of finding vulnerabilities by automatically feeding unexpected input to applications—and too few maintainers, said Carsten Eiram, the chief research officer of Risk Based Security. “We see that many vulnerabilities being found in these libraries are by researchers simply running some of the latest fuzzers against them, so it’s often something the maintainers or companies using said libraries could do themselves. Software vendors are quick to implement libraries into their products, but rarely audit or even fuzz these first or help maintaining them.” It’s all marketing The Heartbleed, Shellshock and POODLE vulnerabilities raised a lot of interest among software developers and system administrators, partly because of the attention the flaws received in the media. Some vendors are still identifying products affected by these flaws and are releasing fixes for them, months after they were first announced. Eiram believes that the primary reason why these vulnerabilities stood out was not their impact, but the way in which they were advertised by their finders—with fancy names and logos. The sad truth is that flaws of similar importance are regularly found in widespread libraries, but manage to fly under the radar and are rarely patched by the software vendors who use them. “A lot of vulnerabilities—18—have been addressed in OpenSSL since Heartbleed, and we haven’t remotely seen the same attention to issuing fixes quickly—or at all—from the vendors,” Eiram said. “We see fixes of varying severity to libraries on almost a daily basis, but rarely see vendors bundling these libraries in their products issue fixes, even though we know these libraries are heavily used.” One example of that is a vulnerability discovered in 2006 by Tavis Ormandy, a security researcher who now works at Google. The flaw was among several that affected LibTIFF and were fixed in a new release at the time. It was tracked as CVE-2006-3459 in the Common Vulnerabilities and Exposures database. “In 2010, a vulnerability was fixed in Adobe Reader, which turned out to be one of the vulnerabilities covered by CVE-2006-3459,” Eiram said. “For four years, a vulnerable and outdated version of LibTIFF had been bundled with Adobe Reader, and it was even proven to be exploitable.” Adobe Systems has since become one of the software vendors taking the threat of flaws in third-party components seriously, Eiram said. “They’ve made major improvements to their process of tracking and addressing vulnerabilities in the third-party libraries and components used in their products.” Another one of those vendors is Google. Aside from just keeping track of vulnerabilities in the third-party code it uses, the company’s researchers are actively searching for flaws in that code. “We’ve seen two of Google’s prolific researchers, Gynvael Coldwind and Mateusz Jurczyk, finding more than 1,000 issues in FFmpeg and Libav, which is used in Chrome, and they’re currently looking at other libraries like FreeType too,” Eiram said. “OpenJPEG also seems to receive some scrutiny by Google at the moment, which is used in PDFium that in turn is used in Chrome. Obviously, Google also put a lot of effort into securing WebKit, when they started using that as the engine for Chrome.” Making such contributions helps to improve the code maturity of those libraries for everyone, and is something that all software vendors should do. If vendors would at least use fuzzing to test the libraries that they use and help fix the issues they find in the process, it would make a significant difference, Eiram said. Much more so than the bug bounty programs for critical Internet software, like those run by Hacker One or Google, which so far have had little effect at drawing researchers toward finding vulnerabilities in libraries, he said. An accurate bill of materials Unfortunately we’re a long way from that happening, as many software developers fail to even keep track of which third-party components they use and where, not to mention vulnerabilities that are later found and patched in those components. Veracode, a security firm that runs a cloud-based vulnerability scanning service, found that third-party and open source components introduce an average of 24 known vulnerabilities into each application and that in the case of some enterprises, 40 percent of the applications they use have one or more critical vulnerabilities introduced by components. “Most companies learned lessons from trying to patch Heartbleed and Shellshock,” said Chris Eng, vice president of research at Veracode. “One of the challenges was that it involved not only patching servers, but patching vulnerable hardware and software products. Answering the question ‘Which of my products rely on a vulnerable version of OpenSSL?’ was difficult for many organizations due to lack of visibility into the composition of their software products.” “Having an accurate ‘bill of materials,’ so to speak, for all software projects is critical to the patching effort,” Eng said. “This has always been true, but Heartbleed and Shellshock both amplified the issue thanks to the ubiquity of both OpenSSL and Bash.” For system administrators the situation is even more complicated, because they rely on software vendors for fixes and their response to flaws in third-party components varies greatly from fairly quickly to none. “We do sense that the software industry has recognized the threat and is trying to deal with it—at least many major companies—but properly mapping libraries used in the code and tracking and triaging vulnerabilities in these requires significant resources,” Eiram said. Be prepared for more If there’s one thing that Heartbleed and Shellshock changed it is that researchers now have a model for advertising the flaws they find so they reach a wider audience. Even though many in the security industry don’t agree with this approach, because it tends to hype the risks, it does seem to put pressure on vendors to act. It also seems to attract the attention of even more researchers, leading to increased scrutiny of some libraries, even if for short periods of time. “Researchers looking to find the most impactful vulnerabilities will naturally be drawn to software that is widespread and baked into a wide range of products,” Eng said. “I think this will continue, because many researchers are motivated—at least in part—by the media attention that comes with discovering high-profile bugs.” From a business perspective, being forced to unexpectedly reallocate resources that are planned for something else in order to deal with flaws like Heartbleed, which involves identifying affected products and issuing patches, is likely a burden for software vendors. If faced with highly publicized flaws on a regular basis, vendors might naturally be pushed to adopt more proactive strategies that involve tracking, patching and even finding vulnerabilities in third-party components themselves as a matter of course. “It does seem like more and more software companies are discussing the challenge of dealing with third party libraries and components, and have recognized how these are an Achilles heel,” Eiram said. “The vast majority of them still need to implement a proper policy and approach for dealing with this challenge.” Companies should map which of their products contain third-party libraries, should define policies for who may add such components to products and how, should consider the security state of a library before using it by consulting the various vulnerability databases and should create an in-house vulnerability tracking solution or purchase a subscription to a commercial one with strong library coverage. “Longer term we may see a shift, but developers may still view Heartbleed and Shellshock as isolated events rather than a trend,” Eng said. “On the other hand, automated solutions are now making it easier for enterprises to identify components with known vulnerabilities in their application portfolios, so I think we’ll see the proactive approach becoming a best practice over time.” On the enterprise side, “Organizations need to recognize that bugs of the magnitude we’ve seen in 2014 will continue into 2015 and put the processes in place to quickly identify where they are vulnerable, have a sound procedure to prioritize the issues and efficient processes to patch systems when bugs are discovered to reduce risk of exploitation,” said Gavin Millard, technical director for EMEA region at Tenable Network Security. “When the next ‘Bug du Jour’ hits, the rapid response to deal with it needs to be a well oiled, tested and efficient machine.”

Q: Use of animation in a projector presentation Q: Is it a good idea to embed GIF or other animation into a Powerpoint presentation? I am working on a 50 minutes technical presentation and trying insert some "breaks" after each 10-15 minutes. The presentation is to be delivered live through a projector, but the slides are likely to be uploaded for public viewing. I saw other presentations on how to make beautiful slides (this one for example). No one seems to mention the use of animation. Bad idea? This question seems to be within the boundaries of this site, at least per this answer A: Some times ago I have a discussion with local folks from powerlexis (sorry, it's on Russian and burried deep). My point is presentation are divided on two types: for live presenting, for downloading, i.e. for learning without presenter. The requirements for both types are different. It's rather weird to watch some non-relevant animation in the middle of technical presentation which are learned without presenter. Because there is a lack of context! Obviously, in live presentation you provide some comments on your animation, which is not the case for the offline presentation. For live presentation some breaks is a good technique. Human attention and its concentration decrease over time. So periodical breaks are necessary. It could be cases, anecdotes, images and animations. The type of "break content" should be relevant to your audience. Providing analogy with learning process, Periodic breaks in lectures improve attentiveness and help develop the ability to concentrate. Students rarely come equipped to concentrate for the full lecture period. Successful television producers and radio commentators know well that people have a very limited attention span. The secret of success lies in the ability to control when the students are concentrating, and when they are not. If lecturers can control die timing of student attention, then they can feed the important material during those periods. Successful breaks in lectures, at short intervals, are a means to that control. Providing breaks is a technical aspect of good lecturing. Waugh, Geoffrey H. and Waugh, Russell F. (1999) "The Value of Lectures in Teacher Education: The group perspective," Australian Journal of Teacher Education: Vol. 24: Iss. 1, Article 3. Ideally it's better to remove non-relevant animation from presentation for downloading.

[Sero-negative tsutsugamushi disease (scrub typhus) diagnosed by polymerase chain reaction]. We report a case of sero-negative tsutsugamushi disease diagnosed by polymerase chain reaction (PCR). A 54-year-old man who worked in Nagano prefecture presented with flu-like symptoms that did not respond to cephalosporin therapy. On admission to another hospital, chest roentgenography revealed abnormal shadows; liver dysfunction was also present. Despite therapy, the patient's condition gradually worsened and he was transferred to our intensive care unit. Erythema on all extremities and scabs on the right medial femoral region and the dorsum of the left foot suggested a diagnosis of tsutsugamushi disease. We administered minocycline and gave percutaneous cardiopulmonary support for adult respiratory distress syndrome. Despite all efforts, the patient died. Although serologic tests were not positive, Karp strains of R. tsutsugamuschi were identified on PCR amplification. Autopsy revealed evidence of acute hemorrhagic pancreatitis, which has not been reported previously in tsutsugamushi disease. We conclude that PCR techniques may be useful in confirming a diagnosis of early tsutsugamushi disease.

After lots of conflict and infighting, the elections reveal the new LSB members and delegates to Pacifica board. At the Jan 24 @ 1pm meeting , the rest of us, public-members of KPFK, can see and maybe meet, the board - those who can maybe influence how the radio station runs or continues to fail it's sponsors. At an easy to find location. see KPFK.org for details under 'events' on home page. see above link for a full list of those elected in January 2016 to KPFK's Local Station Board [LSB] who will sign in at the meeting on Jan 24 @ 1 pm in WLA. For address of LSB meeting and info see KPFK.org site and select "events" or see front home page. 'new' programs that include previously dis-allowed curse/ obscene/ sexual- explicit and derogatory words have been heard at the recently shifted hours of midnight to 3am programming, Mon-Thurs nights. many prior donors, volunteers, sponsors have veered away from such sudden loud and unexpected angry expressions - and so turned away from KPFK. this unusual and previously FCC prohibited language and 'slang' - that more often is used by rappers, 'the streets', the more deprived and undereducated, and also the criminal cultures, has been heard loudly and prolificately at KPFK. and since that version of the American-English language is less preferred or heard by those who want and have worked to obtain a better education and social status, many stakeholders of long-standing have complained and left the station, taking their $$$ and loyalties elsewhere in radio land. this new emphasis of 'rebellious' cultures, and of minority groups, now insisting and inflicting their cultural norms and versions onto many others in majorities has turned majority voices and funds away from the KPFK - even as that radio station repeatedly stresses it's need for more listeners, for needed money, for dedicated funders, and for more...more...more... while these unexpected shifts and drifts in programming reduces what KPFK needs. the hope that the younger styled and vulgar worded programers can also claim paid-up-donors to make up for the dismissed prior KPFK subscribers is dubious and may be a failing experiment. Pandering to the poorest, or lowest cultural norms, and using the language mostly used in prisons, in ghettos, in anger and with violence may be a poor choice made by management. The FCC will not ignore nor allow 1 radio station to claim defiance of USA rules and norms, just because they think they are "special" and can-do-whatever-we-want too. anyone who wants to hear the programs referred to above can listen to KPFK 90.7 FM at midnight - 3 am hours Mon-Thurs - to those who claim they are "awesomeness" and with that disclaimer, claim immunity from federal communication norms. The FCC can also be reached and questions asked of the US federal government directly on line or by telephone. [Federal Communications Commission that regulates TV, radio and more, not just for 'decency' but that too ]

Book in Advance The good news: Many cruise lines take reservations far ahead of the actual cruise. The bad news: Cabins on Alaska cruises can sell out up to 18 months in advance. Booking a cruise to Alaska well in advance is the best course of action. Early reservations give you access to a variety of itineraries, dates and cabins before they’re all taken. As an added bonus, cruise lines often give extra perks to those who book early, such as free airfare or onboard credits. When to Go “Lone Elk” (2016), Tim Yanke Ships don’t sail in the wintertime in Alaska, so the cruising season only lasts from May through September. The peak season for Alaska cruising is mid-June through late August. Those who wish to avoid crowded ports or a cruise with children and teenagers should book their trip for May or September. There are seasonal aspects to consider as well. Spring and early summer provide more opportunities to witness animals as they migrate, while mid-June to August offer the best daylight for excursions. To view the mysterious aurora borealis lights, September is your best bet, though late spring may work as well. What to Pack “Alaska Harbor” (2017), Duaiv Despite the cruise season taking place during the summer, pack for colder weather. Windbreakers, sweaters and other clothing that can be layered are recommended. Depending on the itinerary you choose, pack clothing for the outdoors. Excursions may involve hiking or canoeing, so bring clothes you don’t mind getting wet or dirty.

