Datasets:
id
float64 286
2.87k
⌀ | design
stringlengths 1
92
⌀ | sequence
stringlengths 74
86
| activation_ratio
float64 0.02
60
| folding_subscore
float64 4.86
30
⌀ | num_clusters
float64 51
930
⌀ | ligand
stringclasses 3
values | switch
stringclasses 2
values | kd_off
float64 2.54
1.9k
| kd_on
float64 2.53
1.53k
| kd_fmn
float64 8.14
1.7k
⌀ | kd_no_fmn
float64 8.17
1.72k
⌀ | min_kd_val
float64 2.53
10.3
| ms2_aptamer
stringclasses 128
values | lig_aptamer
stringclasses 59
values | ms2_lig_aptamer
stringclasses 406
values | log_kd_nolig
float64 0.93
7.45
| log_kd_lig
float64 0.93
7.55
| log_kd_nolig_scaled
float64 0
6.43
| log_kd_lig_scaled
float64 -0.16
5.98
| log_AR
float64 -3.72
4.09
|
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
286 | null | AGGAAACAUGAGGAUCACCCAUGUGAGGAUAUACAAAAGAGCGAAAGAAGAAAUUAAUGUAGAAGGCACGUCAA | 0.882462 | null | null | FMN | OFF | 13.311514 | 15.084516 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.713669 | 2.588629 | 1.612322 | 1.487283 | -0.125039 |
287 | null | AGAAAACAUGAGGAUCACCCAUGUAAGGAUAUACAAACUCCAGAAAUAAAAGGAUUAAGAAGAAGGUACAUAAA | 0.839496 | null | null | FMN | OFF | 9.195925 | 10.954108 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.393715 | 2.21876 | 1.292368 | 1.117414 | -0.174954 |
288 | null | CAGGGACAUGAGGAUCACCCAUGUAAGGAUAUGCCCAAAAGAGCGACUACUAAAGGAGGCAGAAGGUACGAACG | 1.104343 | null | null | FMN | OFF | 31.550284 | 28.569287 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.352332 | 3.451583 | 2.250986 | 2.350236 | 0.09925 |
289 | null | CGAAAACAUGAGGAUCACCCAUGUUAGGAUAUGAGGAUGGUAUAGUAUACGGUGUAGAUCAGAAGGAACGGUGG | 1.014236 | null | null | FMN | OFF | 11.566959 | 11.404602 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.434017 | 2.448153 | 1.332671 | 1.346806 | 0.014136 |
290 | null | UAAGCACAUGAGGAUCACCCAUGUAAGGAUAUCCGAUCAUGCAAUCCGGAGAUCACAAGGAGAAGGUACAUGCA | 1.122512 | null | null | FMN | OFF | 33.262082 | 29.631816 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.388849 | 3.504418 | 2.287502 | 2.403072 | 0.115569 |
291 | null | CGGUGACAUGAGGAUCACCCAUGUAAGGAUAUACCGGUUGAAGAUAAUAGCGACGGCGGAAGAAGGUACCUACA | 0.809052 | null | null | FMN | OFF | 25.884433 | 31.993526 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.465534 | 3.253642 | 2.364187 | 2.152295 | -0.211892 |
292 | null | GUGAGACAUGAGGAUCACCCAUGUUAGGAUAUAAAAGGCAAACGUAAUGGCGAGGUUAAUAGAAGGAACAGAAA | 0.766622 | null | null | FMN | OFF | 11.936966 | 15.57086 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.745401 | 2.47964 | 1.644055 | 1.378294 | -0.265761 |
293 | null | GAAAUACAUGAGGAUCACCCAUGUCAGGAUAUCGGUGAGAAAGAGCAUCUCUGCGGCCCGAGAAGGGACACAGG | 0.801696 | null | null | FMN | OFF | 51.749865 | 64.550453 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.167447 | 3.946422 | 3.066101 | 2.845075 | -0.221025 |
295 | null | CGGCGACAUGAGGAUCACCCAUGUUAGGAUAUUCAGUUAACUGUGUUUGAUCGUUUGAGAAGAAGGAACGUGAG | 0.947164 | null | null | FMN | OFF | 10.164894 | 10.731929 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.373223 | 2.31894 | 1.271877 | 1.217594 | -0.054283 |
296 | null | AUAACACAUGAGGAUCACCCAUGUAAGGAUAUAGUAGCAAUGGAAAGAAAUCUAUCCUCUAGAAGGUACACGGC | 0.830304 | null | null | FMN | OFF | 15.336537 | 18.470993 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.916202 | 2.730238 | 1.814855 | 1.628892 | -0.185964 |
297 | null | AGAGCACAUGAGGAUCACCCAUGUUAGGAUAUAAGUCUGGAUCUACCUGAGCCCGAUCUUAGAAGGAACGGUGU | 1.056575 | null | null | FMN | OFF | 11.640582 | 11.01728 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.399465 | 2.454497 | 1.298119 | 1.353151 | 0.055033 |
