Datasets:

moukaii

/

Tuberculosis_Dataset

like 16

PMC4926288_01

Male

Herein, we describe the case of a man, 60 years old, never smoker, peddler, born in Morocco but resident in Italy for almost 30 years with sporadic return to his country, with worsening dyspnea since 2008, diffuse arthralgias and nodules tending to ulceration at distal phalangeal joints of his hands and feet. Due to pain and severe functional limitation, at this site, between 2008 and 2012 the patient underwent several surgical amputations of fingers: the distal phalange of the third finger of his left foot, the distal phalanges of second, third and fourth fingers of his right hand and the distal phalange of first finger of his right foot (Fig. 1). In all these cases, pathological examination described a chronic granulomatous flogistic process, that involved entirely all the anatomical structures (from bone to skin), with epitelioid histiocytes, multinuclear giant cells surrounded by lymphocytes, and in some granulomas central necrosis (Fig. 2). The lesions tended to recur in other fingers of his hands and feet, and at proximal metacarpophalangeal joints of fingers amputated of distal parts; in addition, for several years a rubbery non erythematosus nor painful plaque was present, without modifications in the left perimalleolar region (Fig. 3). Because of the persistence of symptoms and the concomitant appearance of chronic chest pain with dyspnoea, the patient came to our attention with the suspect of a systemic granulomatous disease, so that sarcoidosis, mycobacteriosis and Hansen disease were taken into account. Routine blood tests were normal for age and sex, except the increase of CA-19.9, (53 U/mL, n.v. <39 U/mL). Chest X-ray showed a tenuous opacity in right supra-diaphragmatic area. This finding was not confirmed at the high resolution chest tomography (HRCT), in which parenchyma of lung was normal, while mediastinal lymph nodes were enlarged. A subsequent chest contrast CT confirmed the presence of enlarged lymph nodes tending to conglutination and with calcifications inside. Ecg was normal, while echocardiography showed a little trans-tricuspid regurgitation and an assessed PAPs of 25 mmHg. Neurological examination was normal. Eye examination did not show significant pathologic findings. Blood gas analysis was normal for age, six minutes walking test was performed without pathological desaturation and with an appropriate distance walked in relation to age and sex; a spirometry with DLCO was performed, reported as normal in relation to age, sex and haemoglobin value. Mantoux skin test and IGRA test (Elispot-TB) were negative. PET/CT scan total body was performed showing amount of radiotracer in upper lobe of right lung (SUV max 4,01), mediastinal nodes (SUV max 6,70), skeleton in several upper and lower limbs' bones segments and metacarpophalangeal joints of his hands and feet. On the basis of these findings a bronchoscopy was executed with transbronchial needle aspiration (TBNA) of mediastinal affected lymph nodes, bronchoalveolar lavage (BAL) and bronchoaspiration for cytological and microbiological examination, including M. Tuberculosis and other mycobacterium species; pulmonary CD4/CD8 ratio was less than 3,5. Biopsies of finger nodules and perimalleolar plaque were performed for pathologic and microbiological tests, including amplification of microbial DNA by PCR technique. The results confirmed the same granulomatous aspect of nodules previously removed, without any evidence of microbial presence. Given the clinic and laboratory results, the patient was treated with prednisone per os at the dose of 0.5 mg/kg/die for one month, reducing the dose to 0.35 mg/Kg/die after one month, and finally to 0.2 mg/Kg/die in the third month. After one month of therapy, a reduction of inflammation was observed, the nodules seemed to be brighter and much less painful; whereas in the third month, we found a total healing, with scar formation. After six months from the beginning of therapy, blood tests were normal; a new PET/CT revealed the 18 F-fluorodeoxyglucose uptake in the region of mediastinum with a maximum SUV of 3.8 with a SUV lower than first PET/CT in the fingers of his hands; chest HRCT was unmodified. The patient is still in clinical, functional and radiological follow up, and currently in stable conditions.

bronchoalveolar lavage, corticosteroid therapy, high resolution chest tomography, mediastinal lymph nodes, metacarpophalangeal joints, sarcoidosis-systemic granulomatous disease

PMC6827600_01

Male

Here, we report the case of a 59-year-old man with acute myeloid leukemia (AML) arising in August 2017 from a 5q- myelodysplastic syndrome treated with lenalidomide. A Mito-FLAG induction scheme (G-CSF from day -1, fludarabine 60 mg/die days 1-5, cytarabine 2 g over 3 h every 12 h days 1-5, mitoxantrone 12 mg/die day 1, 3 and 5) followed by two cycles of consolidation chemotherapy were administrated (Mito-FLAG again and one cycle with high-doses-cytarabine); meanwhile a donor search was started. In March 2018, after a TBF reduced-intensity conditioning regimen (thiotepa 390 mg day -6, busulfan 240 mg/die days -5 and -4; fludarabine 80 mg day -3) the patient underwent allogeneic HSCT from a matched unrelated donor. Micafungin was used for fungal prophylaxis. Rabbit-derived anti-thymocyte globulins infusion (2.5 mg/Kg days -3, -2, -1), cyclosporine A (3 mg/Kg, continuous infusion from day -1) and methotrexate (30 mg day +1 then 20 mg days +3 and +6) were administered for GvHD prophylaxis. Since the diagnosis of AML to HSCT a total of 47 units of red blood cells were transfused, deferasirox (an iron-chelating agent) was started two months before HSCT producing a ferritinemia reduction from 2713 to 1489 ng/ml few days before the beginning of conditioning regimen; deferasirox administration was stopped during the transplant procedure. Day +1 from HSCT, the patient complained, on the right side of the face, a sharp pain mimicking trigeminal neuralgia and responsive to high doses of morphine. CT scan of brain and sinuses showed a picture of pansinusitis. At day +2, after a sudden onset of fever, empirical antibacterial therapy (piperacillin/tazobactam plus amikacin) and antifungal therapy with liposomal amphotericin B (L-Amb) were started. Diplopia occurred in day +6, a palsy of VI right cranial nerve was detected plus a sensitive deficit of V cranial nerve of the same side. Magnetic resonance imaging (MRI) of brain and sinuses plus MR angiography with contrast dye showed the presence of a mycetoma in the right sphenoidal sinus associated with thrombophlebitis of the cavernous sinus, thrombosis of the superior ophthalmic vein and possible involvement of temporal meninges in contiguity with the bone cavity. Blood indirect biomarkers for the detection of a fungal infection (1,3-beta-D-glucan and galactomannan) were negatives over the entire period. Antifungal therapy was reinforced, a combination of L-AmB at the dosage of 7.5 mg/Kg/die plus iv isavuconazole (ISC) 200 mg (375 mg of isavuconazonium sulfate equivalent to 200 mg of ISC) every 8 hours for six doses followed by 200 mg/die was started. Day +11, the patient, still in aplasia (WBC 10/mm3, Hb 7.0 g/dl, platelets 10000/mm3), underwent a procedure of endoscopic sinus surgery (ESS) after transfusions of blood components with no complications. The cultural and histological examination does not reveal presence of hyphae; Rhizomucor was identified by amplification and sequencing of two Internal Transcribed Spacer regions (ITS1 and ITS2) in rRNA gene. The Sanger sequencing was performed after amplification using ITS1-Forward and ITS4-reverse primers. The patient achieved myeloid engraftment at day +16 and became afebrile. The trigeminal neuralgia regressed although the VI right cranial nerve palsy persistence, antibiotics were stopped and the combined antifungal therapy was continued. A new MRI, at day +41, revealed the presence of a brain mycotic abscess with associated vasogenic cerebral edema of the right temporal lobe (Figure 1). Although the involvement of the cavernous sinus was detected, an excisional neurosurgery intervention of the cerebral abscess was not undertaken considering the procedural high-risk balanced to the benefits of an incomplete drainage. The patient was discharged, ISC was switched to oral formulation, and L-AmB was administered in an outpatient setting for 74 days in total. Cyclosporine administration was stopped one month after transplantation for fear to promote Rhizomucor growth and further dissemination. The general condition of the patient worsened; he lost 30 Kg of weight in total, parenteral nutrition was started. We were forced to introduce steroid therapy (prednisone 1 mg/Kg/die) for severe gastrointestinal, cutaneous and ocular GvHD. Because the response of cutaneous GvHD to steroids was not adequate, extracorporeal photoapheresis was started with benefit. Megestrol acetate, an orexigenic, was dispensed to treat cachexia. ISC dosage was increased to 300 mg/die in consideration of ISC plasma concentrations (Figure 2); deferasirox was reintroduced in therapy. At six months from HSCT, a new MRI of the brain showed the reduction of the para-cavernous abscess with partial reabsorption of the purulent quote and temporal lobe edema (Figure 1). Complete thrombosis of the right internal carotid artery was detected but patient remained completely asymptomatic for it. We decided to continue antifungal therapy with ISC at 300 mg/die then we reduced the dosage to 200 mg/die based on therapeutic drug monitoring (TDM). Patient's mood improved and body weight with it, he started to have a complete meal and to walk again with crutches. Palsy of VI right cranial nerve regressed almost completely; prednisone was reduced and maintain to a dose of 10 mg/die for hepatic and intestinal GvHD. Revaluation of bone marrow at one year from HSCT confirmed full donor chimerism. Brain MRI revealed further reduction of the endocranial mycotic abscess (8 x 3 mm), no purulent quote was present. In accordance with clinical improvement we considered it a full response, and we decided to stop isavuconazole after 354 days of treatment.

deferasirox, isavuconazole, liposomal amphotericin b, rhino-orbital-cerebral mucormycosis, therapeutic drug monitoring