Influence of hypovolemic and hypertonic treatments on plasma vasopressin levels and fluid balance in the thyroidectomy-induced hypothyroid rats. OBJECTIVES: This study was undertaken to investigate the effects of hypovolemic and hypertonic treatments on plasma vasopressin (AVP) levels and fluid balance in thyroidectomy-induced hypothyroidism in the rat. The influence of hypothyroidism on AVP responsiveness to hypertonic and hypovolemic stimuli were compared. MATERIALS & METHODS: Adult male rats were divided into two groups. The rats were surgically thyroidectomized (hypothyroid) or sham-operated (euthyroid). Two weeks later these groups were further divided in three subgroups each containing six rats. The first subgroup consisted of unchallenged rats. The second group underwent hypovolemic treatment by using I.P. 700 mg polyethylene glycol. The third subgroup consisted of hypertonic (1.5 M NaCl; 1 ml/100 g) stimulated animals. All rats were decapitated and trunk blood collected in heparinized tubes. Plasma samples were stored at -20 degrees C until assayed. Plasma AVP, T3 and T4 levels were measured by radioimmunoassay. Hematocrit values and plasma Na and K concentrations were also determined. RESULTS: In the hypothyroid rats, hypovolemic treatment significantly reduced the expected increases in plasma AVP levels (p<0.05) compared to the respective intact animals. In the hypertonic group, similar increases occurred in plasma AVP levels of hypothyroid and euthyroid rats. Hematocrit values and plasma Na concentrations were not significantly different in the hypothyroid rats compared to euthyroid rats. CONCLUSION: In conclusion, thyroidectomy-induced hypothyroidism may affect AVP response to hypovolemic stimulus although it has no important effect on basal AVP levels nor AVP response to hypertonic stimulus.

Predicting the future is by no means an easy task, it requires considerable erudition, creativity, imagination and knowledge. Our website provides a vast database of articles and ideas which examine the future of humanity and how science, technology and evolution may shape our common future. My Homework Done really makes your homework done. It's that easy! The main sections of the website are all listed below, choose whatever you like to start with.

Robert Roberts (Christadelphian) Robert Roberts (April 8, 1839 – September 23, 1898) is the man generally considered to have continued the work of organising and establishing the Christadelphian movement founded by Dr. John Thomas. He was a prolific author and the editor of The Christadelphian magazine from 1864–1898. Early life Robert Roberts, born in Link Street, Aberdeen, Scotland, was the son of a captain of a small coasting vessel. His grandmother on his father's side was of the Clan MacBeth. His mother was a strongly religious Calvinistic Baptist, schoolteacher, and daughter of a London merchant. Though his family were of lowly circumstances, he was raised in a well disciplined, and strictly religious environment. Leaving school at the age of 11, he worked a short while as clerk in a rope factory, then serving in a grocers shop, and thirdly as a sort of apprentice to a lithographer. At 13 he became an apprentice to a druggist, also taking lessons in Latin, and learning Pitman's Shorthand. His mother took him as a boy of 10 to hear John Thomas speak in Aberdeen, Scotland. He formally and briefly, became a member of his mother's church when aged 12. Shortly afterward he came across a copy of a magazine, belonging to his sister, entitled the Herald of the Kingdom and Age to Come, by Thomas, who knew Roberts' mother. Robert Roberts then began his Bible studies in earnest. After reading Thomas’ book Elpis Israel, with Bible in hand, he became convinced of its soundness, and ceased attending chapel with his family. He was baptised in 1853 aged 14 as part of the "Baptised Believers" (this was 11 years before the name 'Christadelphian' was coined by John Thomas; he was re-baptized in 1863 "on attaining to an understanding of the things concerning the name of Jesus, of which he was ignorant at his first immersion"). He developed a reading plan to facilitate his daily systematic reading of the Scriptures. A form of this plan was later published as The Bible Companion and continues to be used by many Christadelphians. He married Jane Norrie in Edinburgh on April 8, 1859. They had six children, only three of whom survived into adulthood. Shorthand writer and reporter When Robert Roberts was 17 he became shorthand writer for a modest paper, the Aberdeen Daily Telegraph, after which he worked as a casual reporter, once being called on to assist in reporting the speeches delivered at an investigation into the merits of the Suez Canal scheme, conducted by Aberdeen Town Council on the occasion of a visit by Ferdinand de Lesseps. He left Aberdeen for Edinburgh to work as a reporter on The Caledonian Mercury. Leaving Edinburgh 1858, he worked for The Examiner in Huddersfield, then briefly for the same employer in Dewsbury. Then he accepted a travelling assignment as shorthand writer for the American phrenologists, Orson Squire Fowler and Samuel R. Wells, who were visiting Huddersfield as part of a lecturing tour (Roberts later described phrenology as of similarly high value to his religious beliefs). He returned to his job on the Huddersfield Examiner in July 1861. During his time at The Examiner he was also appointed as the Huddersfield correspondent for the Leeds Mercury, the Halifax Courier, and the Manchester Examiner. In the winter of 1863-64, Roberts moved to Birmingham, but failed in his attempt to set up a general reporting and advertising agency there. In 1864 he became a reporter for the Birmingham Daily Post, largely as a result of a testimonial from John Bright MP. In July 1865, he became a shorthand writer for the Birmingham Bankruptcy Court, working there until 1870, when a change in the Bankruptcy Act of 1869 brought an end to his appointment. Then, at the suggestion of Thomas, it was arranged that he should receive a salary for his editorship of The Christadelphian magazine, and so his career as a reporter came to an end. Association with John Thomas It was 1856 when Robert Roberts first wrote to John Thomas in America. In 1858 he tried, but failed, to raise funds for travelling expenses to invite Thomas to visit England again; receiving a reply concerning his efforts through the pages of The Herald of The Kingdom. During the American Civil War Thomas had to suspend publication of The Herald of The Kingdom magazine. Thus on October 8, 1861 Robert Roberts wrote to Thomas urging him to visit, which he did in 1862. Shorthand notes taken by Roberts during this visit formed the basis of Roberts' book Dr John Thomas: his life and work (published in 1873 - two years after Thomas' death). Some time after this visit, due in part to misunderstandings and misinformation, there was a short breach of friendly relations between the two men; this was resolved in October 1864. Subsequently, they enthusiastically supported each other's work. Roberts collected subscriptions and organised the distribution of John Thomas’ exposition of the Book of Revelation, Eureka (3 vols. 1861, 1866, 1868), in England, and (in time) many of his other works. Roberts raised the money to fund what would be the last trip of Thomas to England in May 1869. Toward the end of this trip, March 1870, Thomas made Roberts custodian of all his affairs in the event of his death, which occurred sooner than anticipated in 1871. Roberts died in 1898, and was buried in Green-Wood Cemetery, New York City, beside the grave of Thomas. Preaching Even in his early days Roberts endeavoured to organise preaching events wherever he went. His first serious attempt was in 1860, when he delivered a course of 8 public lectures in Senior's School Room, East Parade, Huddersfield. The Huddersfield meeting then took on Spring Street Academy, (a former Campbellite meeting place) for Sunday meetings including public lectures. Some Sunday afternoons he would also give out-of-door addresses, either in St. George's Square or the Market Place, Huddersfield. It was at Spring Street, in the winter of 1861, that Robert Roberts delivered a series of twelve Lectures on successive Sunday afternoons, systematically setting out Christadelphian beliefs. In 1864 after moving to Birmingham, he organised a lecture at Birmingham Town Hall, in reply to an Irvingite preacher who had spoken there previously. Between 1,500 and 1,800 people attended. Eventually in 1866 he leased the Athenaeum Chambers, 71 Temple Row, Birmingham, staying there until December 1871 when the meeting moved to the Temperance hall, 8 Temple Street, Birmingham. Although based in Birmingham, he travelled widely around the country, preaching and supporting the growing Christadelphian movement. Roberts used all the means at his disposal to preach what he believed to be the truth, and in 1877 he sent a copies of his pamphlet Prophecy and the Eastern Question to all the members of the House of Lords and the House of Commons, receiving the following reply from Gladstone: “DUNSTER, January 24th, 1877. Sir, Allow me to thank you for your tract, which I shall read with great interest; for I have been struck with the apparent ground for belief that the state of the East may be treated of in that field where you have been labouring Your faithful servant, W.E.Gladstone.” In 1895 he embarked (through pressure of circumstances) upon a voyage to Australia. He travelled via the Suez canal, touching at Naples and Colombo to Adelaide. He visited many towns and cities, in Australia and New Zealand, preaching everywhere he went. He then travelled back via the Fiji Islands, the Honolulu (then still known as the Sandwich Islands), Canada and America arriving back in Birmingham in 1896. In 1897 he returned to Australia with his family, they settled in Coburg, a northern suburb of Melbourne, in “Orient House”. In 1897-1898 he went on a short preaching tour in Australia, before embarking on a yet another preaching tour to New Zealand with his wife. He was in the midst of yet more travelling and preaching when he died of heart failure in San Francisco in September 1898 aged 59. He was succeeded as editor of The Christadelphian Magazine by Charles Curwen Walker. Writer and editor Robert Roberts, as early as 1858, attempted to start a manuscript magazine - just a single copy sent from friend to friend through the post. It did not get beyond the 4th or 5th number. In 1862 John Thomas, having suspended publication of the Herald of the Kingdom, advised Roberts to start a magazine. It is at this point that Robert's re-baptism (mentioned above) occurred, midway between the first edition of 12 lectures (1861), and preceding in July 1864 commencement of the publication of The Ambassador of the Coming Age. Thomas, out of concern that someone else might start a publication and call it The Christadelphian, urged Robert Roberts to change the name of his magazine to The Christadelphian, which he did in 1869. His editorship of the magazine continued with some assistance until his death in 1898. Roberts collected for the Rosh Pinna settlement in Israel in 1886 and later, but lost significant funds in the failure of the American Electric Sugar Refining Company in 1888. Roberts wrote and published numerous articles, pamphlets and books. A series of 12 lectures, given in Huddersfield in 1861, formed the basis of his first book. Each lecture was published sequentially at fortnightly intervals, in penny numbers. The second edition (February 1862), entitled Twelve Lectures, was stitched together in one volume. Expanded to 18 lectures, the book was republished by Robert Roberts in 1884, as Christendom Astray From the Bible. From its first publication as 12 lectures, Christendom Astray was acknowledged by Christadelphians as a standard work putting forth their beliefs; it has now been in print for almost 146 years in several editions. In 1867, from the manuscript of R.C. Bingley of Chicago, he published The Declaration, a standard work used for many years. He was involved in many public religious debates (a feature of the age in which he lived) with those of differing opinions, often publishing the substance of the debate in book or pamphlet form; Was Jesus of Nazareth The Messiah? 1871. Transcript of debate with Louis Stern of the Anti-Jewish Conversionist Society, Birmingham. This debate marks the beginnings of mutually respectful relations with Birmingham's Jewish community, which continued in the 1880s when Roberts called on the Christadelphian community to support Laurence Oliphant's appeal for funds for the Rosh Pinna settlement at Al-Ja'una in Galilee. In 1872 Roberts published the book Man Mortal as a reply to the book “Life and Immortality” (1871) by Frederick William Grant of the Plymouth Brethren. The Bradlaugh Debate, a public debate held in 1876 with Charles Bradlaugh entitled “Is The Bible Divine?”. Anglo-Israelism Refuted, based on a three night debate with the advocate of British Israelism, Edward Hine, held on April 21–23, 1879 at Exeter Hall, London, with Lord William Lennox presiding. Roberts was also involved in debates within the Christadelphian movement, which in some cases resulted in divisions. For example, 1865 marked separation from George Dowie of Edinburgh who was teaching the doctrine of the existence of a supernatural devil. Roberts' brother-in-law, William Norrie, initially sided with Dowie, but Dowie's group did not long survive his death. As an "Arranging Brother" of Birmingham Temperance Hall Ecclesia he was directly involved in the compilation of the Birmingham Statement of Faith (1877), and by letter from overseas agreed with minor amendation to the BASF (Birmingham Amended Statement of Faith) in 1898. However also in 1898 was published an article True Principles and Uncertain Details; or, The Danger of Going Too Far in our Demands on Fellow-Believers. Voyage to Australia and New Zealand To quote his own words, "through stress of circumstances" Roberts undertook, at the expense of his friends there, a voyage to "visit the Colonies..., for the more complete restoration of health." Throughout his voyage in 1895-6, Roberts kept a (subsequently published) diary of his experiences and observations, in which he made sure to "put all in" and "resist the feeling that things are unimportant for record". Bibliography Books Christendom Astray From the Bible (1884) Dr Thomas: His Life and Works (1873) The Law of Moses My Days and My Ways Nazareth Revisited (1890) Seasons of Comfort (1879) Thirteen Lectures on the Apocalypse (1880) To the Elect of God in Times of Trouble The Truth about God and the Bible The Visible Hand of God The Ways of Providence (1881) The Trial (1882) Diary of a Voyage to Australia, New Zealand, and Other Lands (1896) Booklets The Blood of Christ (1895) The Christadelphian Instructor (1891) The Commandments of Christ The Ecclesial Guide (1883) The Good Confession (1869) The Parables of Christ The Sect Everywhere Spoken Against (reprint of a lecture) The Slain Lamb (1873) Was Jesus of Nazareth The Messiah? (The Stern debate; 1871) Everlasting Punishment not 'Eternal Torments''' (1871) Magazines The Christadelphian References Bibliography Roberts, Robert, My Days and My Ways An Autobiography (Birmingham: The Christadelphian, 1894) Walker, Charles C., Robert Roberts His Ways and His Days (Birmingham: The Christadelphian) Collyer, Islip, Robert Roberts A Study of Life and Character, (Birmingham: The Christadelphian, 1917, Hyderabad, India 2003 176 pages) Thomas, John ed. The Herald of the Kingdom (America:1858) The Christadelphian'' Magazines 1864-1940 External links Works by Robert Roberts and other Christadelphian writers PDF Downloads of Robert Roberts works Category:1839 births Category:1898 deaths Category:Burials at Green-Wood Cemetery Category:British Christian theologians Category:British biblical scholars Category:Christadelphians Category:Scottish Christians