298 | null | AAGUGACAUGAGGAUCACCCAUGUGAGGAUAUGGCUGAACAGAAAUAUGGGAAAAGAGCCAGAAGGCACGCCGG | 1.795892 | null | null | FMN | OFF | 111.891461 | 62.304111 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.132027 | 4.717529 | 3.030681 | 3.616183 | 0.585502 |
299 | null | UAAGCACAUGAGGAUCACCCAUGUGAGGAUAUGAGUGUCGGUCGAGAAGAGCGUCCAAUCAGAAGGCACAGGAU | 0.896323 | null | null | FMN | OFF | 11.551647 | 12.88782 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.556283 | 2.446828 | 1.454936 | 1.345482 | -0.109455 |
300 | null | CGAAGACAUGAGGAUCACCCAUGUAAGGAUAUUCAAAGAGCGCACCUGAAUGCCCUAUGAAGAAGGUACCGGGC | 0.745023 | null | null | FMN | OFF | 52.068912 | 69.888972 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.246908 | 3.952568 | 3.145562 | 2.851222 | -0.29434 |
301 | null | GUGAAACAUGAGGAUCACCCAUGUCAGGAUAUACUAAUGUCCGCUCGAUUGGACCUGUGUAGAAGGGACUGUGA | 1.387182 | null | null | FMN | OFF | 17.586877 | 12.678133 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.539879 | 2.867153 | 1.438532 | 1.765807 | 0.327274 |
302 | null | CACGAACAUGAGGAUCACCCAUGUCAGGAUAUCGUGCUAAUCCCAUAAUCGGCGCGCACGAGAAGGGACCAGGG | 1.538194 | null | null | FMN | OFF | 19.589527 | 12.73541 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.544386 | 2.974995 | 1.44304 | 1.873649 | 0.430609 |
303 | null | AACCGACAUGAGGAUCACCCAUGUGAGGAUAUGUUCGAGCUGGCAGGACCACCCUGGGACAGAAGGCACGUGAA | 1.578353 | null | null | FMN | OFF | 17.682038 | 11.202844 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.416168 | 2.872549 | 1.314821 | 1.771203 | 0.456382 |
304 | null | AAGCCACAUGAGGAUCACCCAUGUGAGGAUAUUCAUCUAGAUCAACAAGACACGGAUAGAAGAAGGCACGGUGG | 2.112074 | null | null | FMN | OFF | 29.49981 | 13.967222 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.636713 | 3.384384 | 1.535367 | 2.283037 | 0.74767 |
305 | null | GGGUGACAUGAGGAUCACCCAUGUCAGGAUAUGGACUCGAAAUUAGGUAUGAAUCACGCCAGAAGGGACCGGGC | 0.799085 | null | null | FMN | OFF | 43.984868 | 55.044058 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.008134 | 3.783846 | 2.906788 | 2.682499 | -0.224288 |
306 | null | CGGGCACAUGAGGAUCACCCAUGUAAGGAUAUGAACAGUUUUCACAGAGUUUCACUAUUCAGAAGGUACGUUUC | 0.861398 | null | null | FMN | OFF | 20.818602 | 24.168401 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.185046 | 3.035847 | 2.0837 | 1.934501 | -0.149199 |
307 | null | UUGAAACAUGAGGAUCACCCAUGUCAGGAUAUCUUAACCCACUUACGCGAGUGUAGCCAGAGAAGGGACAGCGG | 1.437355 | null | null | FMN | OFF | 17.361108 | 12.078513 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.491428 | 2.854233 | 1.390082 | 1.752886 | 0.362804 |
308 | null | UUGGGACAUGAGGAUCACCCAUGUCAGGAUAUAUAUAAUCUGCGCGACGAGGGAUACAAUAGAAGGGACAACGG | 0.829165 | null | null | FMN | OFF | 15.0535 | 18.15502 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.898947 | 2.711611 | 1.797601 | 1.610264 | -0.187337 |
309 | null | UGCCAACAUGAGGAUCACCCAUGUCAGGAUAUCCGGGAGCACUUCAGUAGAAUCCGCUGGAGAAGGGACAUAGG | 0.893116 | null | null | FMN | OFF | 21.719169 | 24.318425 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.191234 | 3.078195 | 2.089888 | 1.976849 | -0.113039 |
310 | null | UUACAACAUGAGGAUCACCCAUGUUAGGAUAUACGAGGGACAGCGCGGUUAUAUCCCUGUAGAAGGAACACGGG | 1.201573 | null | null | FMN | OFF | 47.591918 | 39.608023 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.679032 | 3.862663 | 2.577685 | 2.761317 | 0.183631 |
311 | null | GCUGGACAUGAGGAUCACCCAUGUGAGGAUAUGAGAAGUAUCAUGCACCCGAUCCAUCUCAGAAGGCACAGGUG | 3.607885 | null | null | FMN | OFF | 258.00797 | 71.512255 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.269869 | 5.55299 | 3.168522 | 4.451644 | 1.283122 |
312 | null | GCGGAACAUGAGGAUCACCCAUGUCAGGAUAUACGCACGGAGUAGGAGGAGGCCUAUGGUAGAAGGGACAGUGA | 0.936374 | null | null | FMN | OFF | 10.157898 | 10.848125 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.383992 | 2.318252 | 1.282646 | 1.216905 | -0.065741 |