PMC10192905_01

Female

HIV photodermatitis with widespread vitiligo-like depigmentation is rarely reported. We reported a photodistributed lichenoid drug eruption with depigmentation in an HIV-infected man on treatment for a second episode of tuberculosis. The rash initially developed during the first course of tuberculosis treatment and resulted in areas of depigmentation and hyperpigmentation. On reexposure to the same regimen to treat the second episode of tuberculosis, there was recurrence with violaceous patches within the depigmented areas from the first episode. On completion of the second regimen, repigmentation was considerably better than after the first episode. Phillips et al. reported a 60-year-old man ART naive man with advanced HIV (CD4 count of 7 cells/microl) who presented with a photodistributed, pruritic eruption associated with extensive depigmentation surrounded by hyperpigmentation. Histology revealed a spongiotic dermatitis with abundant eosinophils. A similar case was described involving a Ugandan woman with advanced HIV (CD4 count of 2 cells/microl) occurring one month after initiation of ART with stavudine, lamivudine, and nevirapine. Most areas repigmented after the regimen was changed to zidovudine, lamivudine, and efavirenz. The authors postulated that the photodistributed depigmentation was due to a photosensitizing effect of either the ART or cotrimoxazole; with the ART being more likely. Histology was not reported. All three cases were of Fitzpatrick skin phototype V or greater. Depigmentation has also been reported in chronic lichenoid photo eruptions in HIV patients with a low CD4 T-lymphocyte count <50 cells/microl. We reported an HIV-infected man with low CD4 count and multidrug-resistant tuberculosis developed a generalised lichenoid eruption that progressively worsened and depigmented after initiating tuberculosis treatment. Treatment was continued under the cover of sun protection, potent topical corticosteroids, and PUVA to induce hardening. He completed nine months of treatment and soon afterwards the depigmentation reversed gradually. Photosensitivity with depigmentation prior to the diagnosis of HIV, has also been reported. The presentation was marked by scaling, erythema, and concurrent vitiligo-like depigmentation of the face, arms, and hands. The condition improved with the use of sunscreen and topical steroids. The differential diagnosis of photodermatitis with vitiligo-like depigmentation includes discoid lupus erythematosus (DLE), vitiligo, and lichen simplex chronicus. To differentiate from DLE there is an absence of scarring and histology does not demonstrate an interface dermatitis. The immunodeficiency, photo distribution, and histology demonstrating spongiotic dermatitis with eosinophils distinguish HIV photodermatitis from vitiligo. Likewise, the photo distribution and absence of lichenification exclude lichen simplex chronicus. Actinic lichen planus is a morphologic variant of LP that predominantly affects sun-exposed areas and has a high prevalence in darker skin. Three variants of actinic LP have been described, namely annular, pigmented, and dyschromic, in that order of their frequency. The annular variant presents as annular erythematous brownish patches or plaques with or without atrophy. The major feature of the pigmented variant is the presence of melasma-like pigmentation. Dyschromic-type actinic lichen planus presents as whitish pinhead-sized and coalescent papules. HIV seems to have a stronger association with photolichenoid eruptions. In a series of 32 patients with histologically confirmed lichenoid eruption or photodermatitis, 12/32 were HIV infected, and in all 12, the lesions were photodistributed. Photosensitive drugs are chromophores that absorb photons and undergo chemical reactions. The chemical structure of the chromophore determines the wavelengths of radiation it absorbs, with most reactions being caused by UVA rather than UVB. Drug-induced photodermatoses in the setting of HIV include phototoxic, photoallergic, and photolichenoid reactions. Drugs most commonly associated with photosensitization include amiodarone; chlorpromazine; thiazide diuretics; tetracyclines; quinolones, particularly nalidixic acid; nonsteroidal anti-inflammatory drugs derived from propionic acid, voriconazole and vemurafenib, a B-Raf enzyme inhibitor used in the management of late-stage melanoma. ART, antituberculosis drugs, sulphonamides, and antifungals, all drugs used to treat HIV and associated opportunistic infections, have at least one drug or a class of drugs that has been reported to be a photosensitizer. Efavirenz, an ART drug, has been reported to cause a photodistributed transient eruption. A small series of five cases in South Africa reported photodistributed annular plaques with an indurated erythematous edge as the most common presentation of the efavirenz reaction. Figures 3, 4 Histology findings were non-specific. Systemic features were mild and included a mild elevation in alanine and/or aspartate transaminases. Despite the continuation of efavirenz, the majority resolved. Cotrimoxazole has been implicated in vitro as a photosensitizer, and the sulfamethoxazole component is believed to be responsible. Dapsone photoallergic dermatitis has been described in case reports. Despite its use as an alternative to cotrimoxazole for Pneumocystis jirovecii prophylaxis, there are no reports of dapsone photoallergic dermatitis in African people or HIV patients. Antifungals known to cause photosensitivity include voriconazole, itraconazole, ketoconazole, and griseofulvin. Itraconazole reactions include a sunburn-like reaction, most likely phototoxic with decreased MED and negative photopatch tests. Voriconazole photosensitivity includes sunburn-like erythema, hand hyperpigmentation, linear papulo-vesicular lesions, erythroderma, discoid lupus erythematosus, actinic cheilitis and pseudoporphyria. Most reactions occurred in patients receiving long-term immunotherapy, however, there is no data reported in the HIV infected population. There are reports of the development of squamous cell carcinoma and melanoma in voriconazole-induced sites of photosensitivity. Amongst the drugs used to treat tuberculosis, photodistributed eczematous eruption due to isoniazid and pyrazinamide has been described. On discontinuing the drug, the photosensitivity usually resolves. However, persistent photosensitivity and progression to CAD have been reported. Photolichenoid drug reactions seem to be more common in HIV-infected people than in the general population and in this setting often pose major management challenges. In a case series of 32 patients in San Francisco, with a histologic diagnosis of lichenoid eruption or photodermatitis, 12/32 were HIV infected, and all 12 were photodistributed. Exposure to known photosensitizing drugs preceded the eruption in 10/12. Patients with pigmented skin and advanced HIV disease (CD4 < 50 cells/microl), were disproportionately affected. Histologically 9/12 showed lichenoid reaction, 2/12 had features of lichen nitidus, and 1/12 was eczematous. Two of those with lichenoid reactions on histology developed marked depigmentation. No cases of lichen planus were found in the HIV-infected group. The authors suggested that previous cases of classic lichen planus in HIV may represent lichenoid photodermatitis. Anti-tuberculosis medications, including isoniazid and pyrazinamide, have been reported to cause a lichenoid and/or photo lichenoid eruption. The pathogenesis is unclear but may be due to delayed hypersensitivity. LDR presents as purple itchy papules becoming confluent and hyperpigmented with continuing exposure to the offending drug. It is often photodistributed and lacks mucosal involvement Figures 5, 6. The interval between drug initiation and the rash ranges from days to years, with most cases occurring within months. On drug withdrawal, the lesions resolve with persistent hyperpigmentation, often lasting for many years. Although photolichenoid eruptions may be related to photosensitizing agents, there seems to be no association or changes in minimal erythemal dose. Photolichenoid reactions have been reported for isoniazid, confirmed by positive photopatch testing and oral rechallenge. Due to the lack of acute markers and delayed resolution of symptoms and signs of the reaction it is often difficult to identify the offending drug. Due to the relative urgency of treating tuberculosis in HIV and the limited number of effective safe drugs, all the drugs are sometimes continued with supportive care until completion of treatment in those with active tuberculosis. Porphyria cutanea tarda (PCT), the most common form of porphyria, is caused by a deficiency of the fifth enzyme of the heme biosynthesis pathway, uroporphyrinogen decarboxylase (UROD). Decreased UROD activity leads to the overproduction of porphyrins in the liver. PCT is a cause of chemical-induced phototoxicity caused by sunlight interacting with endogenous porphyrins within the body. Clinically, these manifest in the third to fourth decade of life with photosensitivity, skin fragility, and blisters. The blisters occur in photodistributed sites particularly the face, V of the neck, and dorsa of the hands, and are associated with scarring and milia Figures 7, 8. Other features include hyperpigmentation, hypertrichosis, and rarely sclerodermoid changes. Earlier studies suggested a causal association between HIV and PCT. While the mechanism of PCT in HIV is still not fully understood, it is thought to be due to changes in porphyrin metabolism and liverinjury in the setting of co-infection with hepatitis C. It is now postulated that in most HIV-infected patients with PCT, hepatitis C and not HIV may induce a decrease in UROD activity. Drug exposure influences PCT. Amongst first-line antituberculosis drugs, rifampicin is the most likely to be associated with PCT. We recently encountered an HIV-infected man who presented with PCT after initiating rifampicin, isoniazid, pyrazinamide, and ethambutol. Based on published reports, we decided to replace rifampicin with rifabutin, a similarly effective rifamycin with less effect on the liver. The photosensitivity and blistering improved until he completed the remaining four months of his six-month course of treatment. Diagnosis of PCT can be confirmed by histology and porphyrin levels. Histologically, PCT is characterized by a cell-poor subepidermal blister, festooning of the dermal papillae, and thickening and hyalinization of the dermal blood vessel walls. Additional features include caterpillar bodies and dermal sclerosis and a mild infiltrate of perivascular mononuclear cells in the upper dermis. These features are not specific to porphyria and can also occur in pseudoporphyria syndromes. The most important diagnostic test to diagnose porphyria remains porphyrin levels in serum, urine, and stool. Pellagra, as mentioned earlier is a nutritional disease caused by the deficiency of niacin (also known as vitamin B3). Clinically pellagra is characterized by photodermatitis with gastrointestinal symptoms and neuropsychiatric ailments. Pellagra can be fatal if not timeously recognized and treated. Erythema is the initial clinical feature, and this evolves into hyperpigmentation, dryness, scale, lichenification, and fissuring. On the dorsum of the hands and forearms this is referred to as the gauntlet or glove sign. Asimilar feature on the lower extremities is called the boot sign. The development of fissures on the hands and feet surface is called goose skin. The eruption surrounding the base of the neck is called the Casal's collar or necklace Figure 9. In severe cases blistering occurs within the lesions and this is referred to as wet pellagra which tends to heal with scarring. Additionally, lesions may develop over bony prominences, perineum, and scrotum. The eruption usually presents as erosions with burning pain that intensifies on palpation. HIV as well as isoniazid, pyrazinamide, and ethionamide have been shown to cause pellagra or pellagra-like disease. It is thus even more important to recognize and prevent pellagra in HIV-infected people on treatment for tuberculosis, particularly breast-feeding women and young children. Breastfed infants receiving isoniazid should also receive pyridoxine 1 mg/kg daily. There is a general consensus that chronic photosensitization is associated with an increase in the development skin cancer. This risk is determined by the Fitzpatrick skin type, age at which photosensitizer was used, duration and severity of photosensitization, immunosuppression, the photosensitizing agent/drug, and spectrum of UV absorption amongst others. Azathioprine, a photosensitizing immunosuppressant, used after solid organ transplant and inflammatory disorders is associated with an increased risk of squamous cell carcinoma (SCC) by additionally producing mutagenic reactive oxygen species on the skin and an additional risk of SCC on the skin. In transplant patients, the risk is estimated to be higher by the magnitude of 65-250 times. This is still applicable when comparing immunosuppressive regimens that incorporate azathioprine and those that do not. On the other hand, mycophenolate mofetil, a non-photosensitizing immunosuppressant of similar potency, reduces the incidence of SCC in this setting. Other photosensitizing drugs that have been associated with an increased risk of skin cancer include thiazides, angiotensin-converting-enzyme inhibitors, cotrimoxazole, tetracyclines, and azoles. On the other hand, long-term use of NSAIDs including those that are photosensitisers, seems to reduce the risk of developing cutaneous SCC. Photosensitivity also has a direct relationship with photoaging. Concerns about the adverse effects of using light therapies like lasers are not supported by any published reports. This further supports the view that photosensitivity as described is wavelength specific. A recent systematic review that included 19 studies found that between 31% and 39% of photosensitive patients suffered a very large impact on their quality of life. Employment, education, social and leisure activities, and clothing choices were most affected. The study also confirmed that the levels of anxiety and depression were twice those of the general population. Involvement of the face, being female, and an earlier age of onset were associated with significantly more severe psychological morbidity. This study confirmed findings from multiple previous studies and highlights the hidden toll of photosensitivity on sufferers. There are limited data on the psychosocial impact of photosensitivity focusing on pigmented skin. The additional impact of more severe dyspigmentation is likely to exacerbate the psychosocial impact of photosensitivity in this population, more so if HIV-infected as both these are independent predictors of poorer quality of life and psychosocial morbidity.