U.S. Sen. Bernie Sanders detailed his plan to aid American seniors Friday, arguing that expanding Social Security and enacting his signature "Medicare for All" health care proposal are critical to providing necessary services. "We have got to recognize that, as a nation, millions of senior citizens in this country are hurting," Sanders told the Des Moines Register in an interview. "We are the wealthiest country in the history of the world, and millions of older people should not have to struggle every single day to take care of their basic needs." The senator from Vermont and 2020 presidential candidate shared details of his plan with the Register ahead of his scheduled appearance at a Saturday afternoon forum sponsored by the Register and the AARP in Council Bluffs. It is the last of five such forums attended by 17 Democrats running for president. Sanders' Medicare for All plan would be phased in over four years to cover all Americans, and it would eliminate private health insurance. Sanders said his Medicare for All proposal would lower the price of prescription drugs by requiring the federal program to negotiate drug prices and allowing patients, pharmacists and wholesalers to purchase lower-cost drugs from Canada and other countries. After that, the plan would cap out-of-pocket drug costs for consumers at $200 annually. The expanded Medicare program also would add coverage for things such as dental care, hearing aids, vision exams and podiatry as well as home and community-based long-term care services. Former Vice President Joe Biden spoke at one of the AARP forums earlier in the week and argued that Medicare for All would weaken the current health care program upon which millions of seniors depend. Sanders said that was "just not accurate" and hoped to use Saturday's AARP/Register forum to make his case. "I want Iowans and especially seniors to understand that under our proposal, we expand Social Security benefits in areas that they desperately need," he said. To pay for an expansion of those Social Security benefits, Sanders supports lifting the payroll tax cap. Currently, American workers pay a tax on wages up to $132,900 a year, and those taxes fund the Social Security program. That means someone earning millions of dollars a year in wages pays the same amount of money into the program as someone who makes far less, Sanders said. Sanders said the tax should be collected on all income over $250,000. With that money, Sanders said he would support a benefit increase of $1,300 a year to seniors with incomes of $16,000 a year or less. He also called for increasing benefits paid to low-income workers when they retire and establishing a "Consumer Price Index for the Elderly" to ensure cost-of-living increases that keep pace with the products seniors use most. He said he would "make no apology" for raising taxes if it means expanding Social Security benefits. “We live in a society where the very rich are doing phenomenally well," he said. "Trump, despite that reality, has given over a trillion dollars in tax breaks to the top one percent and to large profitable corporations. ... Instead of giving huge tax breaks to billionaires, we demand that they start paying their fair share of taxes." Sanders' plan also calls for: Quadrupling funding for the Older Americans Act, which supports services such as home-delivered meals, and creating a new office within the Administration for Community Living to address social isolation among seniors Signing an executive order to put a moratorium on future pension cuts and reverse cuts that have already been made Expanding heating and cooling assistance through the Low Income Home Energy Assistance Program Expanding the Supplemental Nutrition Assistance Program, commonly known as food stamps, as well as the Meals on Wheels program Cracking down on scams and predatory financial practices that target seniors In addition to attending the AARP/Register forum, Sanders plans to attend a senior issues roundtable in Council Bluffs on Saturday and have coffee with union workers and retirees in Ottumwa on Sunday.

A globular complex formation by Nda1 and the other five members of the MCM protein family in fission yeast. In the fission yeast Schizosaccharomyces pombe, Nda1, Nda4, Mis5 and Cdc21 proteins belong to the MCM (minichromosome maintenance) protein family which is thought to have six members. Each MCM member is required for the early stages of DNA replication, and has a well-conserved central 200-amino acid domain containing a putative ATP binding motif. However, the precise molecular functions of MCM proteins are not yet clear. We investigated the physical interaction of Nda1 protein with the other fission yeast MCM proteins using specific antibodies. Immunoprecipitation of Nda1 protein leads to the co-precipitation of all the other members of the fission yeast MCM protein family. We purified the MCM protein complex by a combination of column chromatography. The native molecular weight of the MCM complex was estimated by gel filtration to be 560 kDa. The purified fraction contained nearly equal quantities of the six MCM proteins. Electron microscope observation showed that the MCM complex has a globular shape with a central cavity. We have developed a procedure to purify fission yeast MCM proteins in a native hetero-oligomeric complex form for the first time, which opens an avenue to further biochemical analysis.

Q: Why isn't Array.newInstance(Class, int) generic? I mean, is there any good reason for that? The method's got the following signature: public static Object newInstance(Class<?> componentType, int length) throws NegativeArraySizeException In my opinion, it would be much more convinient to declare the method as follows: public static <T> T[] newInstance(Class<T> componentType, int length) throws NegativeArraySizeException That way, when creating an aray of generic type it would not be neccesary to perform additional casting, e.g. public class Gen<T>{ private T[] a; public static <T> Gen<T> createByClass(Class<T> clazz){ a = clazz.cast(Array.newIntance(clazz.getComponentType(), 8); //we have to invoke //clazz.cast here. } } Was there any good reason to declare the return value type as Object? To me it seems very incovinient. A: You can use Array.newInstance(Class<?> componentType, int length) to create Arrays of Objects: Integer[] a = (Integer[])Array.newInstance(Integer.class, 5); Arrays of primitives: int[] b = (int[])Array.newInstance(int.class, 5); Arrays of Arrays: int[][] c = (int[][])Array.newInstance(b.getClass(), 5); The second example illustrates why this method cannot just return a generic array of objects, as arrays of primitves aren't array of objects (arrays of arrays, on the other hand, are). Using this helper method... private static <T> T[] newArray(Class<?> type, int len){ return (T[])Array.newInstance(type, len); } ...with int[] b = newArray(int.class, 5); will result in a compilation error: Incompatible types, required int[], but found T[] ...and with int[] b = (int[])newArray(int.class, 5); will result in a compilation error: cannot cast Object[] to int[]

Should states ban religious exemptions for student vaccinations? Researchers weigh in In June, New York became the fifth state to require its schoolchildren to be vaccinated despite their parents’ religious beliefs or philosophical objections. Amid a surge in measles cases nationwide this year, legislators and community leaders are debating ways to boost the number of kids who are up to date on their school-mandated shots. Many have focused on restricting or eliminating vaccination exemptions based on religion or personal opinions, which are common and have been offered by school districts across the United States for decades. But three recent academic studies suggest this might not be the most effective way to improve childhood vaccination rates. In fact, the research indicates banning these exemptions could backfire. Scholars studied student vaccination rates in California, the nation’s most populous state, and discovered that when parents cannot get an exemption based on their personal beliefs, some seek other ways for their children to stay in school while skipping one or more vaccinations. The researchers also learned that while California lawmakers have targeted personal belief exemptions, which are used by a relatively small group of students, a larger group of children is being allowed to enter kindergarten on a “conditional status” basis with incomplete vaccinations. Paul L. Delamater, the lead researcher on one of the three studies and the co-author of another, says helping conditional status students finish getting their shots would be a more effective way to boost vaccination rates than banning personal belief exemptions. Also, he says, it likely would be easier to encourage the parents of conditional status students to get their kids up to date than it would be to convince parents who want their children to be able to opt out of the vaccine requirement. “Trying to focus on parents who are not vaccine hesitant first may be a good way forward,” says Delamater, a fellow at the Carolina Population Center who’s also an assistant professor at the University of North Carolina at Chapel Hill. “I think parents with real vaccine hesitancy are going to search for ways to not vaccinate their children.” All three studies examine vaccination rates among kindergarteners in California, which, in 2015, became the first state in almost 30 years to eliminate non-medical exemptions. The new law, referred to as Senate bill 277, took effect in 2016. Among their key findings: While the percentage of kindergarteners who were up to date on their shots increased in 2016, the vast majority of the increase was linked to a different change made by school officials. Schools cut back on the number of children allowed to enter kindergarten on a conditional basis. After schools in California did away with personal belief exemptions, they saw a sharp increase in students submitting medical exemptions. The researchers suspect that some parents who could no longer use personal belief exemptions obtained authorization from doctors to skip vaccinations for medical reasons. While a larger share of kindergarteners had all their required vaccinations after Senate bill 277 took effect in 2016, the trend reversed the following year. The drop in up-to-date students, researchers explain, is connected to the spike in children using medical exemptions as well as an increase in the number of kindergarteners enrolled in school who were designated as “overdue” for vaccinations, oftentimes because they had missed a dose of a vaccine. In addition, Senate bill 277 effectively created a new exemption, allowing more than 5,000 kindergarteners in 2017 to forgo vaccinations if they attended a school without classroom-based instruction or had what are called “individualized education plans.” Delamater says other states can learn a lot from California. “California has been trying to be very proactive about this via legislation and for us, as researchers, it gives us a very interesting opportunity to evaluate how these big changes in policy relating to vaccinations – how people actually react to that,” he says. “As you’ve probably seen from looking at these papers, it’s not a really straightforward and easy-to-understand thing. There is a lot of nuance to this.” Chelsea Richwine, the lead author on a working paper from the National Bureau of Economic Research that investigated the effects of Senate bill 277, stressed the importance of kids getting all their required vaccinations. It’s as dangerous for a child to have incomplete vaccinations as it is to skip them altogether, she says. She recommends restricting vaccine exemptions while also making it clear when and under what circumstances youth should be allowed medical exemptions from one or more required vaccines. In many cases, kids need only to delay vaccinations for a certain period of time, not avoid them completely. Both the American Medical Association and American Academy of Pediatrics support eliminating non-medical exemptions. Under the proposed legislation, the State Department of Health would review vaccination reports from doctors who submit five or more medical exemption forms in a calendar year. “Exemptions are appropriate in certain circumstances, especially medical exemptions,” explains Richwine, a fourth-year doctoral candidate studying health policy at George Washington University. “I think we have to take a more holistic approach to looking at medical and non-medical exemptions. It’s not an effective policy on its own — if there’s an opportunity to substitute [one exemption for another].” ——- Below, we’ve summarized the three recent studies that Delamater, Richwine and their colleagues authored. We also included other research we think you’ll find helpful, including a study that finds that the parents who were most likely to file personal belief exemptions before California banned them were white and from upper-income levels. For this study, researchers examined the impact that three California initiatives — including Senate bill 277 — had on the vaccination rates of kindergarteners. In 2014, a new state law made it harder for parents to get a personal belief exemption. In 2015, school officials began limiting the number of children they allowed to start kindergarten on a conditional admission basis. Then, in 2016, Senate bill 277 was enacted, eliminating personal belief exemptions. The researchers find that between 2000 and 2017, 9.3 million California kids entered kindergarten, 721,593 of whom were not up to date on their required vaccinations. During the period the three initiatives were launched, the percentage of kindergarteners with incomplete vaccinations fell. In 2013, 9.84% of kindergarteners were missing some or all school-mandated immunizations. That number dropped to 4.42% in 2016 but then rose slightly to 4.87% in 2017. Most of the reduction in kindergarteners with incomplete vaccinations is linked to the crackdown on conditional admissions, the rate for which dropped from 6.5% in 2013 to 1.84% in 2017, find the researchers, led by S. Cassandra Pingali, a fellow in the Immunization Services Division of the U.S. Centers for Disease Control and Prevention. Meanwhile, the slight increase in 2017 is related to the rising number of children using medical exemptions and a jump in the number of kindergarteners who are overdue for vaccinations. Senate bill 277 also allowed 5,310 kindergarteners in 2017 to forgo vaccinations s if they attended a school without classroom-based instruction or had individualized education plans. The authors find that California communities reacted differently to the three interventions. In 2016 and 2017, reductions in the share of kindergarteners with incomplete vaccinations appear to be largest in the southern part of the state. “Northern California maintained the highest predicted rate of students without up-to-date vaccination status throughout the study period with relatively minor changes during the implementation of the 3 interventions compared with the rest of the state,” the authors write. This study looks at Senate Bill 277’s effect on the percentage of California students entering kindergarten with incomplete vaccinations. A key takeaway: While the percentage of kindergarteners whose vaccinations were not up to date fell during the first year of the law, it rose in the second year. Researchers tracked three categories of children who had not received all school-mandated vaccinations: those who were allowed to start kindergarten as conditional entrants, students who were overdue to receive one or more vaccinations and those who were “exempt” because they either attend a school without classroom-based instruction or have individualized education plans. The researchers find that the percentage of kindergartners starting school not up to date on their vaccinations fell from 7.15% to 4.42% during the first year after Senate Bill 277 was enacted. But much of this drop was due to a reduction in the number of children who entered kindergarten on a conditional basis, the researchers note. The conditional entrance rate fell from 4.43% to 1.91% in 2016. In the second year after the law took effect, the percentage of kindergartners who weren’t up to date on their vaccinations increased by 0.45%. It appears that personal belief exemptions “were replaced by other mechanisms allowing kindergarteners not up-to-date on vaccinations to enter school,” writes the research team, led by Delamater. “Some parents who would have claimed a personal belief exemption before SB277 may have initiated the series of vaccines to meet the requirements for conditional entrance after the law’s implementation,” the authors write. “Yet, data reporting progression toward series completion are not available and we are not able to know whether or when students became fully up-to-date on vaccinations.” The authors also find that many of the parents who sent their children to school with incomplete vaccinations after Senate Bill 277 was enacted lived in the same geographical areas where many parents previously had filed personal belief exemptions. “Previous geographic patterns of vaccine refusal persisted after the law’s implementation,” the authors write. While other studies established a relationship between California Senate Bill 277 and higher childhood vaccination rates, this study finds that the new rule actually caused California vaccination rates to improve. This study also differs from others by examining changes in vaccination rates for each of the four vaccines required for kindergarten. The three researchers — Richwine, Avi Dor and Ali Moghtaderi of George Washington University — find that vaccination rates rose among all four vaccines in California, ranging from an increase of 2.5% for the measles, mumps and rubella (MMR) vaccine to an increase of 5% for the polio vaccine. As part of their analysis, Richwine, Dor and Moghtaderi looked at parents’ use of personal belief exemptions and medical exemptions in California before and after Senate Bill 277 was enacted and compared it to parents’ use of these exemptions in seven control states — Arizona, California, Connecticut, Kansas, Minnesota, Pennsylvania and Rhode Island. What they learned is this: Compared to control states, California had lower vaccination rates and higher rates of students using personal belief exemptions in 2015, the year before the legislation took effect. After California banned personal belief exemptions, the rate of students using them there fell below that of the control states. However, California also “experienced a sharp increase in medical exemptions while control states’ exemption rates remained unchanged.” Richwine, Dor and Moghtaderi find that California’s policy change reduced the rate at which children used personal belief exemptions by 3.4 percentage points. But that drop was offset by “a significant 2 percentage-point increase in medical exemptions in several of our analyses, which limits the overall decline in total exemptions to just 1 percentage-point.” This study’s main finding: White, upper-income parents were most likely to seek personal belief exemptions in California before the state banned them. The research team — led by Y. Tony Yang, currently executive director of George Washington University’s Center for Health Policy and Media Engagement — analyzed millions of kindergarteners’ vaccination data to identify where in the state personal belief exemptions were most prevalent. The team combined vaccination data from the 2007-08 to 2013-14 academic years with data from the U.S. Census Bureau’s 2008–2012 American Community Survey to better understand the characteristics of families who used these exemptions. The researchers find that the percentage of California kindergartners who used personal belief exemptions to forgo vaccinations rose from 1.54% in 2007-08 to 3.06% in 2013-14. The share of private school students using these exemptions was almost twice as high as the share of children using them in public schools. Yang and his colleagues also find that the “areas of California with higher household income and proportion White population are associated with higher overall PBE [personal belief exemption] percentages as well as greater increases in PBEs [personal belief exemptions].” “An increase in percentage White population from 20% to 35% yielded 1 additional PBE [personal belief exemption] per 280 students in 2013, and an increase from 65% to 80% yielded 1 additional PBE [personal belief exemption] per 139 students,” they write. For this study, researchers analyzed data collected through a national, online survey to better understand why some families delay childhood vaccinations. A total of 7,019 U.S. adults responded to the September 2018 survey, 31% of whom were parents with children under age 18 living at home. The parents answered a series of questions about childhood vaccinations. Researchers find that parents with high levels of “conspiratorial thinking” and those uncomfortable with needles were more likely to say they have followed a vaccination schedule that differs from what’s recommended by the CDC. Parents with high levels of conspiratorial thinking agreed with statements such as “Even though we live in a democracy, a few people will always run things anyway” and “Much of our lives are being controlled by plots hatched in secret places.” “Compared to those who scored lowest on conspiratorial thinking, those who scored highest were 15% more likely to report having delayed vaccinating their children, 11% more likely to have chosen their doctors based on their willingness to delay, 25% more likely to have only vaccinated their children for schools, and 18% more likely to state that they would be willing to relocate in order to attend a school that does not strictly enforce vaccination requirements,” write the authors, led by Timothy Callaghan, an assistant professor of health policy and management at Texas A&M University. The authors also find that “individuals most sensitive to needles are between 14 and 16% more likely than those without sensitivity to display [vaccine] hesitant behavior.” The analysis also indicates “fathers are more likely than mothers to display many vaccine delay behaviors.”