313 | null | GGAUCACAUGAGGAUCACCCAUGUCAGGAUAUUAUGCCCUCCCAGUUGCUGAGACAUUUAAGAAGGGACGUGUA | 1.059017 | null | null | FMN | OFF | 14.277249 | 13.481604 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.601326 | 2.658667 | 1.49998 | 1.557321 | 0.057341 |
314 | null | AGGGUACAUGAGGAUCACCCAUGUUAGGAUAUGUCCGGUACGGCCGCCGUACCAGGCAACAGAAGGAACACAGC | 0.869107 | null | null | FMN | OFF | 26.232963 | 30.1838 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.407305 | 3.267017 | 2.305959 | 2.16567 | -0.140289 |
315 | null | CGAUUACAUGAGGAUCACCCAUGUCAGGAUAUAAUUUGCACAGCCGGGCAGGCCGUGGUUAGAAGGGACGUACA | 0.962221 | null | null | FMN | OFF | 8.749972 | 9.093516 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.207562 | 2.169051 | 1.106215 | 1.067704 | -0.038511 |
316 | null | CGGUCACAUGAGGAUCACCCAUGUAAGGAUAUAGAUGUCUGUGUCAACCGACGGGCUUCUAGAAGGUACGGAUG | 0.976971 | null | null | FMN | OFF | 18.133664 | 18.561109 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.921068 | 2.89777 | 1.819722 | 1.796424 | -0.023298 |
317 | null | GUGAGACAUGAGGAUCACCCAUGUUAGGAUAUUAAACUGGUUUAGUCUGUGACCGACGUAAGAAGGAACUUGAU | 0.894037 | null | null | FMN | OFF | 11.737854 | 13.129046 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.574827 | 2.462819 | 1.473481 | 1.361473 | -0.112008 |
318 | null | CUUCAACAUGAGGAUCACCCAUGUAAGGAUAUCUGCCUCACAGCACCAAAGUGCGGGAAGAGAAGGUACGUAGU | 0.942643 | null | null | FMN | OFF | 14.529627 | 15.413709 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.735257 | 2.67619 | 1.633911 | 1.574843 | -0.059068 |
319 | null | GUGACACAUGAGGAUCACCCAUGUCAGGAUAUAGGUCAGCAAAGUAACCAUGACGAGACUAGAAGGGACGCGUG | 0.736106 | null | null | FMN | OFF | 22.484021 | 30.54456 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.419187 | 3.112805 | 2.31784 | 2.011459 | -0.306382 |
320 | null | GAGCCACAUGAGGAUCACCCAUGUCAGGAUAUCGCAAGCGGGAAUAAGCCAACGUCUACGAGAAGGGACUAAUG | 1.051589 | null | null | FMN | OFF | 10.292383 | 9.787458 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.281102 | 2.331404 | 1.179755 | 1.230058 | 0.050302 |
321 | null | AGGCCACAUGAGGAUCACCCAUGUAAGGAUAUUGGAGCAUGGAAACGCUGUGCGCAUGCAAGAAGGUACACGGA | 0.829139 | null | null | FMN | OFF | 20.467249 | 24.684956 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.206194 | 3.018826 | 2.104848 | 1.91748 | -0.187368 |
322 | null | CAACGACAUGAGGAUCACCCAUGUGAGGAUAUCUACUUGAUCAGGUAACUGCUUCCGAAGAGAAGGCACGGUGA | 0.960179 | null | null | FMN | OFF | 19.539905 | 20.35027 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.013094 | 2.972459 | 1.911748 | 1.871112 | -0.040635 |
323 | null | GUGAAACAUGAGGAUCACCCAUGUUAGGAUAUAGGUAACCUAGUACAUGAUCUGCUGGCUAGAAGGAACUGGAU | 0.810344 | null | null | FMN | OFF | 11.509601 | 14.203352 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.653478 | 2.443182 | 1.552132 | 1.341835 | -0.210296 |
324 | null | AUCUAACAUGAGGAUCACCCAUGUCAGGAUAUUGCAGCCGUAGUAGGUCUAGUUUGUGCAAGAAGGGACAUCUC | 2.355426 | null | null | FMN | OFF | 22.486942 | 9.546868 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.256213 | 3.112935 | 1.154867 | 2.011588 | 0.856722 |
325 | null | UAUGUACAUGAGGAUCACCCAUGUUAGGAUAUAUGGCCGCGCUUUAAACACCGUGCACAUAGAAGGAACAUUUG | 0.963358 | null | null | FMN | OFF | 33.733396 | 35.016466 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.555818 | 3.518488 | 2.454472 | 2.417142 | -0.03733 |
326 | null | GAUCGACAUGAGGAUCACCCAUGUGAGGAUAUACCGCGGACUCCGUCUGCAUGUUAGGGUAGAAGGCACCGAGC | 0.930757 | null | null | FMN | OFF | 13.089023 | 14.062768 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.643531 | 2.571774 | 1.542184 | 1.470428 | -0.071757 |