hiv, actinic dermatitis, photodermatitis, photodermatoses, photosensitivity, pigmented skin

PMC10033739_01

Male

A 26-year-old male with HIV was referred from a local secondary level hospital with a presumptive diagnosis of infective endocarditis. Four days prior, he had presented complaining of a one-week history of fever, cough and dyspnoea. He reported a history of regular injection drug use, injecting a substance known locally as "nyaope" (a form of black tar heroin often combined with other active substances that may include crystal methamphetamine, cocaine, cannabis and antiretroviral medications such as efavirenz and ritonavir). He had been diagnosed with HIV two years previously and was taking a fixed-dose antiretroviral therapy (ART) combination of tenofovir, emtricitabine and efavirenz since that time, with poor self-reported adherence. Of note, he had no history of tuberculosis or any AIDS-defining opportunistic infections. On examination, his temperature was 36.9 C, heart rate 110 beats per minute, blood pressure 85/73 mmHg, respiratory rate 36 breaths per minute, and oxygen saturation 80% on room air (99% on a rebreather mask at 15 L/min). He was pale, had digital clubbing and "track marks" on his forearms indicating recent injection drug use. His cardiac examination revealed a raised jugular venous pulsation and a soft first heart sound with a pan-systolic murmur over the tricuspid and mitral valves. He had scattered crackles over his lung fields bilaterally with a mild hepatomegaly. A chest radiograph showed an enlarged cardiothoracic-ratio, and his 12- lead electrocardiogram revealed a sinus tachycardia with evidence of left atrial enlargement. He was assessed as being in cardiac failure and was initiated on diuretics. The white blood cell count was 15.35 x 109/L (reference range, 3.92 - 10.40); absolute lymphocyte count 1.11 x 109/L (reference range, 1.40 - 4.20); absolute neutrophil count 11.13 x 109/L (reference range, 1.60 - 6.98); haemoglobin 7.6 g/dL (reference range, 13.4 - 17.5); platelet count 61 x 109/L (reference range, 171 - 388); C-reactive protein was 27 mg/L (reference <10 ); procalcitonin 2.72 ug/L (reference range <0.1); creatinine 73 umol/L (reference range, 64 - 104); total bilirubin 34 umol/L (reference range, 5 - 21); conjugated bilirubin 24 umol/L (reference range, 0 - 3); alanine transaminase 226 U/L (reference range, 10 - 40); aspartate transaminase 226 U/L (reference range, 15 - 40), alkaline phosphatase 191 U/L (reference range, 53 - 128) and gamma-glutamyl transferase 68 U/L (reference, <68). A CD4 T cell count of 206 cells/uL and HIV viral load of 3640 copies/mL was on record having been done at the local ART clinic 2 weeks prior to presentation. Serology for hepatitis B was negative, however hepatitis C infection was confirmed by a quantitative polymerase chain reaction (PCR) with a viral load of 149000 IU/mL. Sputa sent for tuberculosis work up were negative for acid-fast bacilli on microscopy and negative on GeneXpert MTB/RIF PCR. The first blood culture, taken on presentation, flagged positive after 21 h of incubation in the BacT/ALERT 3D (BioMerieux, Marcy l'Etoile, France) automated blood culture machine. The Gram stain showed Gram-negative bacilli and the positive culture was plated out onto 5% blood, CHOC and MacConkey agar and incubated at 35 C +- 2 C. Monomicrobial growth was noted on all three plates after approximately 18 h of incubation. The colony morphology on the MacConkey plate was of a non-lactose fermenter, with mid-sized, flat, translucent colonies with entire borders. The isolate was oxidase negative and identified using the API20E (BioMerieux, Marcy l'Etoile, France) system as Salmonella spp. (confidence level 99%). Confirmation serotyping with polyvalent O antigen was positive and the Salmonella Vi antigen was negative, and a laboratory identification of "Salmonella spp., non-typhoidal" was released. Antibiotic susceptibility testing was done using the Kirby-Bauer method. Antibiotic susceptibility showed a pan-susceptible isolate, and co-trimoxazole, ampicillin, ciprofloxacin (greater than 31 mm), ceftriaxone and chloramphenicol were released on the report. A repeat pair of blood cultures was received two days later, with one flagging positive for Salmonella spp. after 77 h of incubation and the other being negative for growth after 5 days. The two Salmonella isolates were referred to the national reference laboratory for serotyping. Both isolates were confirmed as Salmonella enterica subsp. enterica serovar Enteritidis (S. Enteritidis) using whole genome sequencing. Having been started empirically on ampicillin, cloxacillin and gentamicin on admission, antimicrobial therapy was adjusted to ampicillin and ciprofloxacin. Trans-thoracic and trans-oesophageal echocardiography revealed severe mitral and tricuspid valve regurgitation complicated by pulmonary hypertension (Fig. 1). Mitral valve perforations and vegetations were visible confirming the diagnosis of infective endocarditis (Fig. 1) and the indication for urgent valvular surgery. During the patient's workup for mitral valve replacement surgery (which was not available at our hospital) he developed acute limb ischaemia of his left forearm. An urgent computed tomography angiogram revealed occlusion of the left radial artery and an open arterotomy and thrombectomy was performed, restoring perfusion to his hand with a good clinical outcome and no consequent tissue or functional loss (Fig. 2). Thereafter, the patient was transferred to another hospital for mitral valve surgery. A mitral valve replacement was performed using a Hancock II bioprosthetic mitral valve (Fig. 3) and the patient was transferred back to our hospital one week post-operatively. During his admission he received physiotherapy, social worker support and ART adherence counselling. He received a total of 6 weeks of ampicillin and ciprofloxacin, and blood cultures were negative from 5 days after initiating targeted antimicrobials. Arrangement was made, on discharge, to continue with outpatient social support for substance addiction as well as follow up for management of his chronic hepatitis C and HIV infection.

endocarditis, hiv, hepatitis c, non-typhoidal salmonella, salmonella, salmonella enteritidis

PMC8348908_01

Female

A 41-year-old female presented with extreme shortness of breath and fatigue for the past half year. The patient reports that a lump was discovered in her chest about 7 years ago, but she did not seek care at the time. Initially, it was the size of a coin but increased to the size of a grapefruit. She reports that the shortness of breath has been present for a long time, but that over the past few months, she has experienced dyspnea even on light exertion, which severely hinders her daily life. On exam, she was afebrile, normotensive with tachycardia (108 beats per minute). Her respiratory rate was 18 breaths per minute and oxygen saturation was 93%. Cardiac exam revealed tachycardia without rubs or murmurs. Lung exam revealed normal chest excursion with clear lung sounds bilaterally without rhonchi, rales or wheezes. Chest exam revealed a hard, non-mobile non-tender nodule located at the lower aspect of her right rib. Upon admission to the hospital, a contrast-enhanced computed tomography (CT) scan revealed a mass occupying the 5th rib, with destruction of the normal bone structure of the rib (Fig. 1) and visible compression on the right heart border and deviation of the mediastinal structures. The mass was non-enhancing. Based on these findings, a primary bone tumor with low likelihood of metastasis was suspected. The tumor was removed by osteotomy of nearly the entire 5th rib, and the anterior parts of the 4th and 6th ribs. The diaphragm was also partially resected, and parts of the upper and lower lobes of the right lung were removed. The resected specimen measured 16 cm x 12 cm x 12 cm (Fig. 2). Biopsy revealed a background of stromal cells with round and ovoid shapes, cells with foamy cytoplasm, areas of necrosis, as well as the presence of multinucleated giant cells. A diagnosis of GCTB was made. Chest wall reconstruction was performed, and in a follow up visit three months later, there was no evidence of recurrence. The patient's chest CT appeared normal at that time.