Author Archives: hamiltonm09 Researchers halted a study in Africa testing whether a daily antiretroviral pill can prevent women from becoming infected with the AIDS virus. So far, women taking the pill are just as likely as those taking the placebo to become infected. Of the 1,900 women taking the pill and placebo, 28 in both groups became infected. Researchers are still hopeful about obtaining better results in future studies, however. The drug, called Truvada, was found to protect gay men in a study that was published in November. One question being asked is whether there was a difference in how often the women actually took the pills; some women taking Truvada complained of side effects. There is also the question of how much Truvada infused the walls of the vagina, where the initial infection takes place. Some argue that vaginal gels are more effective at getting antirectoviral drugs into vaginal walls. I apologize if this story has already been posted (I checked the website but so much stuff gets posted that it’s hard to keep up). This story talks about how surrogacy has been legal in India since 2002, and how poor women become surrogate mothers to try to supplement their husband’s income. Hundreds of women are now doing this, which is problematic for as of yet there are no laws or government oversight on surrogacy. India is ideal for surrogacy because of its low costs, and modern assisted reproductive techniques. There is debate, however, about how much surrogacy really helps the women. They may be treated poorly by the clinics; an example provided is coercion into repeated insemination. Surrogate mothers may also experience social ramifications, as they may be ostracized by their communities. Additionally, India already has one of the worst maternal mortality rates. Currently, the Indian Counsel of Medical Research has drafted a bill to govern surrogacy, but it will take some time to become law. I found a fun podcast on iTunes called The History Chicks. It’s a series run by two women discussing various female historical figures, and from what I gathered so far it seems to try to portray them in a more objective light (or at least to shed some light on them). There’s only been one podcast so far, and it is about Marie Antionette. If you can’t access podcasts you can go to their website: http://thehistorychicks.com and listen to the discussions there. It’s not really about women’s health or human rights, but I thought it was interesting.

Joined + Jointed Born in Hong Kong, Samuel Chan’s schoolboy love for woodworking was taken to the next level after training for seven years in the UK. In 1995 he set up his own furniture company, Joined & Jointed, based on contemporary, enduring design.

Q: When to use internal tables? So, I have read that using internal tables increases the performance of the program and that we should make operations on DB tables as less as possible. But I have started working on a project that does not use internal tables at all. Some details: It is a scanner that adds or removes products in/from a store. First the primary key is checked (to see if that type of product exists) and then the product is added or removed. We use ‘Insert Into’ and ‘Delete From’ to add/remove the products directly from the DB table. I have not asked why they do not use internal tables because I do not have a better solution so far. Here’s what I have so far: Insert all products in an internal table, place the deleted products in another internal table. Form update. Modify zop_db_table from table gt_table." – to add all new products LOOP AT gt_deleted INTO gs_deleted. DELETE FROM zop_db_table WHERE index_nr = gs_deleted-index_nr. ENDLOOP. " – to delete products Endform. But when can I perform this update? I could set a ‘Save button’ to perform the update, but then there will be the risk that the user forgets to save large amounts of data, or drops the scanner, shutting it down or similar situations. So this is clearly not a good solution. My final question is: Is there a (good) way to implement internal tables in a project like this? A: internal tables should be used for data processing, like lists or arrays in other languages (c#, java...). From a performance and system load perspective it is preferred to first load all data you need into an internal table, then process that internal table instead of loading individual records from the database. But that is mostly true for reporting, which is probably the most common type of custom abap program. You often see developers use select...endselect-statements, that in effect loop over a database table, transferring row after row to the report, one at a time. That is extremely slow compared to reading all records at once into an itab, then looping over the itab. More than once i've cut the execution time of a report down to a fraction by just eliminating roundtrips to the database. If you have a good reason to read from the database or update records immediately, you should do so. If you can safely delay updates and deletes to a point in time where you can process all of them together, without risking inconsistencies, I'd consider than an improvement. But if there is a good reason (like consistency or data loss) to update immediately, do it. Update: as @vwegert mentioned regarding the select-endselect statement, the statement doesn't actually create individual database queries for each row. The database interface of the application server optimizes the query, transferring rows in bulk to the application server. From there the records are transported to the abap report one by one (because in the report there is only the work area to store a single row), which has a significant performance impact especially for queries with large result sets. A select into an internal table can transport all rows directly to the abap report (as long as there is enough memory to hold them), as now there is the internal table to hold those records in the report.

/* * AutomatableSlider.h - class AutomatableSlider, a QSlider with automation * * Copyright (c) 2006-2008 Javier Serrano Polo <jasp00/at/users.sourceforge.net> * * This file is part of LMMS - https://lmms.io * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU General Public * License as published by the Free Software Foundation; either * version 2 of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * General Public License for more details. * * You should have received a copy of the GNU General Public * License along with this program (see COPYING); if not, write to the * Free Software Foundation, Inc., 51 Franklin Street, Fifth Floor, * Boston, MA 02110-1301 USA. * */ #ifndef AUTOMATABLE_SLIDER_H #define AUTOMATABLE_SLIDER_H #include <QSlider> #include "AutomatableModelView.h" class AutomatableSlider : public QSlider, public IntModelView { Q_OBJECT public: AutomatableSlider( QWidget * _parent, const QString & _name = QString() ); virtual ~AutomatableSlider(); bool showStatus() { return( m_showStatus ); } signals: void logicValueChanged( int _value ); void logicSliderMoved( int _value ); protected: void contextMenuEvent( QContextMenuEvent * _me ) override; void mousePressEvent( QMouseEvent * _me ) override; void mouseReleaseEvent( QMouseEvent * _me ) override; void wheelEvent( QWheelEvent * _me ) override; void modelChanged() override; private: bool m_showStatus; private slots: void changeValue( int _value ); void moveSlider( int _value ); void updateSlider(); } ; typedef IntModel sliderModel; #endif

What an amazing game. To see the place explode on the OT winner and all the depressing Habs fans was so great. I was chirping them and throwing OLE OLE all the way from my seat to my car. They really couldn't handle it. Nothing beats it. Not if we take them lightly. We have turned a lot of trends around this year (e.g. our performance against Boston). I pray we do not take them lightly or they may turn the tide. We need to come out flying against those Sabres and bury them early. Meszaros was also not top 4 in his rookie year, he played much more sheltered minutes than Karlsson has been seeing what with playing the likes of Malkin. Yes and no. I vaguely remember him playing some crazy minutes towards the end of his first season when we had a bunch of defencemen all out with injuries. Sure enough, I've posted below his ice time over that 10 game stretch. Those 37 minutes against Buffalo are particularly ridiculous. If I remember correctly it was this stretch that had most of us here (myself included) anointing him the future #1 D and comparing him to Phaneuf. Yes and no. I vaguely remember him playing some crazy minutes towards the end of his first season when we had a bunch of defencemen all out with injuries. Sure enough, I've posted below his ice time over that 10 game stretch. Those 37 minutes against Buffalo are particularly ridiculous. If I remember correctly it was this stretch that had most of us here (myself included) anointing him the future #1 D and comparing him to Phaneuf. Yes and no. I vaguely remember him playing some crazy minutes towards the end of his first season when we had a bunch of defencemen all out with injuries. Sure enough, I've posted below his ice time over that 10 game stretch. Those 37 minutes against Buffalo are particularly ridiculous. If I remember correctly it was this stretch that had most of us here (myself included) anointing him the future #1 D and comparing him to Phaneuf. Yes and no. I vaguely remember him playing some crazy minutes towards the end of his first season when we had a bunch of defencemen all out with injuries. Sure enough, I've posted below his ice time over that 10 game stretch. Those 37 minutes against Buffalo are particularly ridiculous. If I remember correctly it was this stretch that had most of us here (myself included) anointing him the future #1 D and comparing him to Phaneuf. Yeah, but Karlsson hasn't played that many games in the top-4 either. I think its fair to say that there is reason to worry about whether Karlsson will meet his potential. I'm not ready to annoint him as a Norris winner or anything, don't get me wrong, but his situation and Meszaros's situation in their first year are quite diffrent, which is all I was trying to point out. Meszaros was playing protected minutes which led to his ridiculous +/-. He was quite impressive, but IMO Karlsson's performance is moreso. Despite not having played that many game in the top 4, during our franchise record streak Karlsson has been top 4, and has not been sheltered in any way shape or form. There are no guarantees when it comes to potential, but since the healthy scratches, Karlsson has been playing excellent hockey. You'd think that after Mezsaros people would be weary of calling a young defense man in his first year "franchise calibre" Meszaros never did anything to warrant that label - anybody who called him "franchise caliber" was guilty of extreme wishful thinking. He never showed legitimate #1 upside, although there was reason to hope he could turn into a solid #2-3. Really, he never did anything particularly well - he had decent size and could show a bit of a mean streak time to time, but his mobility was below par, and in particular his offensive skills were always greatly exaggerated by the stats-obsessed like Fuhr. Half his goals were fluke wristers from the point, and his assist totals were obviously padded from playing a supporting role on a stacked PP. And no, i'm not just criticizing the guy after he's gone - I always expressed skepticism towards those hyping him up. Karlsson couldn't be much more different. He has much higher upside because his skating and puck skills are much stronger. At the same time, he is undersized, meaning there isn't much room for error if his development doesn't go as hoped. I love how Murray pulls boarder line franchise players with like mid round picks...unreal Getzlaf, Perry, now Karlsson just to name a few... If his picks pan out as they have then are we ever heading towards a bright future. I LOVE YOU MURRAY AND I LOVE YOU KARLOSSON Lots of franchise players come from the middle of the first round. That's not exceptional - historically first round picks have the greatest chance to make it to the NHL and to make an impact in the NHL, and the stars are almost as likely to come from the middle or tail end of the round as the first couple picks. So far Murray has drafted a handful of them - but it's important to remember that he has just as many failures as successes. He's been doing this for a very long time. No hate with Murray on this one, as I'm really liking Karlsson. He's a pleasure to watch right now.