327 | null | GCAUAACAUGAGGAUCACCCAUGUGAGGAUAUUCCCUCCGGCAAUUGCUCCCAAGAGGGAAGAAGGCACAGUGG | 0.45368 | null | null | FMN | OFF | 66.062113 | 145.613991 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.980959 | 4.190595 | 3.879613 | 3.089249 | -0.790364 |
328 | null | GGGAAACAUGAGGAUCACCCAUGUAAGGAUAUAGAAGAUUCAACAUUCAAGAAUGAGACUAGAAGGUACAGAUC | 0.883515 | null | null | FMN | OFF | 17.881538 | 20.239086 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.007616 | 2.883769 | 1.906269 | 1.782422 | -0.123847 |
329 | null | ACGGGACAUGAGGAUCACCCAUGUUAGGAUAUACGAACUUCGCCGAACGUGACCAAUUGUAGAAGGAACUUGGU | 0.814528 | null | null | FMN | OFF | 13.993936 | 17.180419 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.84377 | 2.638624 | 1.742424 | 1.537278 | -0.205146 |
330 | null | CCACUACAUGAGGAUCACCCAUGUCAGGAUAUCAACCACGCCUCUCCUUGGACGUAGAUGAGAAGGGACGUGGG | 1.682673 | null | null | FMN | OFF | 28.158612 | 16.734454 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.81747 | 3.337853 | 1.716123 | 2.236507 | 0.520384 |
331 | null | UCGGCACAUGAGGAUCACCCAUGUAAGGAUAUACGAAGCUUGCAGUCGCUGUUAUUUGGUAGAAGGUACCCUCG | 0.858586 | null | null | FMN | OFF | 12.476618 | 14.531591 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.676325 | 2.523856 | 1.574979 | 1.42251 | -0.152469 |
332 | null | AAAGAACAUGAGGAUCACCCAUGUCAGGAUAUACAAAGACGUAGCAAAGCGGACUCAAGAAGAAGGGACAAGGA | 0.788887 | null | null | FMN | OFF | 10.104066 | 12.807994 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.55007 | 2.312938 | 1.448723 | 1.211592 | -0.237132 |
333 | null | AUGUAACAUGAGGAUCACCCAUGUAAGGAUAUGCAACAAAACUCUGAAUCGUAAGUUCGCAGAAGGUACAUUAG | 0.960848 | null | null | FMN | OFF | 27.271883 | 28.383133 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.345795 | 3.305856 | 2.244449 | 2.20451 | -0.039939 |
334 | null | GACCCACAUGAGGAUCACCCAUGUCAGGAUAUCCGAUCGUCAAAGACCCAAAUAAUUAGGAGAAGGGACAUUAA | 1.031982 | null | null | FMN | OFF | 15.433409 | 14.955118 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.705054 | 2.736535 | 1.603707 | 1.635188 | 0.031481 |
335 | null | ACUAGACAUGAGGAUCACCCAUGUGAGGAUAUCUUGCUAUGCACUAUGGGCCAACGGAAGAGAAGGCACUGGGA | 2.038789 | null | null | FMN | OFF | 93.182934 | 45.705046 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.822209 | 4.534565 | 2.720862 | 3.433218 | 0.712356 |
336 | null | GUGAAACAUGAGGAUCACCCAUGUUAGGAUAUAACGCGACGGCAGGGAUCUGCGCUACUUAGAAGGAACGGGAC | 0.844627 | null | null | FMN | OFF | 9.730164 | 11.520066 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.44409 | 2.275231 | 1.342744 | 1.173884 | -0.16886 |
337 | null | UAGUAACAUGAGGAUCACCCAUGUCAGGAUAUGAGGUCUACGGCAUAAGCGAAUCGGGUCAGAAGGGACAUAAC | 0.829877 | null | null | FMN | OFF | 16.904244 | 20.369576 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.014042 | 2.827565 | 1.912696 | 1.726218 | -0.186478 |
338 | null | GCACGACAUGAGGAUCACCCAUGUGAGGAUAUACUACAUCAGGAACACGCUAUGCACGGUAGAAGGCACGGGAG | 0.955375 | null | null | FMN | OFF | 15.617667 | 16.347156 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.794054 | 2.748403 | 1.692708 | 1.647056 | -0.045651 |
339 | null | GGGAUACAUGAGGAUCACCCAUGUCAGGAUAUCUUUUACCGGCACGACAAUCAUAUGAAGAGAAGGGACUAUAU | 0.909934 | null | null | FMN | OFF | 31.878904 | 35.034301 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.556328 | 3.461944 | 2.454981 | 2.360598 | -0.094383 |
340 | null | GCGGGACAUGAGGAUCACCCAUGUGAGGAUAUGUGCAGUGGCAGGGACAGUUAAAAGUACAGAAGGCACAGCCC | 0.895741 | null | null | FMN | OFF | 17.616396 | 19.666832 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.978934 | 2.86883 | 1.877587 | 1.767484 | -0.110104 |