anterior arc, bone tumors, giant cell tumors, osteoclastoma, rib

PMC7516064_01

Female

A 35-year-old woman was admitted to the emergency department with progressive dysphagia for 6 years. Her symptoms worsened in the last 14 days followed by vomiting undigested and retained food eaten. The patient also complained about coughing since 6 years ago and was previously diagnosed with a variant respiratory problem but her symptoms didn't improve with medication. The patient had a heartburn and a history of weight loss. On physical examination she was found to have temperature 36.6 C, a heart rate of 113 bpm, a blood pressure of 117/83 mm Hg, and respiratory rate 21 bpm. She had an appearance of multiple depigmented patches with sharply defined borders and leucotrichia on the neck, abdomen, hand, knee, and lateral malleolus (Fig. 1). The patient had vitiligo for 18 years. The lesion altered in size from small dot, were itchy, progressive, not painful, and no blister. The patient had a sister with the appearance of vitiligo. The patient underwent an upper gastrointestinal endoscopy and showed dilatation from distal oesophagus (38 cm from incisors) with retained food caused by narrowing gastro oesophagus junction (Fig. 2). The biopsy was not performed. Computed Tomography Scan Thorax revealed severe dilatation of oesophagus (diameter 4-7 cm) with narrowing in the distal level of gastrooesophagus sphincter, intraluminal fluid, shifting trachea to the right, shifting thyroid lobes to anterior and shifting left carotid artery to posterolateral left (Fig. 3). After examining the symptoms and investigations, we conclude the diagnosis as achalasia. Considering the clinical history and physical exam findings, the diagnosis of vitiligo was given. She was prescribed ranitidine and metoclopramide injection as a plan for initial management prior to surgery. Regarding the procedure, Laparoscopic Heller's myotomy was performed. The patient was placed in the French position (supine with the legs abducted on straight leg boards) with the operator stand between the legs and the surgical assistants stand one on each side of the patient. A 3-port procedure was taken, with a 10 mm port was used for camera port. The left liver lobe was retracted to the abdominal wall. We released oesophagus from crus anterior and posterior, and retracted with sling catheter modification. The myotomy of oesophagus musculature was performed with scissor and ultrasonic scissor (harmonic device) with the active blade in the upper side about 5 cm to proximal. The myotomy of the gastric side with monopolar cautery and splitting with grasper 2 cm distal to LOS. After the myotomy was made and leak testing was done with blowing the nasogastric tube, the opening of the esophagus was repaired with Dor's fundoplication (Fig. 4). A post-operative study with a barium swallow of upper gastrointestinal radiograph was carried out 5 days following surgery, in which passage from oesophagus to jejunum without leakage, and no narrowing in oesophagus gastric junction at the distal oesophagus (Fig. 5A). Patient compliance was good throughout the treatment, and we also assess patient tolerance by monitoring blood routine and vital signs. The patient was discharged from the hospital on postoperative day 8 and is undergoing follow-up as an outpatient, with no dysphagia. Five months later the patient presented back with improvement were observed in upper gastrointestinal endoscopy, with a reduction in the sigmoid shape of oesophagus, good condition of LOS, and polyp 2 mm presented in the gastric corpus (Fig. 5B).

achalasia, autoimmune disease, case report, heller laparoscopy, vitiligo

PMC6147817_01

Male

A 9-year-old male child with sickle cell disease presented with abdominal pain of four days and bilious vomiting for one day. The urine was dark and the stool was pale. Upon admission, the patient was sick and deeply jaundiced. The vital signs were stable but for a low-grade fever. The abdomen showed generalized tenderness, especially in the epigastrium and right hypochondrium. There was no organomegally. The complete blood count showed leukocytosis and reticulcytosis (Table 1). Serum electrolytes were normal. The liver function tests showed an elevated total bilirubin (TB) and direct bilirubin (DB). Alkaline phosphatase was elevated; serum amylase and liver transaminases were within normal limits. The coagulation profile showed a slight elevation versus control. The plain abdominal x-rays were normal Hemoglobin electrophoresis showed a hemoglobin-S of 90%. Abdominal ultrasonography (US) showed a contracted gallbladder with no evidence of acute inflammation, but with very doubtful small stones or sludge within. There was mild intrahepatic biliary dilatation. However, the CBD was not dilated and did not contain any stones. No free intra-abdominal fluid was seen. The spleen was not visualized. The patient was treated conservatively in the hope that a small CBD stone or sludge would pass. The patient improved within a few days. Blood culture showed no growth. Hepatitis serolog and HIV tests were negative. Ten days later, symptoms recurred. The patient became febrile (38.5 C), and total and direct bilirubin increased to 50 and 32 mg/dL, respectively. Serum amylase remained normal. Repeated abdominal U.S showed normal gallbladder and CBD but with free fluid in the peritoneal cavity. A computed tomography was normal apart from the free fluid in the peritoneal cavity and an absent spleen. Endoscopic retrograde cholangiopancreatography (ERCP) showed free flow of bile into the duodenum, no stones in the CBD and no leakage of the dye through the biliary tree. ERCP was not performed on first admission because the patient was seen in the pediatric medical service at that time. The patient improved clinically and his total and direct bilirubin declined to 18 and 12 mg/dL, respectively. Five days later, the patient became very sick with more severe symptoms and signs. The abdomen became distended and tender all over with rigidity and rebound tenderness. The patient was optimized for surgery. By laparotomy, about 500 mL of bilious ascetic fluid was drained. Operative cholecystogram showed multiple small stones in the gallbladder (GB) and distal portion of the CBD. A cholecystectomy was done and the CBD explored. Multiple small pigment stones were removed with saline irrigation. A sealing perforation was found in the mid-CHD. A T-tube (T-T) with a long proximal limb was inserted to stint the perforation site and the perforation was repaired with absorbable sutures. An omental patch was used to support the repair site. A repeat operative T-tube cholangiogram showed no other leaks. A tube drain was left in the subhepatic region. The patient improved clinically and his total and direct bilirubin declined to 7.2 and 5 mg/dL, respectively. There was leak of bile around the T-tube, which started one week postoperatively. Blood culture grew Enterobacter species, which were treated by antibiotic. A T-tube cholangiogram 20 days postoperatively showed minimal leak from the CBD and no residual stones with free flow of dye to the duodenum. The T-tube was later removed followed by tube drainage three days later. The patient was discharged in good health.

PMC7415102_01

Female

A 35-year-old woman presented with anosmia after recovery from COVID-19. About two weeks before the anosmia, she had experienced low-grade fever, dry coughing, and headache. Due to the outbreak of COVID-19, physicians evaluated her for SARS-CoV-2 paraclinical examinations. Her lab test revealed positive CRP (3+) and lymphopenia. Chest CT scan showed patchy ground-glass and peripheral infiltration (Figure 1). A throat swab sample was taken, and reverse real-time PCR assay confirmed SARS-CoV-2 infection. She was referred to an otolaryngologist for her anosmia. A complete head and neck examination was performed. The nasal cavity, oral cavity, and cranial nerve functions (II-V, VII-IX, and XII) were normal. The patient was diagnosed with postviral olfactory dysfunction. Rhinocort spray, one puff BID for 10 days, was prescribed for her. However, no improvement was observed. A throat swab sample was taken, and reverse real-time PCR was performed again. The second PCR result was negative. Oral prednisolone was prescribed. After 6 days of consuming prednisolone, her anosmia reversed.

PMC5458692_01

Female

A 16-year-old female presented with a history of several months of left lateral knee pain. She also complained of a movable mass at the lateral joint area during ambulation. An MRI scan of left knee was performed. The MRI showed a thickened ITB and oval abnormal altered signal intensity lesion appearing heterogeneously hyperintense on inversion recovery sequences (Figs. 1,2), hypointense on T2-weighted images measuring about 4.1 cm x 2.7 cm x 0.8 cm (cephalocaudal X anteroposterior X mediolateral) located between femoral condyle medially and iliotibial band laterally and is limited inferiorly by lateral tibiofemoral joint line. A well-demarcated, ovoid nodular lesion was also observed in the compartment-like space. The initial diagnosis based on the MRI findings, clinical history, and physical examination was ITB friction syndrome. We suspected the nodular lesion was a ganglion, focal synovial thickening, focal villonodular synovitis, or focal degenerative change of invaginated extra-articular fatty tissue. Unfortunately, the possibility of a FTS was not considered. Patient was taken for an open marginal excision when nodule was found attached to the lateral joint capsule. Lateral synovium was inflamed as is typically seen in ITB friction syndrome. The nodule was successfully resected and was submitted to the department of pathology for histologic analysis. In the resected nodule, abundant collagen fibers, and spindle-shaped cells were seen and scattered fibroblasts were detected (Fig. 3). The nodule did not contain giant cells. There were no regions of necrosis, mitotic activity, or cellular atypia. The nodule was diagnosed as a FTS based on the histological findings. After the surgery patient was followed up for 2 years, during which she did not have any subjective symptoms and was able to do all activities unrestricted. Clinically also, there was no evidence of recurrence.

fibroma of tendon sheath, itbfs in teenage girl, iliotibial band friction syndrome, intra-articular fibroma of the tendon sheath, rare presentation of itbfs