Universal Car Care Automotive Car Service will inspect your Toyota at each scheduled appointment, and determine what needs to be fixed or replaced. The schedule is planned according to the manufacturers’ instructions. Each servicing is done as determined by the Toyota manufacturers. In this way, your Toyota’s warranty is kept intact and service book is filled in time. What to do when your Toyota runs out of its warranty? If you are looking for value, quality, and convenience. Then look no further. Universal Car Care offer a first class service and repair facility and provide you with a dealer type service but at independent garage prices. At Universal Car Care Automotive we undertake all types of work, from servicing, replacing timing belts and full engine diagnostics to electronic management and service warning light reset. All work on your Toyota, will be carried out to the very highest standard using only approved spare parts. Why Should You Get Your Toyota Serviced? Regularly getting your Toyota serviced will ensure that it functions perfectly and gives you no trouble. Having a filled in log book also increases the resale value of your Toyota. When Should You Get Your Toyota Serviced? You can choose to have your Toyota serviced at fixed and regular intervals. Another method is to get your Toyota serviced when sensors installed in the engine and other areas prompt you to. These sensors detect when parts may need to be repaired, and then alert you. Save with Universal Car Care compared to Dealership Prices When you visit Universal Car Care Automotive, you will see that they offer dealership like services, without the expensive prices of dealerships. If you go to have some part repaired or replaced by a Toyota dealership, it will require expensive machinery and components to get the job done; thus costing you quite a lot. However, Universal Car Care Automotive has a first class service and repair facility, with which they can service your Toyota with perfection, letting you save up to as much as 30%. Their equipment can diagnose every problem your Toyota may be having, including engine’s computer and coding error and resetting issues. What Our Gold Coast Automotive Service & Repair Clients Are Saying Harry Jones says I've been taking all my cars to Brendan for years. Brendanalso looks after my parents and girlfriends cars. Always has good advice and the price is always competitive. Paul Nelson says Quality plus. Professional service, on time and honest. Jim H says "We get all our company cars serviced at Universal Car Care and have found that their rates and service are very competitive. We have been using their services since they were located in Nerang." Ellie W says "I have found that when I get my Holden commodore serviced at Universal Car Care I get great service, helpful motor mechanics and great prices. Shelley is really nice to deal with compared to other motor mechanics i have dealt with in the past." Calm C says "Fast, efficient, super friendly and helpful. Manged to do a job in less than a day that I was told would take 2 days with another mechanic. I will definitely go back and highly recommend Brendon and his team."

Q: TypeError: '<' not supported between instances of 'State' and 'State' PYTHON 3 I am trying to utilize a PriorityQueue from the queue class. However, i'm having issues putting custom objects into my PQ. I have implemented the __cmp__ function below: def __cmp__(self, other): return (self.priority > other.priority) - (self.priority < other.priority) I want the PriorityQueue to be sorted by the priority field, as assigned in my init function: def __init__(self, board, priority=0): self.priority = priority # Other logic However, when I run the code to insert a State object into the PQ, I get this error: TypeError: '<' not supported between instances of 'State' and 'State' Here is the code that runs the PQ. if op.precond(S): new_state = op.state_transf(S) if not (OPEN.queue.__contains__(new_state)) and not (new_state in CLOSED): GVALUES[Problem.hash(new_state)] = get_distance_value(op, new_state) HEUR_VALUES[Problem.hash(new_state)] = get_AStar_value(new_state) print("NEW STATE: " + str(new_state)) OPEN.put(new_state) print("OPEN: " + str(OPEN.queue)) Where OPEN is the priorityQueue. Any help would be greatly appreciated... as it should be pretty straightforward to insert a value into a PQ. A: In Python 3 you need to define __lt__ and __eq__ instead of __cmp__. See https://docs.python.org/3.1/library/stdtypes.html#comparisons. A: Instead of __cmp__ you need to implement one of the __lt__, __le__, __gt__, or __ge__ methods and use the functools.total_ordering decorator functools.total_ordering(cls) Given a class defining one or more rich comparison ordering methods, this class decorator supplies the rest. This simplifies the effort involved in specifying all of the possible rich comparison operations: The class must define one of __lt__(), __le__(), __gt__(), or __ge__(). In addition, the class should supply an __eq__() method. However, a better solution to that would be putting a tuples (priority, state_object) into the queue, as they suggest in docs for PriorityQueue The lowest valued entries are retrieved first (the lowest valued entry is the one returned by sorted(list(entries))[0]). A typical pattern for entries is a tuple in the form: (priority_number, data). The pitfall of the first approach is that you can modify priority of items that are already in queue and possibly observe unexpected behavior. In the second approach this is not an issue, since tuples are immutable.

Q: Does the Diablo 3 contest's Price Tag Limit of 250$ include shipping? Question is title, does the limit include shipping as in; 250$ + shipping or (prize price + shipping <= 250) A: If the total cost (prize + shipping) is under $250, don't worry about how much shipping costs. If the total cost (prize + shipping) is over $250, please limit shipping to less than $20. There are usually ways to find the same item that will ship to you for cheaper (and quicker). For example, try to find an item that comes from the Amazon nearest your country (e.g. amazon.co.uk if you're in the UK, or amazon.de if you're in Germany).

<!DOCTYPE html> <html> <head> <meta name="viewport" content="width=device-width, initial-scale=1" /> <link href="ripple.css" rel="stylesheet" /> <style type="text/css"> /** other stuff */ * { font-family: "Roboto"; } .bar { position: relative; height: 48px; width: 120px; display: inline-block; background: #ccc; } .bar.square { height: 120px; } .bar.tall { height: 120px; width: 48px; } .yourButton { border: 0; outline: 0; width: 100px; height: 32px; position: relative; background: #1a8cf3; color: white; border-radius: 4px; font-weight: 400; font-size: 16px; vertical-align: bottom; transition: box-shadow 0.25s; box-shadow: 0 0 0 rgba(0, 0, 0, 0.2); cursor: pointer; -webkit-tap-highlight-color: rgba(0, 0, 0, 0); } .yourButton:focus { outline: none; box-shadow: 0 1px 1px rgba(0, 0, 0, 0.2); } .optHolder { position: relative; width: 32px; height: 32px; display: inline-block; vertical-align: bottom; color: #1a8cf3; } .optHolder input[type="checkbox"] { visibility: hidden; position: relative; width: 100%; height: 100%; margin: 0; padding: 0; border: 0; color: inherit; } .optHolder input[type="checkbox"]::before { content: "\2714"; text-shadow: 1px 1px 0 white, 0px -1px 0 white; text-align: center; display: block; width: 32px; line-height: 32px; font-size: 24px; visibility: visible; transition: all 0.25s; opacity: 0.0; transform: rotate(120deg); } .optHolder input[type="checkbox"]:checked::before { opacity: 1.0; transform: rotate(0deg); } .optHolder input[type="checkbox"]::after { content: ""; border: 1px solid currentColor; border-radius: 3px; width: 14px; height: 14px; position: absolute; left: 50%; top: 50%; margin-top: -8px; margin-left: -8px; display: inline-block; visibility: visible; z-index: -10; } a.rippleJS { position: relative; } </style> </head> <body> <div class="bar"> <div class="rippleJS fill"></div> </div> <div class="bar tall"> <div class="rippleJS fill"></div> </div> <div class="bar square"> <div class="rippleJS fill"></div> </div> <div class="bar" style="background: white;"> <div class="rippleJS"></div> </div> <button class="yourButton"> Click Me <link class="rippleJS" /> </button> <label class="optHolder"> <input type="checkbox" checked="checked" /> <link class="rippleJS fill" /> </label> <a href="#test" class="rippleJS">Link</a> <a href="https://google.com" class="rippleJS">Google</a> <script src="ripple.js" type="module"></script> </body> </html>

Center for Environment, Commerce & Energy and all of its partner groups, subsidiaries, et al. Be it resolved that Sandy Norris McDonald, III is hereby appointed to the board of directors. Be it resolved that Sandy Norris McDonald, III will take over as Chairman of the Board and President of the Center for Environment, Commerce and Energy and all of its subsidiaries and assigns upon the current president, Norris McDonald, no longer operating as the organization’s chairman of the board and president.

[Effect of histamine on the action potential of the maxillary nerve in rabbits]. The significant enhancement of action potential as recorded from rabbit maxillary nerve with topically applied 1.0 mmol/L histamine on the nasal mucosa was completely blocked by pretreatment with diphenhydramine (H1 antagonist) but not with cimetidine (H2 antagonist). This fact gives new support to the concept that histamine exerts its pathological effect on nasal mucosa at least partly via an afferent nervous pathway of the trigeminal nerve.

Desperate beachgoers formed a human chain to battle "treacherous and dumping" waves to save a boy from drowning.Twelve-year-old Joshua McQuoid was caught by a wave and swept out while playing with a friend at the beach on Napier's Marine Parade in New Zealand at 4.55pm on Sunday.The first two officers who braved the conditions, they are extremely admirable and displayed a lot of bravery getting into the surf.A German tourist went to the boy's aid but was unable to keep a hold of him, a police spokesman said. The conditions were described as "treacherous with dumping waves and an extremely strong undertow".Beachgoers form a human chain to try and rescue a boy.A police officer then swam to the boy but was unable to hold him due to the heavy surf. He was joined by a few members of the public who tried to help.AdvertisementA second officer entered the water and reached the boy, at times losing hold of him as the boy went underwater.He was under for "considerable periods of up to 20 seconds at a time and fading fast", police said.Dramatic rescue: Joshua McQuoid. Photo: SuppliedAbout 12 members of the public and four police officers then desperately grabbed hold of each other to form a human chain, managing to pull the boy to shore. Initially he was "unresponsive, physically spent, and could not move unaided".He was moved up on to the beach where members of the public gave him first aid.Joshua's father, Shane, said the family was grateful to the members of the public and the police who helped in the rescue."I just wish I could thank each and every one. Without them basically my son wouldn't be here."Joshua was at the beach with Hikiroa Ratapu and another friend when the wave knocked them both down, Mr McQuoid said."I think they had their feet in the water and from what Josh said he turned around to speak to his mate when the wave hit."It knocked them down, and his mate and another girl managed to haul themselves out of the water but [Josh] got swept in."Mr McQuoid said Hikiroa was his "little hero"."He realised he couldn't go into the water so he just turned around and started yelling out to people. He was our little hero. That's when they started running to help."Joshua tried to swim to shore but kept getting dragged out and quickly tired while trying to stay afloat as waves broke over him, Mr McQuoid said. "His exact words were he felt like he was in a washing machine."Senior Sergeant Mike Stevenson said the actions of the police officers were "admirable"."The first two officers who braved the conditions, they are extremely admirable and displayed a lot of bravery getting into the surf."If they had not done what they had done I'm positive the boy may not still be with us."He said the stretch of coastline was "notorious", and was characterised by a "pretty steep drop off, thumping waves and really strong undertow".The two police officers, who became exhausted by the surf, were also helped to shore.Mr McQuoid said it showed how dangerous the beach was. "I had talked to him about that beach before and what it can be like with big waves."The boy was taken to Hawke's Bay Hospital by ambulance and later discharged.The family visited the police afterward where they saw video from a witness."The waves were just huge and the force of [them]. It smashed down and dragged back," Mr McQuoid said.Mr Stevenson said he was proud of the heroism displayed by both the first two officers plus the members of the public who helped.Fairfax NZ News