341 | null | AUGAAACAUGAGGAUCACCCAUGUGAGGAUAUGGUCUCGAACAAAAUACAAACACCAUCCAGAAGGCACAUGAA | 0.928735 | null | null | FMN | OFF | 27.65555 | 29.777645 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.393758 | 3.319826 | 2.292412 | 2.21848 | -0.073932 |
342 | null | UUAAUACAUGAGGAUCACCCAUGUUAGGAUAUAGAAAUCGCUGGUGCGAGAAGACAGGCUAGAAGGAACACGGA | 0.945379 | null | null | FMN | OFF | 9.619343 | 10.175119 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.319945 | 2.263776 | 1.218599 | 1.16243 | -0.056169 |
344 | null | CUCGUACAUGAGGAUCACCCAUGUCAGGAUAUUACUGUCGAGUCCAAAACUAGAAAGGUAAGAAGGGACACAUU | 1.335861 | null | null | FMN | OFF | 17.816617 | 13.337175 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.590555 | 2.880132 | 1.489209 | 1.778785 | 0.289576 |
345 | null | AACGUACAUGAGGAUCACCCAUGUGAGGAUAUGCCUAAAGAGUUCUAAGCAUCCAAGGGCAGAAGGCACAUGAA | 1.415898 | null | null | FMN | OFF | 140.351457 | 99.125373 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.596385 | 4.94415 | 3.495039 | 3.842803 | 0.347764 |
346 | null | UAGUAACAUGAGGAUCACCCAUGUGAGGAUAUCUGGCUAGGCUAAAGCAGAGAAACCAAGAGAAGGCACGGGAU | 1.074784 | null | null | FMN | OFF | 20.828869 | 19.37959 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.96422 | 3.03634 | 1.862874 | 1.934994 | 0.07212 |
347 | null | GGUUGACAUGAGGAUCACCCAUGUGAGGAUAUAACAAGUGGGAGCUCUCCAUGAAAAGUUAGAAGGCACUUGGU | 0.856275 | null | null | FMN | OFF | 52.910742 | 61.791769 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.12377 | 3.968606 | 3.022424 | 2.86726 | -0.155164 |
348 | null | GGUGCACAUGAGGAUCACCCAUGUGAGGAUAUGUGAAACGAGCUGAAUGCCAACCAAAACAGAAGGCACAAUGG | 1.037135 | null | null | FMN | OFF | 18.990309 | 18.31036 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.907467 | 2.943929 | 1.806121 | 1.842582 | 0.036462 |
349 | null | UAUGUACAUGAGGAUCACCCAUGUCAGGAUAUCUUCGAUUAGACCAUUAGCGCCGCGGAGAGAAGGGACGUAGA | 0.944236 | null | null | FMN | OFF | 15.065741 | 15.95549 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.769803 | 2.712423 | 1.668457 | 1.611077 | -0.05738 |
350 | null | CGUGUACAUGAGGAUCACCCAUGUUAGGAUAUCUUACCAAAGUCGAGGUGACUCCGGGAGAGAAGGAACUGGCA | 1.006757 | null | null | FMN | OFF | 79.128309 | 78.597204 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 4.364336 | 4.371071 | 3.26299 | 3.269724 | 0.006735 |
351 | null | CGUCUACAUGAGGAUCACCCAUGUCAGGAUAUACACCAACAACCUUCGCGAGAUAGGUGUAGAAGGGACGGGUA | 1.538816 | null | null | FMN | OFF | 13.475171 | 8.756842 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.169835 | 2.600849 | 1.068489 | 1.499502 | 0.431014 |
352 | null | AAUACACAUGAGGAUCACCCAUGUAAGGAUAUCAAGCAUCAAACAUUAGAGUGAGGAGUGAGAAGGUACAUCAC | 0.810663 | null | null | FMN | OFF | 16.299344 | 20.106196 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.001028 | 2.791125 | 1.899682 | 1.689778 | -0.209903 |
353 | null | AUGGAACAUGAGGAUCACCCAUGUUAGGAUAUCGGCGAAGGGAGUUUUAUACUCACUGCGAGAAGGAACGUGAC | 0.743753 | null | null | FMN | OFF | 18.742031 | 25.199257 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.226815 | 2.930769 | 2.125468 | 1.829422 | -0.296046 |
354 | null | UAGGAACAUGAGGAUCACCCAUGUUAGGAUAUCGAGGUAUGGAUUAUCAUGCUGUAAGCGAGAAGGAACGUGUG | 0.963073 | null | null | FMN | OFF | 29.64266 | 30.779242 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.426841 | 3.389215 | 2.325494 | 2.287868 | -0.037626 |
355 | null | AGGGCACAUGAGGAUCACCCAUGUAAGGAUAUGGACUUUUUUGCUGUAGUAAUCAUCUCCAGAAGGUACGUCUU | 0.800944 | null | null | FMN | OFF | 19.571615 | 24.435678 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.196044 | 2.97408 | 2.094698 | 1.872734 | -0.221964 |
356 | null | ACUCGACAUGAGGAUCACCCAUGUCAGGAUAUCUGAGUGUGGCCUCCUACUAAACUAUAGAGAAGGGACAAUGG | 1.072004 | null | null | FMN | OFF | 11.021701 | 10.281399 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.330336 | 2.399866 | 1.22899 | 1.29852 | 0.06953 |