PMC9894331_01

Female

In February 2022, a 74-year-old woman was presented with a mass shadow in the lower lobe of her left lung during a periodic review after a breast cancer operation. (Figure 1A). This patient underwent a left mastectomy in September 2012 due to a malignant tumor in the left breast in another hospital. Postoperative pathology showed that the malignant tumor in the left breast was an invasive lobular carcinoma. Metastatic cancer was not found in lymph nodes and did not metastasize in pectoralis fibro-fatty tissue. Tumor cells appeared as cords and trabeculae with fibrous tissue hyperplasia (Supplementary Figure S1). A series of IHC results suggested ER (+), PR (-), HER2 (-), Ki-67 (+, 5%), E-cadherin (-), P120 (+), EGFR (-), CK5/6 (-), P63 (-), calponin (-), CK7 (+), CK20 (-), LCA (-), TTF-1 (-), HEP (-), GCDFP-15 (-), PAS (+), and AB (-). The patient was treated with six cycles of anthracycline drugs after surgery, and exemestane was prescribed until December 2021, during which the periodic review showed no abnormalities. The CT scan found a pulmonary nodule in the left lung until February 2022. The abnormal focus of the lung was on the left side of the body, which was the same as the breast lesions 9 years ago. PET-CT showed that the nodules in the left lower lobe of the lung were well demarcated and had morphological rules that were not typical of lung cancer (Figure 1B). On 4 March 2022, the left lower lobe tumor biopsy of the patient's lung showed poorly differentiated carcinoma (Figure 1C). The combined results of differential IHC detection for lung adenocarcinoma and squamous cell carcinoma suggested TTF-1 (-), napsin A (-), CK7 (+), p40 (-), and p63 (-). The results of IHC detection in the left lower lobe of the lung to analyze whether it originated from breast cancer suggested ER (-), PR (-), HER2 (-), Ki-67 (+, 15%), GCDFP-15 (-), and GATA-3 (-). The results of IHC detection in the left lower lobe of the lung to analyze whether it originated from intestinal cancer suggested CK20 (-), SATB2 (-), and CDX-2 (-). PD-L1 (22C3) showed a TPS<1%. Tumor markers were all in the normal range, including CA125, CEA, SCC, NSE, ProGRP, and CYFRA21-1. Practitioners considered not to exclude metastatic breast cancer through a combination of clinical history, IHC analysis, and imaging manifestations. Furthermore, PET-CT was implemented to understand the patient's general condition. Results showed that a malignant tumor is considered in the lower lobe of the left lung, and lymph node metastasis should be considered under the left pulmonary hilum (Figure 1B). There were no space-occupied lesions and abnormal metabolism of FDG in the postoperative area of left breast cancer. It was worth noting that PET-CT found a malignant space-occupying lesion in the initial segment of the ascending colon (Figure 2A). The subsequent colonoscopic biopsy revealed mucinous adenocarcinoma. IHC results suggested GATA-3 (-), mammaglobin (-), CDX-2 (+), SATB2 (+, individual cells are positive), GCDFP-15 (-), and HER2 (-). Pathological analysis after laparoscopically assisted right hemicolectomy confirmed mucinous adenocarcinoma of the colon again (Figure 2B). The pathological stage was pT2N0M0, which was different from the pathology of the left inferior pulmonary lobe. At this point, the origin of the malignant lung mass in this patient had not been determined after a pathological assessment of needle biopsy and imaging evaluation. A surgical pathology sample was needed to determine the origin of the tumor tissue, but the patient's chest structure showed no indications for surgery. We used two simultaneous approaches to identify the source of malignant tumors in the lower lobe of the left lung. The tissue traceability expression profile was initially detected in punctured tissue, and the details are provided in Supplementary Table S1. The results showed that the malignant tumor in the lower lobe of the left lung originated from breast cancer (Figure 3). The maximum tumor tissue similarity score was 100, and the results suggested that lung and colorectal cancer similarity scores were deficient, at only 0.7 and 1.9, respectively. It indicated that the lesion in the lower lobe of the left lung was not a primary pulmonary lesion and was not metastatic from the ascending colon. This was consistent with the pathological analysis results. The left lower lobe nodule was a poorly differentiated carcinoma, and the ascending colon nodule was a mucinous adenocarcinoma. There were no apparent standard features between the two lesions. The tissue traceability expression profile results exhibited essential reference values for subsequent diagnosis and treatment. Then, more than 600 hot spot exon regions and some intron regions of tumorigenesis and developmental genes were analyzed by NGS. DNA was extracted from plasma. The Illumina NextSeq 500 System (Illumina, San Diego, USA) was used for NGS. The average sequencing depth was at least x1,000. Unfortunately, no tumor-driving gene was found in this test. Only a somatic point mutation FAT1 p.G4570S was obtained, which has not been found in other studies and has not been recorded in COSMIC or other databases. Based on the comprehensive evaluation results, a malignant lung tumor in the left lower lobe was initially diagnosed as stage IV triple-negative cancer. After a multidisciplinary treatment (MDT) discussion, the patient was treated with C1-C4 paclitaxel albumin and capecitabine on 2022-4-7, 2022-4-29, 2022-5-24, and 2022-6-20. The specific regimen was planned with 1,500 mg orally twice daily on days 1-14 and 200 mg intravenous infusion of paclitaxel albumin on days 1 and 8. The radiotherapy plan was added on 22 July 2022, including 10 MV-X SAD 100 DT 214 cGy/F/d in the intensity-modulated field of the chest tumor area (including lesions in the lower left lung and mediastinal metastatic lymph nodes) and 10 MV-X SAD 100 DT 180 cGy/F/d in the intensity-modulated field of the high-risk chest area. She was scheduled to finish radiotherapy 28 times. Combined with the chemotherapy regimen, the specific regimen was provided with 1,500 mg orally twice daily and 190 mg intravenous infusion of paclitaxel albumin on days 1 and 8 (q3w). The longest diameter of the left lower pulmonary nodule narrowed from 29 mm to 14 mm in September 2022. A partial response (PR) was achieved, with lesion diameters decreasing by 51.72% (Figure 4). She is currently in stable condition.

cancer of unknown primary, case report, gene expression profile, lung metastasis of breast cancer, traceability of tumor tissue

PMC6327904_01

Male

Our patient is a 66-year-old Japanese man diagnosed with right upper lobe adenocarcinoma of p-stage IIIA (pT2bN2M0; version 8) post right upper lobectomy. After a year of surgical resection, recurrent mediastinal lymph node metastases were confirmed by endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA). Based on the result of immunohistochemical staining (TTF-1+, p40-, Tumor Proportion Score (TPS; PD-L1 IHC 22C3 pharm DX Dako) 100%, EGFR-mutation -, ALK-rearrangement FISH-, ROS1-rearrangement RT-PCR-), The anti-Programmed Death receptor 1 (anti-PD-1) antibody pembrolizumab 200mg/body once every three weeks was initiated. After the sixth cycle of the treatment, the patient presented to the clinic with worsening dyspnea. He was tachypneic without any fever nor desaturation. Lungs were clear to auscultation. Both complete blood count and chemistry panels were normal. Blood culture, sputum culture, serum beta-D glucan, serum galactomannan, serum interferon-gamma release assays (IGRAs) for diagnosing mycobacterium tuberculosis, and serological assay by use of glycopeptide lipid core antigen for diagnosing mycobacterium avium complex came back negative. High-resolution chest CT (HRCT) revealed bilateral diffuse well-defined 1-2 mm of small granular shadow along with thickened interlobular septa, consistent with perilymphatic distribution (Fig. 1). Given the lack of any evidence of pulmonary infection or any exposure to the stimulants of hypersensitivity pneumonia, an immune reaction to pembrolizumab was suspected and transbronchial random lung biopsy from the left upper lobe anterior segment and the left lower lobe anterior basal segment was performed (see Fig. 2). Microscopically, type 2 pneumocytes with bizarre enlarged nuclei as well as lymphocytic infiltration in interstitium were identified. Pigmented macrophages suggested the hemorrhage. Most lymphocytes showed CD8+/CD4-, suggesting cytotoxic T lymphocytes. These findings were consistent with T cell-induced lung injury due to pembrolizumab. In addition, those lymphocytes aggregated around lymphatic vessels, which was confirmed by D2-40 immunohistochemistry. Those findings were confirmed in all samples of the random biopsy. Given the clinical, radiological and pathological findings, pembrolizumab-induced pneumonitis was strongly suspected, thereby the treatment was immediately discontinued. After three-week admission, the patient was discharged with ameliorated symptoms. No corticosteroid was administered during admission to avoid potential interference with the anti-tumor effect of pembrolizumab. Complete remission of his tumor has been maintained throughout the follow-up period; pembrolizumab is still suspended.

lung cancer, pembrolizumab, irae

PMC4290071_01

Male

A 15-year-old boy, presented with a right leg swelling, which increased in size over 2 months. There was no history of fever or weight loss. Radiograph of right lower limb showed a lytic sclerotic mass in proximal meta-diaphysis of right fibula, which on biopsy was suggestive of Ewing's sarcoma. Whole body 18F-fluoro-deoxyglucose positron emission tomography/computed tomography (FDG PET/CT) was performed as a part of staging work-up. Maximum intensity projection (MIP) image [Figure 1a] showed intense focus of tracer uptake in the right leg (arrow) and liver (arrow-head). Axial fused PET/CT images revealed intense tracer uptake in destructive lytic-sclerotic soft tissue mass in upper end of right fibula, with a maximum standardized uptake value (max SUV in milliCurie/kilogram of body weight) of 7.8. An intense solitary focus of FDG uptake was seen in hypodense lesion in caudate lobe of liver [Figure 1c - arrow], which was presumed to be metastatic on the basis of imaging findings. It measured 16 mm in transverse dimensions with a max SUV of 8.2. Rest of the study was unremarkable, except for reactive mediastinal nodes. Subsequently, patient underwent induction chemotherapy for 6 weeks. Follow-up FDG PET/CT study after treatment completion showed complete regression of tracer concentration at primary site in tibia on MIP image [Figure 1b - arrow], as well as reduction in size of the soft tissue mass with post treatment healing changes in the fibula seen on axial CT images. Contrary to this, the focal hepatic lesion in caudate lobe of liver showed significant increase in size and metabolic activity [Figure 1b - arrow head]; measuring 31 mm, with max SUV of 14.6 on axial fused PET/CT images [Figure 1d - arrow]. This prompted a histological correlation and fine-needle aspiration (FNA) was done from the liver lesion. Microscopic examination showed collection of epitheloid cells on Papanicolaou Stain [Figure 2a - arrows and Figure 2b] with pale oval shaped cells showing slipper shaped nuclei [Figure 2b - inset]. These findings were confirmatory for tuberculous etiology. Patient was immediately started on antituberculosis treatment, and follow-up is awaited.