Quad/Graphics Expands Service Footprint with Bluestem Brands Quad/Graphics, Inc. has signed a multi-year agreement with Minneapolis-based Bluestem Brands, Inc., best known for its growing Fingerhut and Gettington.com brands. The agreement, which will exceed $135 million over its contract term, covers all printing, paper procurement, premedia, and page layout and production services as well as all product photography and video content creation services. In addition Bluestem Brands will benefit from system integration and efficiencies through the use of Quad/Graphics’ proprietary Catalog Studio content management and workflow solution. “This new agreement expands our service footprint with this major multi-brand retailer and represents an end-to-end solution,” said Joel Quadracci, Quad/Graphics Chairman, President & CEO. “Under the agreement, Quad will implement a new onsite facilities management arrangement where our employees will work directly with Bluestem’s merchandisers and creative team on page layout and production. In addition, they will utilize our Catalog Studio solution to manage content, streamline workflows and gain efficiencies.” To support Bluestem’s photography and video content creation needs, Quad/Graphics will relocate its existing studio and premedia production center to a larger facility in the Minneapolis area. “Video is a fast-growing part of the online and mobile catalog environment and our Bluestem agreement supports our continuing investment in video services, which are the perfect complement to digital photography,” Quadracci said. “Having both photography and video produced in the same location by Quad/Graphics is going to be a major benefit to Bluestem and a differentiator for us as we continue to enhance our catalog production capabilities.” Chidam Chidambaram, Bluestem’s Chief Marketing Officer, says Quad/Graphics integrated solutions approach will help Bluestem streamline production in many areas. “Quad has been our printer for many years as we have grown our Fingerhut and Gettington.com brands,” Chidambaram said. “As we planned for future growth, Quad demonstrated an innovative approach through its integrated workflow solutions. It will help us better support our brand strategies, control our overall costs and get to market faster.”

This morning I found out via a tweet sent out by nature enthusiast James Wilson that ‘One of the biggest and most floriferous Magnolias in Ottawa is this Merrill Magnolia (Magnolia x loebneri ‘Merrill’) is on the horticulture grounds at Algonquin College. It is 30 feet tall and 30 feet wide. It is in full bloom today.’. Oooh, gotta check that out! Then I thought of another wonderful bunch of Magnolias in the Arboretum. So, for lovers of these wonderful smelling flowers, here’s a 10km bike route starting from the amazing display in the Arboretum to the Merrill Magnolia at Algonquin College. The ride is almost entirely along multi-use pathways. The Arboretum magnolias are just off the gravel path at the northern end of the Arboretum near Prince of Wales Drive. After checking out the beautiful display in the Arboretum, I followed the gravel road that heads up the hill alongside Prince of Wales Drive. The gravel along this dirt road is usually packed, but can be a bit unpredictable throughout the year. Alternatively one could cross Prince of Wales at the signalised pedestrian lights and ride along the paved shoulder/unprotected bike lane along Prince of Wales, as noted by the purple line on the map, but car and truck traffic along Prince of Wales is pretty speedy as it’s a popular commute route. From the traffic circle at the top of the hill I headed west along the National Capital Commission (NCC) Scenic Driveway. Unfortunately the Experimental Farm Pathway only starts a few hundred meters along the NCC Scenic Driveway, just in front of the big red barn, and there is no shoulder or bike lane along the section between the traffic circle and the barn. However the sidewalks are paved. After riding a short distance along the pathway beyond the barn I turned onto quiet Morningside Lane and then west again along equally pleasant Cow Lane that cuts through fields on either side. Then it’s back onto the pathway, on the other side of Ash Lane. One confounding little spot for those travelling along the Experimental Farm Pathway for the first time is the continuation of the pathway across Fisher Avenue. This is because the path on the west side of Fisher is not alligned with the path on the east side. Instead it starts a short distance north, and is very poorly indicated or noticeable from the east side. Beyond this little navigational mess the Experimental Farm Pathway continues merrilly through a myriad of wonderful landscapes, all the way to Woodroffe Avenue. Across Woodroffe the path takes on a different name – the Pinecrest Creek Pathway – which I followed for a short distance down a hill around a curve before taking the exit that traverses the Transitway. Once across the transitway the path curls up and under Baseline Road. I got off the path at College Ave and headed over the bridge towards Woodroffe Avenue. Unfortunately there are no bike lanes over this bridge but the sidewalks are extra wide. the Algonquin College horticulture grounds are right across Woodroffe on the southeast corner of Woodroffe and College Avenue, but there isn’t even a sidewalk, let alone a bike lane or paved shoulder along College Avenue to get you to the horticulural grounds official entrance. Traffic along this short stretch of College Ave is often speedy as drivers take the wide curve coming off the 6 lane Woodroffe Ave. Fortunately there is no fence blocking access onto the horticultural grounds so I rode along a short stretch of grass directly from the corner of Woodroffe & College to the very nice brick path that meanders through the horticultural gardens. I followed this path around to the east side of the green houses, where sits the glorious Merrill Magnolia. I highly reccomend checking out this multi-sensory beauty. The gentleman on site said there may be a week left of bloom as long as there is no overnight frost before then. Sheer coincidence, that gentleman happened to be James Wilson, who’s initial tweet inspired this ride! Turns out James teaches horticulture at the college and was just starting a class when I arrived. One can also follow this same route throughout the summer to visit the Horticultural grounds which are quite beautiful. Et voila! Share this: Twitter Facebook Like this: Like Loading... Related

As the Spring went on, it became quite clear that Felix Doubront – for whatever reason – was not seriously being considered for the rotation. And then, as Spring went further on, it became relatively clear that he wasn’t being considered for much of a significant role, even in the bullpen, at all. So today’s news that the Chicago Cubs have released Felix Doubront is not a huge surprise. Without any minor league options left, the Cubs were probably going to have to go this route if there wasn’t a trade to be had anyway. By releasing Doubront today, the Cubs owe him just 45 days termination pay on the $1.925 million deal he signed (arbitration-level contracts are not entirely guaranteed) before the season. Thus, the Cubs will save about $1.45 million with this move, which is apparently more than they could have recouped in any kind of trade. Doubront, 27, is now a free agent. The Cubs took a flier on him last year – it cost shortstop prospect Marco Hernandez – and it didn’t work out. The Cubs’ Spring roster is now down to 38 after the Doubront release and the Eric Jokisch option.

This invention relates in general to drive train assemblies for transferring rotational power from an engine to an axle assembly in a vehicle. In particular, this invention relates to an improved structure for providing a seal between two telescoping members in a slip yoke assembly adapted for use in such a vehicle drive train assembly. In most land vehicles in use today, a drive train assembly is provided for transmitting rotational power from an output shaft of an engine/transmission assembly to an input shaft of an axle assembly so as to rotatably drive one or more wheels of the vehicle. To accomplish this, a typical vehicular drive train assembly includes a hollow cylindrical driveshaft tube. A first universal joint is connected between the output shaft of the engine/transmission assembly and a first end of the driveshaft tube, while a second universal joint is connected between a second end of the driveshaft tube and the input shaft of the axle assembly. The universal joints provide a rotational driving connection from the output shaft of the engine/transmission assembly through the driveshaft tube to the input shaft of the axle assembly, while accommodating a limited amount of angular misalignment between the rotational axes of these three shafts. Not only must the drive train assembly accommodate a limited amount of angular misalignment between the engine/transmission assembly and the axle assembly, but it must also typically accommodate a limited amount of axial movement therebetween. A small amount of such relative axial movement frequently occurs when the vehicle is operated. To address this, it is known to provide one or more slip yoke assemblies in the drive train assembly. A typical slip yoke assembly includes first and second splined members which are connected to respective components of the drive train assembly. The splined members provide a rotational driving connection between the components of the drive train assembly, while permitting a limited amount of axial misalignment therebetween. In some instances, the first splined member may be provided on the end of a yoke member connected to a universal joint assembly, while the second splined member may be connected to a portion of the driveshaft of the drive train assembly. As is well known in the art, most slip yoke assemblies are provided with one or more seals to prevent the entry of dirt, water, and other contaminants into the region where the splined members engage one another. Such contaminants can adversely affect the operation of the slip yoke assembly and cause premature failure thereof Exterior seals are typically disposed on the outer surface of the slip yoke assembly to prevent contaminants from entering into the region where the splined members engage one another from the exterior environment. A number of external seals are known in the art for use with conventional slip yoke assemblies. For example, a typical exterior seal includes a rigid annular housing which is mounted on the outer surface of the female splined member. A resilient annular seal is supported on the housing and extends radially inwardly into sliding and sealing engagement with the outer surface of the male splined member to provide the seal. Another example of an external seal is a convoluted boot which is positioned over the splined members of a slip yoke assembly. One end of the convoluted boot is fastened to the female splined member and the other end is fastened to the male splined member. The length of the convoluted boot can expand or contract to accommodate the axial movement between the splined members of the slip yoke assembly. Several structures are known in the art for mounting the rigid annular housing of a seal or the ends of a convoluted boot. In one known structure, the ends of either the seal housing or an end of the convoluted boot and the female splined member are formed having mating threads which allow the seal housing or the end of the convoluted boot to be threaded onto the end of the female splined member. In another known structure, a portion of the seal housing or the end of the convoluted boot is crimped or otherwise deformed about the end of the female splined member. In yet another known structure, a band clamp or other mechanical fastener is used to retain the seal housing or the end of the convoluted boot on the end of the female splined member. Although these known structures have been effective, it has been found that they are relatively expensive or time consuming in structure and installation. Thus, it would be desirable to provide an improved structure for providing a seal between two telescoping members in a slip yoke assembly adapted for use in such a vehicle drive train assembly which is relatively simple and inexpensive in structure and installation.