357 | null | CGCUAACAUGAGGAUCACCCAUGUGAGGAUAUUCGCGGCGGACCGGGCUUUGGCGCUCGAAGAAGGCACAACGG | 1.919808 | null | null | FMN | OFF | 24.523407 | 12.773883 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.547403 | 3.199628 | 1.446056 | 2.098282 | 0.652225 |
358 | null | GCUAGACAUGAGGAUCACCCAUGUGAGGAUAUUAGCCAAUCGAGUAAUCCGCUAUAGUUAAGAAGGCACGUGAU | 0.961016 | null | null | FMN | OFF | 16.012612 | 16.662171 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.813141 | 2.773377 | 1.711795 | 1.67203 | -0.039764 |
359 | null | CUAACACAUGAGGAUCACCCAUGUUAGGAUAUCAGCUGCAGCGCUCGACUGCAAUUUAUGAGAAGGAACUGUGG | 1.380797 | null | null | FMN | OFF | 24.193813 | 17.521624 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.863436 | 3.186097 | 1.762089 | 2.084751 | 0.322661 |
360 | null | CUCCUACAUGAGGAUCACCCAUGUGAGGAUAUCUCCCAGUGGGAAUAGUUUCCAUGGAAGAGAAGGCACAGUGA | 1.265437 | null | null | FMN | OFF | 30.852894 | 24.381211 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.193813 | 3.429231 | 2.092466 | 2.327884 | 0.235418 |
361 | null | GGUUAACAUGAGGAUCACCCAUGUUAGGAUAUGCUACAGAGUCUGGUCCCUGGAAAUGGCAGAAGGAACGUGUU | 0.940933 | null | null | FMN | OFF | 16.158742 | 17.173106 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.843345 | 2.782461 | 1.741998 | 1.681115 | -0.060883 |
362 | null | CUAGAACAUGAGGAUCACCCAUGUCAGGAUAUUCUUGGAUGCAUCCAAGCGAAAACAAGAAGAAGGGACGUAUA | 0.969712 | null | null | FMN | OFF | 10.445323 | 10.771572 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.37691 | 2.346154 | 1.275564 | 1.244808 | -0.030756 |
363 | null | GGGUAACAUGAGGAUCACCCAUGUGAGGAUAUCCAUUGUUGGCGACCGGUACGACCACGGAGAAGGCACAGUUC | 1.98825 | null | null | FMN | OFF | 69.498394 | 34.954553 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.554049 | 4.241304 | 2.452702 | 3.139957 | 0.687255 |
364 | null | UUAGCACAUGAGGAUCACCCAUGUCAGGAUAUACGGAAUGUCCUCUACAGGGCGCGCUGUAGAAGGGACCGGGC | 1.024055 | null | null | FMN | OFF | 9.759008 | 9.529765 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.25442 | 2.278191 | 1.153074 | 1.176844 | 0.023771 |
365 | null | UGGGAACAUGAGGAUCACCCAUGUGAGGAUAUCCACCGAUUUCACACGAUAGGCACAAGGAGAAGGCACACCUA | 1.067935 | null | null | FMN | OFF | 36.178433 | 33.876988 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.522736 | 3.588463 | 2.42139 | 2.487117 | 0.065727 |
366 | null | UUGUGACAUGAGGAUCACCCAUGUGAGGAUAUUCUGCUUGUGGAUAGUACGACUUGAUGAAGAAGGCACGUUAU | 0.961541 | null | null | FMN | OFF | 33.337812 | 34.671243 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.545911 | 3.506692 | 2.444564 | 2.405346 | -0.039218 |
367 | null | UCUAUACAUGAGGAUCACCCAUGUCAGGAUAUAAGCACCGGGCGAUUGUCACGCGGCCUUAGAAGGGACAGGAA | 1.648711 | null | null | FMN | OFF | 28.753021 | 17.439697 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.858749 | 3.358743 | 1.757403 | 2.257396 | 0.499994 |
368 | null | AACCUACAUGAGGAUCACCCAUGUGAGGAUAUUGCGGUUCUUAGCAUGAGAACCAUACCAAGAAGGCACAGGGC | 3.085746 | null | null | FMN | OFF | 23.230873 | 7.528448 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.018689 | 3.145482 | 0.917342 | 2.044136 | 1.126793 |
369 | null | CUCAAACAUGAGGAUCACCCAUGUAAGGAUAUCCGUAAUAAAUUUGGUAAGAGGCGGCGGAGAAGGUACGCAGC | 0.93329 | null | null | FMN | OFF | 17.876091 | 19.153844 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.952503 | 2.883464 | 1.851157 | 1.782118 | -0.069039 |
370 | null | GGUCCACAUGAGGAUCACCCAUGUAAGGAUAUCCUGUUUUCUGGUUUAGAGUCGCGAAGGAGAAGGUACAUUAA | 1.830846 | null | null | FMN | OFF | 41.123958 | 22.461718 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.111812 | 3.716591 | 2.010466 | 2.615244 | 0.604778 |