18f-fluoro-deoxyglucose, focal uptake, liver, metastases, tuberculosis

PMC4719501_01

Female

A 53-year-old woman with on and off complaints of dysuria, urgency, urge incontinence, and increased frequency of urination presented to the urology department of our institute. There was long-standing history of recurrent cystitis, but no history of hematuria or loin pain. On examination, there was no organomegaly or lymphadenopathy. Urine examination showed the presence of numerous pus cells, but on culture was sterile, signifying sterile pyuria. Urine cytology for malignant cells was negative. Routine hematological investigation, screening renal and liver function tests were normal except for mildly raised total count at 11,800 cells/cu mm. Peripheral blood smear examination was normal. The patient was hypothyroid. Ultrasound, computerized tomography (CT), and intravenous urography showed diffuse thickening of the bladder wall [Figure 1a and b]. Cystoscopy showed a smooth nonulcerated nodular bulge in the right side of the bladder wall [Figure 2]. Ziehl-Neelsen (ZN) stain of the urine showed the presence of acid-fast Bacilli (AFB). Based on the clinical presentation, imaging, a preliminary AFB positivity report, and due to the exceptionally high incidence of tuberculosis (TB) in this region, the patient was started on antitubercular treatment. Initially, the patient appeared to improve symptomatically. In the meantime, simultaneously sent urine sample for culture and polymerase chain reaction could not confirm the presence of mycobacterium TB. Furthermore, repeat samples of urine examined on microscopy did not reveal the presence of AFB. On recurrence of the symptoms, a repeat cystoscopy was performed, and the findings were similar to the pretreatment cystoscopy with thickening of the bladder mucosa. Hence, a bladder biopsy was planned, and transurethral resection was performed. Tissue was also taken from the deep muscle. Histopathological examination (HPE) showed intact but thinned out bladder epithelium. The subepithelial tissue showed the presence of lymphoid follicles with expanded marginal zone, which totally replaced the sub epithelial bladder tissue. The cells were small to medium sized with dispersed chromatin, inconspicuous nucleoli and abundant cytoplasm showing clearing, imparting monocytoid morphology. No large or transformed cells were seen. No granuloma was identified. On immunohistochemistry (IHC), the cells stained positive for CD45 and CD20 [Figure 3]. Cytokeratin, epithelial membrane antigen (EMA), CD3, CD5, CD10, and Bcl2 were negative. ZN stain was negative for AFB on the HPE sections. Deep muscle biopsy showed presence of lymphoid follicles with reactive germinal center. CT scan failed to reveal any lymphadenopathy or involvement of any other organ. Bone marrow examination was unremarkable. Based on these findings, a diagnosis of primary MALT lymphoma of the bladder was made, Ann-Arbor stage 1EA. The patient was started on systemic chemotherapy with cyclophosphamide, vincristine, doxorubicin, and prednisolone. Six cycles were given. The patient is under follow-up and 9 months postchemotherapy, the patient is symptomatically normal. Repeat CT scan, cystoscopy, and postchemotherapy showed completely normal bladder [Figure 4].

bladder, bladder cancer, lymphoma, mucosa associated lymphoid tissue type, tuberculosis

PMC6393917_01

Female

A 21-year-old black woman, with no prior psychiatric history, presented at the Emergency Department of our hospital with an acute onset of psychotic symptoms. These symptoms included paranoid delusion (she was convinced that her sister had made witchcraft against her and her boyfriend was cheating on her), psychomotor agitation, and initial insomnia. The symptoms appeared four days after she was started on antituberculous therapy including isoniazid 300 mg/day, rifampicin 600 mg/day, ethambutol 1200 mg/day, and pyrazinamide 1500 mg/day, for pleural tuberculosis. She was also on pyridoxine 200 mg/day and thiamine 100 mg/day for prophylaxis against neuropathy associated with isoniazid. In addition to the recently diagnosed pleural tuberculosis, the patient had no previous medical history and no history of substance abuse. At mental state examination, she was poorly cooperative and suspicious, displayed psychomotor agitation, moving around constantly and had anxious humour and paranoid delusions. No errors of perception were detected and judgement regarding the morbid nature of her condition was impaired. On examination, vital signs were stable and the physical signs, including neurological examination, were unremarkable. Testing including a complete blood count, chemistry panel, liver and thyroid function tests, and a urine toxicology screen was normal. A computed tomography scan of the head was obtained and showed no abnormality. An initial diagnosis of drug-induced psychosis was made, once we considered the possibility that her psychotic symptoms could have been secondary to isoniazid, and the patient was admitted to our inpatient unit. All antituberculous therapy was discontinued and she was started on olanzapine 15mg/day. By the seventh day, the psychotic symptoms had remitted, and the patient presented full insight into her clinical condition. The antituberculous therapy was reintroduced by the following order: rifampicin 600 mg/day at day 10, pyrazinamide 1500 mg/day at day 12, and ethambutol 1200 mg/day at day 17. Since these three antibacterial agents have efficacy in the treatment of pleural tuberculosis, it was decided not to introduce isoniazid. At day 10, the antipsychotic started to be progressively reduced and by the time the patient was discharged (after 21 days of hospitalization) she was only taking olanzapine 5 mg/day and the antituberculous therapy. The patient stopped taking olanzapine one week after discharge and at the four-week follow-up in outpatient consultation; she remained stable, with no recurrence of psychotic symptoms. The fast remission of symptoms and the good clinical outcome further supported our diagnosis of drug-induced psychosis.

PMC6540495_01

Female

Evidence regarding golimumab, a monoclonal anti-TNF-alpha antibody, is scarce; only two case reports exist in the literature. The first described use of golimumab in a patient with severe HS and psoriatic arthritis who failed adalimumab and anakinra previously. With golimumab, her HS worsened despite improvement in her psoriatic arthritis. She was therefore considered to have failed golimumab. The second report detailed a 42-year-old female with UC, HS, and pyostomatitis vegetans treated with golimumab (200 mg followed by 100 mg every 4 weeks). This patient had remission of her dermatologic symptoms and UC within 2 months of starting therapy. Little can be inferred from these case reports regarding the effectiveness of golimumab in the treatment of HS. Certolizumab-pegol is another biologic targeting TNF-alpha, and is the only anti-TNF-alpha agent that does not cross the placenta. The inability of certolizumab to cross the placenta may relate to the absence of an Fc region, a factor implicated in placental transfer, due to pegylation. There is a report of certolizumab utilized in a pregnant HS patient as an alternative to adalimumab. With only one mention in the literature, no assessment of certolizumab's efficacy in HS can be ascertained. There are several safety concerns to consider when treating patients with TNF-alpha inhibitors. Data regarding the prevalence of these events in HS patients is scarce given the small number of HS patients treated with TNF-alpha inhibitors to date and few RCTs in the literature. These factors restrict the ability of researchers to perform meta-analyses: further limiting the study of adverse events in this population. Therefore, safety information is largely borrowed from the psoriasis, rheumatology, and gastroenterology literature. TNF-alpha is heavily implicated in mediating immune response to pathogens. Immunosuppression resulting from anti-TNF-alpha therapy increases susceptibility to infections, especially concerning is the potential reactivation of latent TB through diminished granuloma integrity. In a meta-analysis of 29 RCTs accounting for 11,879 patients, TB reactivation risk was significantly elevated in patients treated with anti-TNF-alpha medications. Consequently, patients initiating anti-TNF-alpha therapy should be screened for latent TB and annually thereafter. Another consideration with anti-TNF-alpha medications is increased risk of malignancy. One meta-analysis of the RA literature found an increased risk of all-site malignancy associated with anti-TNF-alpha medications, with an odds ratio (OR) of 3.29 (95% CI: 1.19-9.08). However, in subsequent meta-analyses of RA patients, these results were not replicated. Concomitant therapies are also likely important in development of these adverse events. A meta-analysis of the IBD literature also failed to find a significantly increased cancer risk in patients receiving anti-TNF-alpha therapy, although the authors cited concern that limited follow-up times could lead to less detection and cancer event reporting. Importantly, increased risk of nonmelanoma skin cancers (NMSC) associated with anti-TNF-alpha therapy has been reported. One study reported a relative risk (RR) of 2.02 (95% CI 1.11-3.95), and another demonstrated a RR of 1.45 (95% CI 1.15-1.76). Lymphoma risk is also increased in patients treated with anti-TNF-alpha therapy compared with the general population; but not when compared with RA patients treated with classic disease-modifying anti-rheumatic drugs. Diseases requiring anti-TNF-alpha therapy inherently involve chronic inflammatory states, which may lead to the development of lymphoma. It is difficult to say whether exposure to anti-TNF-alpha medications or the chronic inflammatory load experienced by these patients are to blame for the observed increase in lymphoma. Neuropathy has been reported in HS patients taking anti-TNF-alpha medications. The prevalence of anti-TNF-alpha related neuropathies is estimated at 0.60% and largely resolve upon withdrawal of anti-TNF-alpha therapy.

tnf-α inhibitors, adalimumab, biologics, certolizumab-pegol, etanercept, golimumab, hidradenitis suppurativa, infliximab

PMC4318105_01

Male

A 74-year-old man was found dead inside a closet of clothes in his residence. He was living alone in a single storied town house at suburban area. The police received a report from the neighbors about house breaking. When the police reached in that house, no one was inside. The entrance gate lock was broken. The police had to enter through the broken gate. The belongings were scattered over the floor of the bedroom but did not find the old in the house. On the next day, the police discovered the dead body of the old man in a closet while revisiting the scene [Figure 1a]. His mouth and nose were covered by a black plastic bag. The open ends of the bag were tied at the back of the neck. There was profuse bleeding from nostrils. His body was tied by a car seatbelt in semi prone position with flexed knees and elbows. Several knots were present, continued from the front of the neck through wrists, abdomen and ankles [Figure 1b]. At autopsy, postmortem hypostasis was found on the anterior aspect of the body due to semi prone position of the body. Early putrefactive changes like greenish discoloration over abdomen and marbling on the shoulder were found over body. Intense violaceous congestion was present on the face, neck, shoulders and chest. Mouth, lips, tongue were cyanosed, black in color. Horizontally placed three abrasions were present on the right and left side of chest and on the right abdomen of sizes 2.5 cm x 1 cm, 3.5 cm x 1 cm and 3 cm x 1 cm respectively. Multiple abrasions were present over front of both knees sizes ranging from 1-2.5 cm x 0.5-1.5 cm. Two black colored bruises of sizes 3 cm x 2 cm and 1 cm x 1 cm were present on the left side of the forehead with periorbital hematoma and right side of the face respectively. A ligature mark was present around the front, left and right side of the upper third of neck with knot mark underneath chin. The ligature mark was 13 cm in length transversely. It was 0.5-1 cm in breadth above downwards. The mark extended upward and backward and was faint on the back of the neck [Figure 2]. Three crescentic nail pressure abrasions were found over upper back sizes ranging from 1-2 cm x 1-2 cm. On dissection, there was subcutaneous hemorrhage underneath the ligature mark in the neck muscle [Figure 3]. Airway and neck glands were congested. Hyoid bone and thyroid cartilage were intact. There were patchy hemorrhagic spots in the chest muscles over sternum and attaching with right and left costal margins [Figure 4]. Both lungs were highly congested with petechial hemorrhagic spots on the pleural and pericardial surface. The heart was 300 g in weight. Coronaries were calcified but not blocked. No intracranial hemorrhage or cranial fracture was noticed except scalp hematoma on the frontal area. All organs were congested. Histopathological examinations were mostly unremarkable except mild myocardial fibrosis. Toxicological tests were negative. The cause of death was opined as asphyxia due to ligature strangulation associated with attempted plastic bag smothering and chest compression. However, blunt force head injury was considered as contributory cause but was not documented as fatal injury. Crime scene visit and autopsy findings of the present case suggest the manner of death is homicide. The victim was incapacitated by inflicting blunt force forehead injury, tying the body by a car seat belt and wrapping a plastic bag around his face. Then he was strangled by the car seat belt tied around his neck, simultaneously his chest was compressed in prone position and mouth and nose were smothered by the plastic bag to death. The police investigation revealed that a stranger intruded into house and killed the elderly victim for the purpose of robbery.