Rafael Benítez’s side have secured promotion to the top tier but plenty of questions remain about the future direction of the club Rafael Benítez and Newcastle United are back in the Premier League – but have they underachieved or overachieved this season? And, most importantly, what happens now? Why did it take so long to confirm promotion? Given that Benítez invested £55m in 12 players last summer (although he achieved a £30m transfer profit after raising £85m in sales from his newly relegated squad) many neutrals expected Newcastle to be up by March at the latest. In contrast, those with intimate knowledge of the Championship believe Benítez has worked wonders, fully earning his £5m-a-year salary. They point out that, during the previous five seasons, only one side, Burnley, have secured immediate automatic promotion the year after dropping out of the Premier League. Chris Hughton, who has taken Brighton up and also won the Championship with Newcastle in 2010, ranks among those who believe the second tier is infinitely tougher than seven years ago, with players considerably fitter and, thanks to advances in match analysis techniques, managers better prepared tactically. Rafael Benítez puts owner Mike Ashley on notice after Newcastle are promoted Read more The Tyneside challenge was further complicated by the reality that opponents viewed trips to St James’ Park, with its invariable 52,000 full houses, as “cup finals” and raised their game accordingly. Visitors also tended to turn up in packed defence mode, which does not suit either Newcastle’s or their manager’s preference for playing on the counterattack. Will the club be sold in the coming weeks? Watch this space. It is quite possible that nothing will happen and Newcastle simply continue under Mike Ashley’s ownership but senior club sources acknowledge that there has been discreet interest from assorted parties in recent months. If – and it is only an if – a takeover does happen, expect it to be as sudden and unexpected as Manchester City’s switch to Emirati control. Possible buyers? Well, the state of Qatar is reportedly weighing up purchasing a Premier League club and rumours of Chinese interest refuse to disappear. Ashley would demand a high price, and is sufficiently contrary to suddenly decide to keep the club, but purchasers are attracted by those 52,000 crowds, Newcastle’s international reach – the former chairman Freddy Shepherd may have exaggerated slightly when he once claimed his was the world’s eighth most popular team but the club are undeniably high profile – their rare city-centre location in a regional capital and, of course, the transformative presence of Benítez. Will Benítez stay? The million-dollar question. In January – when Ashley refused to allow his manager to buy the winger and central midfielder he craved – the former Liverpool and Real Madrid manager indicated he could well depart this summer. Benítez, long admired by, among others, West Ham United, would not lack offers but the January frosting of relationships has long since thawed. Indeed, harmony is said to now be restored, with two recent transfer summits to discuss summer spending having proceeded “positively”. Facebook Twitter Pinterest Rafa Benítez has plenty of admirers at other clubs. Photograph: Adam Davy/PA Critically, the manager appears to have regained charge of recruitment, with the influence of Graham Carr, the once powerful chief scout who has Ashley’s ear, much diminished. The big concerns are that Benítez and Ashley rarely speak directly and that the former is keener on buying the odd player older than 25 than the latter. Benítez’s affection for the club and the city runs deep and he would like nothing better than to stay at St James’ Park, win a trophy and take Newcastle back into the Champions League – but he is not a complete romantic and will walk if things are not to his liking. The problem is Ashley and the Spaniard like to be in control, and Benítez is perhaps far too practised a political operator for the owner’s comfort. Last summer Ashley’s edict to club staff was: “What Rafa wants, Rafa gets” but the mood music is no longer quite the same. How important is the manager staying to the club’s future? They say no one is indispensable but Newcastle fans would tell you that Benítez is the exception to the rule. His amalgam of tactical shrewdness, smart man management and genuine warmth – (long term “Rafaology” students say he is revealing his “human side” much more these days) – have helped re-connect previously fractured bonds, between club, supporters and city. A regular at football related community events on Tyneside, Benítez has invested the job with the sort of class and dignity not seen since Chris Hughton’s days at St James’ Park. Significantly his CV dictates he possesses the sort of “pulling power” capable of attracting some of Europe’s best players to Newcastle but will Mike Ashley facilitate a top tier “Rafalution”? The Spaniard is clearly not quite sure as, with promotion secured, the politics have begun in earnest. “You never know,” he said when asked on Monday night to confirm he would still be in charge come August. “That is football. I’m really pleased to be here. Hopefully we can put in the foundations for something that will be a guarantee for the future. I am sure if we do the right things, we can prepare everything to be strong enough for the Premier League.” The subtext will not be lost on Ashley. Does the squad need overhauling? Most definitely. Benítez bought players specifically to win promotion but if he is to keep the team in the top division, let alone achieve his ambition of taking Newcastle back into Europe, major surgery will be required. It has been agreed that a minimum of six recruits are needed, with a centre-half, a left-back, a holding midfielder, a creative midfielder, a winger and a couple of strikers looming large on the managerial shopping list. Who might Benítez buy? Time will tell but there are a few clues to be going on with. Bas Dost, the prolific Sporting Lisbon player, is a striker he tried to sign last summer and could do with now – but the Dutchman would not come cheap. Carr, incidentally, is also a Dost fan, having urged Ashley to buy him for years. Swansea City’s Gylfi Sigurdsson is another at the pricey end of the radar, while Crystal Palace’s Andros Townsend returning to Newcastle seems a real possibility. Hull City’s midfielder Sam Clucas and their centre-half Harry Maguire have been scouted by Newcastle and Benítez is said to also like the Stoke City defender Ryan Shawcross as well as Middlesbrough’s Ben Gibson. Facebook Twitter Pinterest Could a return for Andros Townsend be on the cards? Photograph: Lindsey Parnaby/EPA Further forward, a move for Liverpool’s Daniel Sturridge has been discussed and Newcastle have conducted background checks on the character of Burnley’s principal striker, Andre Gray. Benítez remains very enthusiastic about the creative midfield talents of Fulham’s Tom Cairney and Manchester City’s Fabian Delph has been mentioned but the second ruptured cruciate ligament sustained by the Bournemouth striker Callum Wilson may remove him from the equation, scuppering a long-mooted move. Newcastle United crush Preston North End to seal return to Premier League Read more Who from the existing team should prosper in the Premier League? Jonjo Shelvey, Matt Ritchie and Ciaran Clark. Isaac Hayden could also develop into a useful top-flight midfielder and Karl Darlow surely deserves a chance in goal. After scoring so many goals, Dwight Gayle, too, should play a part but it is not entirely inconceivable that he could be sold on for a profit to fund signings. Expect plenty of departures, however. Will Benítez be able to take Newcastle back into Europe? Why not? Europe represents the Spaniard’s natural habitat and an arena he feels Newcastle should be competing in. But, barring a takeover, it all depends on the scale of Ashley’s vision.

Synthesis of new cholesterol- and sugar-anchored squaraine dyes: further evidence of how electronic factors influence dye formation. [reaction: see text] Synthesis of new quinaldine-based squaraine dyes linked to cellular recognition elements that exhibit near-infrared absorption (>740 nm) are described. Both product analysis and theoretical calculations substantiate the interesting electronic effects of various substituents in the dye formation reaction. These results are useful in the synthesis of symmetrical and unsymmetrical squaraine dyes that can have potential biological and photodynamic therapeutical applications.

"(DOCTOR WHO THEME)" "The power's still dropping, Vorg." " What are you doing?" " I wish I knew..." "Routine maintenance, your worship." "Aaagh!" "Eradicator detachment, stand by!" " It's one of the Tellurians." " It must be eradicated." "He hasn't done anything." "Are you all right?" "Don't touch it." "It's crawling with germs." "He's right." "The thing must be destroyed." "Eradicator detachment, one charge, maximum intensity..." " Wait!" " Stand aside, Kalik." " This procedure is not in order." " Not in order?" "The eradicator cannot be used without authority." " In an emergency..." " One alien is hardly an emergency." "The function of this tribunal is to keep this planet clean." "This creature comes from outside our solar system and is a carrier of contagion." "The creature may be hostile." "Will you stop referring to me as the creature?" "Or I may become exceedingly hostile." "Silence!" "The tribunal is deliberating." "The tribunal is not deliberating." "The tribunal is arguing." "Quite nonsensically, if I may say so." "The tribunal will not tolerate insolence from unauthorised life forms!" "Will one of you kindly explain to me where I am?" "Which planet, I mean." "You are on Inter Minor." "Inter Minor?" "Not Metebelis 3, the blue planet of the Acteon Galaxy?" "Oh, no." "I see." "Thank heavens the Tardis is safe anyway." " This container is yours?" " Yes, it is indeed." "Ah, yes." "Just as I thought." "A miniscope." "This is outrageous." "Who is responsible for this?" "Is it yours?" "Certainly not." "It is the property of this Lurman." "The female is his assistant." "And you, sir?" "You are?" "Chairman Pletrac of the Admissions Tribunal." "One wonders why the tribunal is submitting to questioning." "Shouldn't it be the other way round?" "I'm sorry to have to tell you, but you are all in very serious trouble." "One almost admires its audacity." "You are, I take it, the representatives of authority here?" "One's authority comes direct from President Zarb himself." "You have allowed the importation of a machine that is forbidden by inter-galactic law." "One did not allow it!" "One is deporting the Lurmans and their machine." "But the machine is here and it is in operation." "You cannot deny that." "Well, strictly speaking, one must concede that, in a sense..." "Then you are responsible, are you not?" "As a direct result of your carelessness, my young companion is trapped inside this machine in extreme peril." "One must remind you that the question before this tribunal is your eradication as a menace to public health." "If you'll allow me to rescue my young companion and give what help I can to the unfortunates in here," "I'm prepared to overlook the matter." "One is indeed overwhelmed." "If not...then you'll just have to take the consequences." "Let me know when you've made up your mind." "Marvellous, Shirna." "What audacity, eh?" "I believe he's one of us." "One of us?" "He's a Tellurian." "He's in the carnival business, I'm sure." "Look at his manner and his clothes." "I've worked many a Tellurian fair." "You may be right." "He's got the style." "I'd wager on it." "He's got the measure of these grey-faced idiots." "One is against this whole thing." "One might have expected that from you, Kalik." "Orum, are you for or against the use of the eradicator?" "Against." "You are outvoted, Pletrac." "Very well." "Eradicator detachment, stand down." "Thank you for your timely intervention, sir." "Wait!" "Where are you going?" "Just over there." "You're very nervous, Pletrac." "Not nervous so much as puzzled." " What use is the Tellurian to you?" " Of no use." "You never do anything without a reason." "Why did you save its life?" "Out of mercy and compassion." "Vorg will tell you." "I bet he understands the parlare." "Listen." " Eh?" " The Tellurian carnival lingo." "Parlare la carny?" " I beg your pardon?" " Varda the Bona Palone?" "I'm sorry." "Niente dinari round here, y'jills." "I must apologise." "I'm afraid I do not understand your language." "You understand, all right." "You're a showman like me." "Are you a showman?" "Allow me to introduce myself." "I am the Great Vorg." "This beautiful young lady is Shirna, my assistant." "Delighted, Miss Shirna." "I am the Doctor." "Great title." "Doctor, Professor always pulls them in." "Are you in charge of this disgraceful device?" " Yes." "Why?" "Something wrong?" " Yes." "Very wrong." "I too have an assistant, and she's trapped inside this machine." "Somehow I've got to get her out." "I wouldn't put your hand in there." "The Drashigs can take a lump out of you." " Drashigs?" " They followed you." "They're running wild inside there." "Doing terrible damage." "The stato fields are gone." "I'm going to lose the collection." "Lose them?" "That would be a tragedy." "Yes." "My insurance doesn't cover the replacement of livestock." "Livestock?" "!" "Let me tell you, the people inside that ship are human beings!" "Tellurians, Ogrons." "Marvellous collection." "The collection of the simplest life forms is a dubious pursuit, sir, but the collection of civilised intelligent beings is a crime!" "I warn you that I intend to put an end to this shameful business." " It's putting an end to itself." " What does that mean?" "It's packing up." "All the support systems are going." "The power is almost down to critical." " How long will it last?" " Who knows?" "Not much longer." "Then every living creature in there will die, including my assistant!" "I've got to find a way of saving them." " Have you seen her?" " Not this side." "She can't get away." "We'll get a search party together." "What is the Tellurian doing?" "Trying to rescue the other Tellurian, one imagines." " They are clearly social creatures." " And harmless." "Pletrac is growing suspicious." "If he should decide to examine the eradicator, he will discover that one has rendered it useless." "You worry too much." "Zarb still decrees the death penalty for acts of treason." " Have you destroyed the part?" " What part?" " From the eradicator." " You mean the trizon." "Yes, it's here." "We will conceal it in the Lurman's baggage." "Then if anything should go wrong, one of us can discover it." "Of course." "Blame it on the Lurman." "An alien spy and saboteur." "Doctor?" "Doctor, are you there?" "There she is!" " Now then, miss..." " All right." "I know the routine." "You know, Shirna, he could lose that nose of his just like that." "Vorg." "That's odd." "The Drashigs!" "If they get out, they'll expand to full size." "Come on." "It's time we left." " Where are you going?" " Where?" " Home." " We thought we'd take a shuttle." "A transporter will take you and your machine to the thruster base." "We can find our own way." "You can keep the Scope." "You will remain here until the transporter arrives!" "The quarantine regulations on the conveyance of aliens are explicit." "You will be taken in a transporter which will then be disinfected." "Disinfected?" "Back." "Back!" "Back!" " I'm going to lock you in here..." " Until the Captain sees me." "I know." "Right." "Sensible girl." "Vorg?" "Doctor, I shouldn't stay near the Scope." "The Drashigs..." "Vorg, I need your help." " I've got to get back inside." " What?" "It's the only way to get Jo out and save your "livestock"." "I need you to trigger the settings." " Settings?" " This is your machine, isn't it?" " Of course." " Then you know how it works?" " He won it, Doctor." " He what?" "During the Great Wallarian Exhibition." "Wallarians are great gamblers." "Vorg had the Magnum pod concession." "Three Magnum pods and a yarrow seed." "Quickness of the hand deceives the eye..." "Yes, I've seen it." "So you won this machine?" "And you don't know how it works?" "I see." "This Wallarian that you got it from, did he give you a green or a blue disc - a thing about this big?" "He gave me a few odds and ends." "They're in my bag." " Go and have a look." " What's the idea, Doctor?" "It's simple, really." "The Scope's Omega circuit is broken." "If I can link it to the Tardis, I can reprogramme the Scope." " What will that do?" " Two things." "It will enable me to get Jo out of this wretched contraption, and return the others to their original co-ordinates." " Back to where they came from?" " I hope so." "Is this it?" "A bit mucky." "Yes." "Thank heavens you kept it." "I'll tell you what I want you to do." "Would you mind just waiting there for a moment?" "Do nothing till you get the signal." "Is that clear?" "Good." "About your business." "The transporter must arrive shortly." "So you think my plan has failed?" " One is conscious of certain flaws." " Indeed?" "One gathers the intention is the escape of these Drashigs in order to cause a disaster that will reflect badly upon Zarb." " Admirably put." " One has sabotaged the eradicator in order the leave the city defenceless?" "Precisely." "The bigger the disaster, the better for us." "But is it not possible that one might become part of that disaster?" "There is a certain minimal risk." "One has no wish to be devoured by alien monstrosities, even in the cause of political progress." "When the Drashigs burst out, the city will be taken by surprise." "We, on the other hand, will be ready to remove ourselves from danger." "One trusts the removal will be speedy." "The Lurman said the ferocity of the Drashigs is formidable." "No doubt he exaggerates." "I'm sure, as commissioners of Inter Minor, we'll be more than a match for these primitive life forms." "Have no fear, Orum." "My plan will not fail." "It will if the Drashigs don't escape!" "And there's no sign of that." "Sshh!" "Isn't there?" "They'll never break through those plates." "They're molectic bonded disillum." "Perhaps one better give them a little help." " Will it work, Doctor?" " Of course it will." " It's not very well insulated." " Then don't touch any metal." "Listen to me." "This is the phase one switch here." "This is the phase two." "Don't touch that till the last possible moment." "Got that." "Phase one, phase two." " What are you doing?" " He's going back in the Scope." "You will remain here." "You came here illegally." "Regulations demand you be sent to the ICCA." "What's the ICCA?" "The Inner Constellation Corrective Authority." " Prison?" " You admit you are a vagabond." "Oh, yes, yes, very much so." "Phase one." "Stop!" " Oh, no!" " We'll never get him back now!" " Can you fix it?" " I don't know." "All these wires!" " You must try." " I'm doing my best." " The Doctor's relying on us." " Put your finger on there." " Here?" "Ow!" " Good." "That's the live terminal." "Doctor?" "Doctor, can you hear me?" "Jo?" "Jo, is that you?" "Doctor!" "Doctor, where have you been?" "Stop asking silly questions and come on." "Haven't you found that sprock yet?" "I think you've lost that too." "You'll have to hurry." "The transporter's due." " Keep Pletrac busy." " One will try." "Orum." "Is this part of something, Vorg?" " Where did you get that?" " Your bag." "What is it?" "I haven't seen one of these since my national service days." "The old 14th Heavy Lasers." "What an outfit!" "Our battery sergeant was a Crustacoid mercenary..." "Vorg!" "The power's almost critical." "Is the phase two switch ready?" "I've just got to fix this junction box." " Come on, Jo." " I can't..." " Come on!" " I can't get my breath." "The circuits are going." "Come on, Jo!" "One last effort." "We're nearly there." "Daddy..." "Claire." " Oh, Daddy." " My dear." " What's the matter?" " Help me." "Heat exhaustion." "I should never have brought her out here." "The transporter has arrived at last?" " Time to get the aliens aboard." " Why was it delayed?" "The Functionaries at the depot are refusing to work double shifts." "What impudence!" "They are getting above themselves." "We live in troubled times." "Oh, do get out of the way, Orum." "(ROARING)" "Quick!" "The eradicator!" "Sabotage!" "Run for your lives!" "This way!" "Vorg, here!" "Look out!" "Vorg...." "Vorg." "The phase two switch." " Well, that's that." " What about the Doctor?" " It must be too late." " Well, we can try." "If you like." "It's no use." "The power's completely gone." "No..." "No, wait a minute." "(LOW HUMMING)" " I'll have to switch it off." " You can't." "Well, that's it, then." "No, wait!" "It worked!" "Hello, Vorg." "You cut that a bit fine, didn't you?" "We had a spot of bother here." "Doctor?" "It's all right, Jo." "We've made it." "What about the others?" " Others?" " On the ship." "I reversed the settings and linked them to the Tardis." " They should still be on the ship." " Back in 1926 in the Indian Ocean?" "Exactly." "(KNOCKING)" " Who is it?" " Only me." " I didn't wake you, did I?" " No." " I just wanted to say goodnight." " I've been reading." " Have you finished it?" " Yes." "Seems like the longest book I ever read." "It does seem to have been a long trip somehow." " Daddy?" " Yes?" "Oh..." "Nothing." "Disappointing ending, you know." "Fellow became a missionary." "I thought he'd marry her." "You are an old romantic, aren't you, Daddy?" "I bet half your stories about the East are romances." "You'll see for yourself tomorrow." "Bombay." " I'm looking forward to it." " I don't think young Andrews is." "That's what I mean, you see, romantic." " Goodnight, Daddy." " Goodnight, my child." "Sleep well." "The second monster was barrelling in at 90 degrees, and I swung like this, you see, keeping low, and I gave him a quick burst right in the vitals." "We are all extremely grateful." "Your valour will not be forgotten." "It's my natural reaction to fight." "Our President will wish to honour our Lurman guests for their courage." "A decoration, perhaps?" "How will we live?" "The Scope's had it and we've no credit-bars." "Leave that to me." "I say, Pletrac, let me show you a little trick." "Sorry." "Now, I have here three Magnum pods and a yarrow seed." "Now, I place the seed under the middle pod, like so." "Now, I move them very, very slowly." "Watch." "(VORG) Are you watching?" "You tell me which pod you think the seed is under." " The middle one." " The middle one?" "You wouldn't like to wager a couple of credit-bars on your judgement?" "Certainly." "One will wager two credit-bars that it's under the middle pod." "One can hardly discount the evidence of one's eyes." "Oh." "You're unlucky." "One was obviously too hasty." "One will not make the same mistake again." "Another little wager?" "Five credit-bars." "No...ten." "Whatever you say, Pletrac." "Thank you." "I'm going to like it here." "You remind me of the Wallarians." "They're great sportsmen too." "I don't think we need to worry about our friend Vorg." "He'll probably wind up president!" "..Very slowly, like that." "Keep watching." "You tell me which pod you think the seed is under." "(TARDIS WHOOSHES)"