371 | null | GUGAGACAUGAGGAUCACCCAUGUAAGGAUAUUGCCUCGACCAUAUAAACAUAUCGGACAAGAAGGUACAGGAG | 0.769238 | null | null | FMN | OFF | 29.109189 | 37.841586 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.633409 | 3.371054 | 2.532062 | 2.269708 | -0.262355 |
372 | null | GGUUAACAUGAGGAUCACCCAUGUAAGGAUAUCGGGCUGUCCAGGCGAUAGUACACGUCGAGAAGGUACGCGGU | 1.122812 | null | null | FMN | OFF | 12.145378 | 10.81693 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.381113 | 2.496949 | 1.279766 | 1.395602 | 0.115836 |
373 | null | AACAAACAUGAGGAUCACCCAUGUGAGGAUAUCAAGUCCAUACCCUAAGAGGGAGUUUUGAGAAGGCACGUGUA | 1.34093 | null | null | FMN | OFF | 15.088893 | 11.252559 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.420596 | 2.713959 | 1.319249 | 1.612613 | 0.293363 |
374 | null | CGGGAACAUGAGGAUCACCCAUGUCAGGAUAUACGCGAUGGCAACAGUGAUUGUUUGUGUAGAAGGGACUUACG | 0.908413 | null | null | FMN | OFF | 30.241727 | 33.290707 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.505278 | 3.409223 | 2.403932 | 2.307876 | -0.096056 |
375 | null | AGAAGACAUGAGGAUCACCCAUGUGAGGAUAUUACACUAGAAAACAGCCGCGUCUCGGUAAGAAGGCACUAUGG | 1.080476 | null | null | FMN | OFF | 36.59653 | 33.870757 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.522552 | 3.599953 | 2.421206 | 2.498607 | 0.077401 |
376 | null | GAUUUACAUGAGGAUCACCCAUGUGAGGAUAUGCCGUACAUCGCGCUCUGAGCUAGUUGCAGAAGGCACAUGAU | 0.969661 | null | null | FMN | OFF | 18.297962 | 18.870465 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.937598 | 2.90679 | 1.836252 | 1.805443 | -0.030808 |
377 | null | GAUUCACAUGAGGAUCACCCAUGUCAGGAUAUGACUUGAGCUGUCUCCGAUCGAGCCAUCAGAAGGGACUGGAA | 0.923817 | null | null | FMN | OFF | 27.751004 | 30.039501 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.402513 | 3.323272 | 2.301167 | 2.221926 | -0.079241 |
378 | null | AGGCAACAUGAGGAUCACCCAUGUCAGGAUAUAGUAAACACAAAUACGAGAAAUAUAACUAGAAGGGACAUAAU | 1.110595 | null | null | FMN | OFF | 18.478673 | 16.638539 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.811722 | 2.916617 | 1.710375 | 1.815271 | 0.104896 |
379 | null | UUUAUACAUGAGGAUCACCCAUGUGAGGAUAUAAAGGCGGACACUGCUGUCGAUCGCUUUAGAAGGCACUGGAU | 1.260408 | null | null | FMN | OFF | 19.958407 | 15.834874 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.762215 | 2.99365 | 1.660868 | 1.892304 | 0.231436 |
380 | null | UGGUCACAUGAGGAUCACCCAUGUAAGGAUAUCCGCGCCAUAGAGGAAAAGACGGUAUGGAGAAGGUACAGCUU | 0.899808 | null | null | FMN | OFF | 26.909883 | 29.906258 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.398068 | 3.292494 | 2.296721 | 2.191147 | -0.105574 |
381 | null | GCGGAACAUGAGGAUCACCCAUGUAAGGAUAUCGUGAGGGAACGGCAGCAACACUGAUCGAGAAGGUACAGGGC | 1.584093 | null | null | FMN | OFF | 36.43329 | 22.999467 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.135471 | 3.595483 | 2.034125 | 2.494137 | 0.460012 |
382 | null | GAUCAACAUGAGGAUCACCCAUGUCAGGAUAUGCAGACAGUCUUUACGUCAGUCGUAAGCAGAAGGGACUACGG | 1.326564 | null | null | FMN | OFF | 69.612617 | 52.475895 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.960354 | 4.242946 | 2.859008 | 3.141599 | 0.282592 |
383 | null | CCUCAACAUGAGGAUCACCCAUGUCAGGAUAUCUAGGAGACAUCACAUGCGUCCGAUGAGAGAAGGGACACAGU | 1.097078 | null | null | FMN | OFF | 27.489609 | 25.057105 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 3.221157 | 3.313808 | 2.119811 | 2.212462 | 0.092651 |
384 | null | GAUCAACAUGAGGAUCACCCAUGUUAGGAUAUCACACCGGAAAGUGAAAUGCUUUUCUUGAGAAGGAACAAGGC | 0.920501 | null | null | FMN | OFF | 7.278473 | 7.90708 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.067759 | 1.984921 | 0.966412 | 0.883575 | -0.082838 |