elder homicide, ligature strangulation, smothering, traumatic asphyxia

PMC3598395_01

Male

A twenty two year old Sri Lankan male presented to the outpatients department of the National Hospital of Sri Lanka complaining of shortness of breath. Noting that the patient was severely emaciated, he was requested to get admitted to a medical ward for further investigations. While in ward his main complaint was recurrent shortness of breath and a bloated feeling that was brought upon by ingestion of food. He also complained of severe constipation and maintained that he had cut down on eating due to this. He did not have symptoms such as pyrexia, symptoms of thyrotoxicosis, bleeding per rectum, chronic diarrhoea and lumps on palpation anywhere in the body. He had no medical history suggestive of chronic infections such as tuberculosis, metabolic disorders such as diabetes, immunodeficiency disorders and primary gastrointestinal disorders such as celiac disease or chronic pancreatitis. There were no inherited organic illnesses in the family, risk behaviors for Human Immunodeficiency Virus (HIV) infection or a history of substance abuse. He was extremely wasted with a body mass index (BMI) of 11.1 kg/m2 (weight 27 kg, height 1.56 m). He did not have any overt signs of micronutrient and vitamin deficiencies. The cardiovascular examination was normal and the blood pressure was 110/70mmHg. The respiratory, abdomen and nervous system examinations did not reveal any clinically significant findings. He was investigated extensively to identify an organic pathology to explain the emaciation. The haemoglobin was 11.5 g/dl with normal white blood cell and platelet counts. The blood picture was also unremarkable apart from features of iron deficiency. The erythrocyte sedimentation rate was 3mm in first hour and the liver function tests and renal function tests were within normal limits. The fasting blood glucose was 3.3 mmol/l and the serum amylase was 327 U/l. The total serum protein level was 68 g/l with an albumin level of 48 g/l suggesting a more recent cause for weight loss as the protein content was not grossly reduced. The electrolyte profile was normal apart from a hyponatremia (128 meq/l) and there were no significant findings on the chest roentgenogram or the ultrasound scan of abdomen. An upper gastrointestinal endoscopy was arranged and revealed a normal oesophagal, gastric, duodenal and upper jejunal mucosa. Multiple biopsies taken at different sites were within normal histological limits. The HIV screen was negative and the thyroid hormone profile was also normal. At this point it was noted that the patient was avoiding food. He constantly complained of food causing uncomfortable abdominal distention, epigastric pain and shortness of breath. He was then referred to the University Psychiatry Unit of the National Hospital of Sri Lanka for further assessment for an underlying psychiatric morbidity. On the initial psychiatric interview it became clear that these recent constellation of symptoms had started three months back after he became constipated following treatment for an infected eczematous rash. He was heavily inconvenienced by the abdominal distension plus the difficulty in passing stools and therefore tried to avoid food to minimize the discomfort. Later, he became preoccupied with the idea of keeping his body free of symptoms by avoiding food. He was having recurrent intrusive fears of ingested food being retained in the body without him being able to defecate due to constipation. This led to secretive disposal of food and resultant weight loss. However, he was not convinced that his beliefs were irrational. His idea of food being retained in the body and accumulating causing discomfort due to the potential inability to defecate, bordered on a delusional thought. Apart from being withdrawn and wasted with a blunt mood, the rest of the mental state examination was normal. Family members have noted that he was withdrawn and smiling to self on occasions over the last 4-5 years. He was unemployed, spent most of his time at home but didn't help out with the daily family chores. He did not have any special interests, hobbies or religious interests. The differential diagnosis at this point included; OCSD with a delusional component, a prodrome of schizophrenia or simple schizophrenia. A probable diagnosis of a type of OCSD was supported by a history of symptoms suggestive of OCD . For the past two years he had repetitive behaviours such as hand washing due to obsessional thoughts of uncleanliness. Rituals related to hand washing and eating led to significant obsessive slowness sometimes exceeding two hours to complete a meal. In addition to excessive washing, he used to stare at the tap prior to washing as a part of the ritual, sometimes up to an hour. Considering the overall picture it was decided to treat him with cognitive behavioural therapy (CBT) as for OCD instead of starting antipsychotic medication. Because of his poor physical health in ward treatment was necessary. Due to his food refusal he had to be sedated and fed via a nasogastric tube in the first few days. To avoid refeeding syndrome his biochemical parameters including electrolytes were regularly checked. Wernicke's encephalopathy was anticipated and treated with thiamine. As he gradually gained his strength CBT was started early. The behavioural therapy consisted of exposure and response prevention. The exposure consisted of graded refeeding while being encouraged to face the anxiety associated with the obsessive fear of being unable to tolerate meals and constipation. After the initial inpatient stay of two weeks, therapy was carried out at home with the mother being the co-therapist. He was not started on any antipsychotic or anti depressant medications and was managed on CBT alone. At three weeks, his weight increased by 1 kg and after 3 months by 5 kg (BMI 13.1 kg/m2). The average time taken for a meal reduced from 90 minutes to 20 minutes. With less preoccupation about his meals/bowels habits, his social interactions and involvement with other members of the family improved markedly. At six months follow up his improvement continued with further weight gain (BMI 15.8 kg/m2). His interactions with family members and neighbours had also improved. He remained unemployed but was fulfilling his daily household chores and was considering active employment. The excellent response to behavioural therapy within a relatively short time span was surprising but was a vindication of the diagnosis of OCD.

PMC3266186_01

Female

A 67-year-old Caucasian woman was seen at our clinic for possible prosthetic infection following a total left hip replacement. Her medical history was negative until three years before, when she began to complain of left hip pain during walking, movement limitation, and pain at rest. After one year of unsuccessful prior rehabilitative and analgesic treatment, she underwent total left hip replacement. The results of a pre-operative chest X-ray and blood tests were normal; however, erythrocyte sedimentation rate (ESR) was elevated (94 mm/hour). The post-operative period was uneventful, and the patient was discharged five days after surgery. She remained in good clinical condition until about 16 months after surgery, when she began to feel pain and movement limitation at the prosthetic site. Two months later, a hip computed tomography (CT) scan showed a suspect iliopsoas abscess, which was confirmed by peripheral blood mononuclear cells marked with 99 mTc. Her clinical conditions worsened because of increasing local pain and an irregular mild fever. She was admitted to an orthopedic unit for needle aspiration of the abscess (102 x 53 mm) under ultrasound guidance. Culture of the needle aspiration and blood cultures for aerobic and anaerobic bacteria were performed, and empiric antibiotic therapy was started with intravenous linezolid (600 mg twice a day). Her fever increased, and all cultures were negative. After one week of unsuccessful medical treatment, the surgeon decided to perform surgery to inspect and clean the infected site. A pseudocyst containing dense material was found just near the prosthesis. A complete aspiration with culture of dense and cloudy liquid, including biopsies of the wall of the cyst and the surrounding tissue, was performed. Intravenous antibiotic therapy with 400 mg of teicoplanin, 160 mg of gentamicin, and 800 mg of ciprofloxacin was started. After four days, the fever disappeared and the patient was discharged without antibiotic therapy. Repeat cultures were negative. A histopathological examination disclosed a fibrous tissue with acute and chronic inflammation, partly with an aspecific granulomatous aspect. Twenty days later, the patient complained of mild fever and a painful, fluctuant nodule located at the superior internal surface of the left thigh along the surgical scar. The nodule was then surgically drained. A large quantity of cloudy liquid was collected from the site. Cultures were again negative. At the site of the cut, there appeared to be a deep fistula of about 5 cm in diameter with discrete, greenish, and odorless secretion. There was no evidence of inflammation to the surrounding tissues. The patient was then admitted to our unit. Her vital signs were normal. During a physical examination, she showed bad general health conditions and evident brownish coloration of the skin to the extremities (hands, feet, palmar, and plantar plicae), nipples, linea alba, and oral mucosa. The cutaneous fistula appeared unchanged. Laboratory studies showed the following: red blood cell count of 4.53 x 109/L, hemoglobin of 12.9 g/dL, platelet count of 336 x 109/L, white blood cell count of 8.2 x 109/L (60.9% neutrophilis and 24.2% lymphocytes), ESR of 89 mm/hour, and C-reactive protein (CRP) of 75 mg/L (normal value is less than 0.5 mg/L). The result of a tuberculin skin test (5 IU purified protein derivative) was positive, QuantiFERON-TB Gold was 3.08 IU/mL (cutoff value is 0.35 IU/mL), serum cortisol at 8 a.m. was 9.5 mug/dL (normal value is 4.3 to 22.4), adrenocorticotropic hormone (ACTH) was 2300 pg/mL (normal value is 10 to 60), and anti-cortex antibodies were negative. The second controls of serum cortisol and ACTH were 5.5 mug/dL and 1490 pg/mL, respectively. Major causes of adrenal insufficiency are autoimmune disorders and MTB infection. Anamnesis, CT scan of adrenal glands, and the absence of anti-cortex antibodies suggested exclusion diagnosis of Addison disease secondary to MTB infection. The result of an experimental whole blood test based on interferon-gamma (IFNgamma) response to RD1-selected peptides, which tends to be related to active tuberculosis, was also positive. The active IFNgamma response was 2.6 IU/mL (cutoff is 0.7 IU/mL). The remaining biochemical parameters were normal. The amount of secretion was discrete; thus, fistula microbiological cultures could not be done. A single specimen was collected to perform Gram and Ziehl-Neelsen staining. Only polymerase chain reaction (PCR) for MTB complex was positive. Hip, abdominal, and chest CT scans revealed a periprosthetic abscess with diffusion to the left psoas muscle (Figure 1), a slight bilateral adrenal enlargement with calcifications, and a mild fibrosis of both upper lobes of the lungs. Our patient's condition was diagnosed on the basis of the laboratory and clinical findings as tuberculosis and secondary Addison disease. So that Pott disease could be excluded, our patient underwent a backbone X-ray, which was negative. She was put on treatment with anti-tuberculosis agents: rifampicin (RFP), ethambutol, isoniazid (INH), pyrazinamide, and pyridoxine without removal of the prosthesis. Hydrocortisone and fludrocortisone were prescribed for Addison disease. After three months, the anti-tuberculosis treatment was continued with RFP and INH only. The fistula continued to slowly discharge discrete amounts of secretion and appeared to be completely healed after six months. Our patient was totally asymptomatic and without pain upon hip movements after 15 months. The iliopsoas abscess was no longer evident on a CT scan performed about one year later.