Q: How to do De-Houghing of a Hough transform'ed Image? I'm working with code found at Rosetta Code for creating a Hough transform. I now want to find all the lines in an image. To do so I need the ρ and θ values of each of the peaks in the Hough space. A sample output for a pentagon looks like this: How can I find a single [θ,ρ] coordinate for each of the 'hot spots' visible in the Hough space? A: You are finding the coordinates of the peaks and then uses the axis to scale those into [θ,ρ] coordinates. Depending on how noisy the data, how many false peaks you expect and how much time you have, there are a few ways of doing it. Easiest is to pick some level that is a a real peak, cut of all data below that and then do a center of gravity on each peak to get it's center. You could also erode/dialte the image until each peak is a single pixel.

import time import simple_queue import simple_http_client class Task(object): def __init__(self, logger, config, method, host, path, headers, body, queue, url, timeout): self.logger = logger self.config = config self.method = method self.host = host self.path = path self.headers = headers self.body = body self.queue = queue self.url = url self.timeout = timeout self.start_time = time.time() self.unique_id = "%s:%f" % (url, self.start_time) self.trace_time = [] self.body_queue = simple_queue.Queue() self.body_len = 0 self.body_readed = 0 self.content_length = None self.worker = None self.read_buffers = [] self.read_buffer_len = 0 self.responsed = False self.finished = False self.retry_count = 0 def to_string(self): out_str = " Task:%s\r\n" % self.url out_str += " responsed:%d" % self.responsed out_str += " retry_count:%d" % self.retry_count out_str += " start_time:%d" % (time.time() - self.start_time) out_str += " body_readed:%d\r\n" % self.body_readed out_str += " Trace:%s" % self.get_trace() out_str += "\r\n" return out_str def put_data(self, data): # hyper H2 if isinstance(data, memoryview): data = data.tobytes() self.body_queue.put(data) self.body_len += len(data) def read(self, size=None): # fail or cloe if return "" if self.body_readed == self.content_length: return b'' if size: while self.read_buffer_len < size: data = self.body_queue.get(self.timeout) if not data: return b'' self.read_buffers.append(data) self.read_buffer_len += len(data) if len(self.read_buffers[0]) == size: data = self.read_buffers[0] self.read_buffers.pop(0) self.read_buffer_len -= size elif len(self.read_buffers[0]) > size: data = self.read_buffers[0][:size] self.read_buffers[0] = self.read_buffers[0][size:] self.read_buffer_len -= size else: buff = bytearray(self.read_buffer_len) buff_view = memoryview(buff) p = 0 for data in self.read_buffers: buff_view[p:p+len(data)] = data p += len(data) if self.read_buffer_len == size: self.read_buffers = [] self.read_buffer_len = 0 data = buff_view.tobytes() else: data = buff_view[:size].tobytes() self.read_buffers = [buff_view[size:].tobytes()] self.read_buffer_len -= size else: if self.read_buffers: data = self.read_buffers.pop(0) self.read_buffer_len -= len(data) else: data = self.body_queue.get(self.timeout) if not data: return b'' self.body_readed += len(data) return data def read_all(self): if self.content_length: left_body = int(self.content_length) - self.body_readed buff = bytearray(left_body) buff_view = memoryview(buff) p = 0 for data in self.read_buffers: buff_view[p:p+len(data)] = data p += len(data) self.read_buffers = [] self.read_buffer_len = 0 while p < left_body: data = self.read() if not data: break buff_view[p:p + len(data)] = data[0:len(data)] p += len(data) self.body_readed += p return buff_view[:p].tobytes() else: out = list() while True: data = self.read() if not data: break out.append(data) return "".join(out) def set_state(self, stat): # for debug trace time_now = time.time() self.trace_time.append((time_now, stat)) if self.config.show_state_debug: self.logger.debug("%s stat:%s", self.unique_id, stat) return time_now def get_trace(self): out_list = [] last_time = self.start_time for t, stat in self.trace_time: time_diff = int((t - last_time) * 1000) last_time = t out_list.append("%d:%s" % (time_diff, stat)) out_list.append(":%d" % ((time.time()-last_time)*1000)) return ",".join(out_list) def response_fail(self, reason=""): if self.responsed: self.logger.error("http_common responsed_fail but responed.%s", self.url) self.put_data("") return self.responsed = True err_text = "response_fail:%s" % reason self.logger.warn("%s %s", self.url, err_text) res = simple_http_client.BaseResponse(body=err_text) res.task = self res.worker = self.worker self.queue.put(res) self.finish() def finish(self): if self.finished: return self.put_data("") self.finished = True class HttpWorker(object): def __init__(self, logger, ip_manager, config, ssl_sock, close_cb, retry_task_cb, idle_cb, log_debug_data): self.logger = logger self.ip_manager = ip_manager self.config = config self.ssl_sock = ssl_sock self.init_rtt = ssl_sock.handshake_time / 3 self.rtt = self.init_rtt self.speed = 1 self.ip = ssl_sock.ip self.close_cb = close_cb self.retry_task_cb = retry_task_cb self.idle_cb = idle_cb self.log_debug_data = log_debug_data self.accept_task = True self.keep_running = True self.processed_tasks = 0 self.speed_history = [] self.last_recv_time = self.ssl_sock.create_time self.last_send_time = self.ssl_sock.create_time def update_debug_data(self, rtt, sent, received, speed): self.rtt = rtt self.speed = speed self.speed_history.append(speed) self.log_debug_data(rtt, sent, received) def close(self, reason): self.accept_task = False self.keep_running = False self.ssl_sock.close() if reason not in ["idle timeout"]: self.logger.debug("%s worker close:%s", self.ip, reason) self.ip_manager.report_connect_closed(self.ssl_sock.ip, reason) self.close_cb(self) def get_score(self): now = time.time() inactive_time = now - self.last_recv_time rtt = self.rtt if inactive_time > 30: if rtt > 1000: rtt = 1000 if self.version == "1.1": rtt += 100 else: rtt += len(self.streams) * 500 if inactive_time > 1: score = rtt elif inactive_time < 0.1: score = rtt + 1000 else: # inactive_time < 2 score = rtt + (1 / inactive_time) * 1000 return score def get_host(self, task_host): if task_host: return task_host else: return self.ssl_sock.host

Must Love Pekes is a blog for those who love Pekingese, their looks, their antics, their personalities. It is written by me, Linda, and I have been rescuing Pekingese for 14 years. Lots of them have gone through our home. We have loved them all. Followers Monday, July 12, 2010 OLLIE AND BUFFY Ollie and Buffy were both adopted from PVPC. They parents adore them and can't imagine what life would be without them. BORING I'm sure! The Pekes keep them very entertained! These two really love each other and they romp and play and run through the house stealing toys from each other and having tugs of war. They both love walking and visiting around the neighborhood. Oh, don't you love looking at this picture in July!! It's so hot outside (except in Australia where Lady Jicky is and it's cold there), so pretend you are sitting in the snow with Buffy and you'll cool right down. Buffy loves the snow! Ollie is on the alert-- I love his harness. Pekes should wear harnesses when they go for a walk to protect their throat. Ollie was one of my foster dogs and was adopted before Christmas several years ago. This past year, I took my grandkids up to see their house at Christmas and it's going to become a yearly tradition. I love visiting and seeing their beautiful decorations!! (Okay, is talking about Christmas making you cold-- I hope so, we can use anything to cool us down.) They all came to the Peke Picnic this year. Buffy is meeting a new friend-- it's not Starlight. It looks like Starlight the Terror, but it's not. All the Pekes at the picnic were so cute! And there I am at the picnic holding Caleb and Maggie-- Maggie was one of my foster dogs who was adopted last year. And Caleb, of course, now contributes to the blog now and then. ;-) He's our "Maryland contributor." Back at home, Buffy loves sitting in front of the window, surveying the neighborhood. Here is Buffy with Flat Stanley-- he was a school project for one of the grandkids. Buffy looks very innocent here, but don't let her fool you. She pulled Flat Stanley apart! Yes, she did! She also likes to nip at Ollie whenever he gets any attention from anyone and she won't let him get on the bed or his mom's lap without a fuss. She's such a girl! Female Pekes can try to rule! I know-- we have Queen Cranberry here! Here they all are with Flat Stanley-- I think he's still in one piece there. It was a long day-- and they're both tired. I think they're going to take a npa. I think Ollie will be asleep first. I'm Ollie and Buffy's Aunt and they are the best friends. Ollie scrapbooks with me, he sits in my lap, while Buffy sleeps on my feet. Their Mom and Dad are the best parents and I enjoy my days spent with all of them.