385 | null | UGACCACAUGAGGAUCACCCAUGUCAGGAUAUAGGUACACUGGUACAGCCUUUUCGGCCUAGAAGGGACUCUCU | 0.925737 | null | null | FMN | OFF | 8.416776 | 9.091978 | null | null | 3.008213 | .....(((((x((xxxx))))))).................................................. | ........................(xxxxxx(............................)xxxxx)....... | .....(((((x((xxxx)))))))(xxxxxx(............................)xxxxx)....... | 2.207392 | 2.130227 | 1.106046 | 1.028881 | -0.077166 |
386 | null | ACCGAUCGAGGAUAUACAGAACAAAAGAACAUGACGAAGAAACAUGAGGAUCACCCAUGUAGAAGGCGAAAAGA | 1.055289 | null | null | FMN | OFF | 9.04982 | 8.575679 | null | null | 3.008213 | .........................................(((((x((xxxx))))))).............. | .......(xxxxxx(.............................................)xxxxx)....... | .......(xxxxxx(..........................(((((x((xxxx))))))))xxxxx)....... | 2.14893 | 2.202745 | 1.047584 | 1.101399 | 0.053815 |
388 | null | AAGAGCAGAGGAUAUACAUAGGCAUCAGUUGAAGCAGCUGAACAUGAGGAUCACCCAUGUAGAAGGCUGACAAA | 1.342661 | null | null | FMN | OFF | 7.287602 | 5.42773 | null | null | 3.008213 | .........................................(((((x((xxxx))))))).............. | .......(xxxxxx(.............................................)xxxxx)....... | .......(xxxxxx(..........................(((((x((xxxx))))))))xxxxx)....... | 1.691521 | 1.986175 | 0.590175 | 0.884828 | 0.294654 |
EternaBench-Switch
EternaBench is a database comprising the diverse high-throughput structural data gathered through the crowdsourced RNA design project Eterna, to evaluate the performance of a wide set of structure algorithms.
Disclaimer
This is an UNOFFICIAL release of the EternaBench-Switch by Hannah K. Wayment-Steele, et al.
The team releasing EternaBench-Switch did not write this dataset card for this dataset so this dataset card has been written by the MultiMolecule team.
Example Entry
ID | design_name | sequence | structure | reactivity | errors | signal_to_noise |
---|---|---|---|---|---|---|
769337-1 | d+m plots weaker again | GGAAAAAAAAAAA... | ................ | [0.642,1.4853,0.1629, ...] | [0.3181,0.4221,0.1823, ...] | 3.227 |
Column Description
The EternaBench-Switch dataset consists of the following columns, providing crucial insights for understanding RNA stability for vaccine design:
ID: A unique identifier for each RNA sequence entry.
design_name: The name given to each RNA design by contributors, used for easy reference.
sequence: The nucleotide sequence of the RNA, using standard bases.
structure: The predicted secondary structure of the RNA, represented using dot-bracket notation. The structure helps determine the likely secondary interactions within each RNA molecule.
reactivity: A list of floating-point values that provide an estimate of the likelihood of the RNA backbone being cut at each nucleotide position. These values help determine the stability of the RNA structure under various experimental conditions.
errors: Arrays of floating-point numbers indicating the experimental errors corresponding to the measurements in the reactivity. These values help quantify the uncertainty in the degradation rates and reactivity measurements.
Related Datasets
License
This dataset is licensed under the AGPL-3.0 License.
SPDX-License-Identifier: AGPL-3.0-or-later
Citation
@article{waymentsteele2022rna,
author = {Wayment-Steele, Hannah K and Kladwang, Wipapat and Strom, Alexandra I and Lee, Jeehyung and Treuille, Adrien and Becka, Alex and {Eterna Participants} and Das, Rhiju},
journal = {Nature Methods},
month = oct,
number = 10,
pages = {1234--1242},
publisher = {Springer Science and Business Media LLC},
title = {{RNA} secondary structure packages evaluated and improved by high-throughput experiments},
volume = 19,
year = 2022
}
- Downloads last month
- 48