PMC5413209_01

Male

An eighty-four-year-old man presented with progressive exertional dyspnea, productive cough and weight loss for two months. He denied fever and hemoptysis. Past medical history was significant for hypertension, atrial fibrillation and diabetes mellitus. His medications included warfarin, metoprolol, glipizide, lisinopril, and simvastatin. The patient was a Korean War veteran and a retired machinist. He had never smoked in his life. He denied any known direct exposure to asbestos. The patient was afebrile with normal vital signs. His physical exam was notable for diminished breath sounds at the right base, with dullness to percussion. Blood work showed stable normocytic anemia; serum chemistries were normal. Chest-x-ray (Fig. 1) showed moderate right-sided pleural effusion and bilateral calcified pleural plaques as well as diaphragmatic plaques consistent with asbestos-related pleural disease (ARPD). Thoracentesis revealed serous fluid, with glucose 130 mg/dL, LDH 884 mg/dL, protein 4.8gm/dL, pH 8, Albumin 2.39gm/dL, WBC 2100 (7% neutrophils and 93% mononucleated cells), RBC 64000. Fluid culture showed no organisms on gram stain and subsequently no growth. Cytology was negative for malignant cells. AFB stain was negative. Three weeks later, on outpatient follow-up, a chest CT scan (Fig. 2) showed a loculated right-sided pleural effusion, pleural-based nodular density left lower lobe with pleural plaques compatible with ARPD. A thoracoscopic pleural biopsy was planned but before this could be performed, the patient was hospitalized again, 5 weeks after his initial presentation, with worsening symptoms of shortness of breath. Chest x-ray revealed a recurrent right-sided pleural effusion. A repeat thoracentesis revealed glucose 42 mg/dL, LDH 746 mg/dL, protein 5.2 gm/dL, pH 7.5, albumin 2.19gm/dL, WBC 79, with 58% neutrophils, 42% mononucleated cells, RBC 2000. Cytology was negative for malignant cells. Acid fast bacilli (AFB) stain and Gram stain were negative. At that time, pleural fluid AFB culture from the first thoracentesis turned positive for mycobacterium tuberculosis and a diagnosis of tubercular pleural effusion, superimposed on ARPD, was made. The patient was started on isoniazid, rifabutin and ethambutol. Treatment was stopped two weeks later due to development of liver toxicity. The patient subsequently developed health-care associated pneumonia and deteriorated clinically despite treatment with broad-spectrum antibiotics. Per the patients previously expressed wishes, comfort measures were instituted and he expired soon after.

asbestos-related pleural disease (arpd), tuberculosis (tb), tuberculous pleural effusion (tbpe)

Chest CT scan showing a loculated right-sided pleural effusion with calcified pleural plaques.

PMC9893068_01

Male

In July 2022, a 38-year-old male presented to a clinic at the King Fahd Medical Research Centre, Jeddah, Saudi Arabia with a subcutaneous fibrous cord extending from the axilla to his left arm. He complained of painful abduction of his left shoulder and pain in the left shoulder extending from the axilla to the medial aspect of the arm. He reported that the cord appeared 2 weeks prior to his attendance at the clinic and 2 days after repetitive physical activity using a jumping rope. He also reported that the cord was longer and more prominent once it appeared. The patient had no history of chronic illnesses. The patient had a family history of hypertension and type 2 diabetes mellitus. He was not on any medication, except esomeprazole, for gastric acidity and heartburn. On physical examination, he was apparently healthy with a body mass index (BMI) of 33.1 kg/m2. Inspection showed a 12 cm subcutaneous band or cord running from the left axilla to the medial side of the left arm (Figure 1). The cord was fibrous and thin upon palpation. The patient was then diagnosed with AWS. The patient was advised to undergo self-massaging. The cord and its accompanying pain symptoms gradually resolved over 8 weeks without any need for analgesics (Figure 2). The reporting of this study conforms to CARE guidelines. Written informed consent for publishing clinical data and images relevant to this case report was obtained from the patient.

limited range of motion, lymphatic cording, painful shoulder movement, physical exertion

PMC6329015_01

Female

An 11-year-old girl was bitten by an unidentified snake on the volar aspect of her left forearm while playing at the farm. A tourniquet was tied on her arm for an unknown duration and traditional medicine applied to the wound. Initially, the forearm pain was sharp but gradually evolved to a severe throbbing pain spreading to the chest wall with associated swelling of the affected regions. A day later, the child was taken to her local hospital where fever and rapidly advancing dark-brown discolouration of the forearm was noted. She was then transferred to our facility due to toxaemia, arriving 6 days following the bite. There was no history suggestive of systemic envenomation and she had no known chronic illness. On admission, she was ill-looking with a temperature of 38.4 C, tachycardia and tachypnoea. She was pale with haemoglobin level at 8.2 g/dL, white blood cell count at 14.6 x 103, neutrophilia and platelet count at 53 x 103. Local examination revealed patchy dark-brown skin discoloration of the upper limb and anterior chest with multiple foul-smelling skin blisters. The skin of the forearm and hand was tense and tender with visible bite marks. The tenderness was exacerbated by passive movement of the fingers; however, the hand remained pink and warm with a palpable pulse. A diagnosis of necrotizing fasciitis with acute compartment syndrome was made, and the patient was taken to theatre for surgical fasciotomy and debridement. Intraoperative findings included extensive soft tissue necrosis with overlying dermal gangrene and multiple pockets of pus in the arm, hand and anterior chest wall. Forearm fasciotomy was performed, and muscles bulged out revealing pale non-contractile muscles with poor bleeders. The skin blisters were de-roofed, pus drained and wounds washed. Minimal debridement was done to reduce operating time as the patient's condition was critical. The muscles were left intact and the wounds dressed. Postoperatively, high-flow oxygen, whole blood, analgesics and high-dose antibiotics were commenced along with a high-protein diet and micronutrient supplements. The parents were counselled on the possibility of amputation if the limb showed no recovery on the second-look debridement scheduled at 48 h. Following the operation, fevers settled and the child recorded a good urine output. During second-look debridement, the muscles were found to have recovered. Minimal pus was found, though the dermal gangrene had extended to include most of the upper limb and the chest up to the level of the xiphoid process (Figure 1). The underlying necrosis of the subcutaneous tissue extended beneath the viable skin of the anterior chest wall to the mid-axillary lines bilaterally. Multiple drains were inserted into the fascial plane to drain the anticipated fluid and pus under the skin pockets. The forearm tendons exposed following fasciotomy were covered by approximating the skin. Staged debridement was repeated every 48 h with the patient making steady recovery. However, 6 days post admission she developed an intermittent dry cough associated with central chest pain. She was tachycardic with bilateral pitting pedal oedema. Chest x-ray showed widening of the mediastinum with clear lung fields (Figure 2). Pus was noted at the jugular notch draining from the mediastinum and a diagnosis of mediastinitis was made. A drain was placed beneath the jugular notch, diuretics started and the patient nursed in Trendelenburg position to facilitate pus drainage. A week later, the chest pain and cough decreased, and the mediastinum pus drainage ceased with repeat x-rays showing resolution of the mediastinal widening (Figure 3). Wound reconstruction was performed 22 days post admission (Figure 4). A split-thickness skin graft harvested from the lower limbs was meshed by hand and secured onto the wound. A sheet (not meshed) thick-split skin graft was used to cover the flexural area of the elbow joint. In total, 20% of total body surface area (TBSA) was grafted with a local flap mobilized and used to complete coverage of the left axilla. The skin at the base of the neck was sutured to achieve secondary closure and a plaster splint applied with the elbow semi-flexed at 120 and the hand in functional position. Graft wounds were exposed on day 5 with good take of the graft except 0.5% TBSA on the back that sheared off earlier during movement of the child on the ward and dehiscence of the lower neck sutured wound (Figure 5). Donor site wounds were exposed on day 15 and healed well. Hand function was compromised with reduced power and movement of the ring and little finger while returning the ability to hold a pencil using her thumb and index finger. Physiotherapy was commenced and the child was discharged.

africa, critical care/emergency medicine, zambia, compartment syndrome, infectious diseases, mediastinitis, necrotizing fasciitis, snakebite, surgery

PMC8421570_01

Male

Table 2 describes the demographic characteristics, clinical symptoms, comorbidities, imaging features, laboratory indicators, treatment strategies, and type of TB among the overall group and the COVID-TB non-survivors and survivors. A total of 89 COVID-TB patients were included in the overview of case reports, of which 19 (23.46%) died, and 72 (80.9%) were male. The number and proportion of COVID-TB patients in the 0-14, 15-24, 25-44, 45-64, and 65+ years age groups were 4 (4.49%), 9 (10.11%), 40 (44.94%), 24 (26.97%), and 12 (13.48%), respectively, with an average age of 41.21 +- 17.84 years. The median age of the non-survivor group (53.95 +- 19.78 years) was older than that of the survivor group (37.76 +- 15.54 years) (p < 0.001). The non-survivors were less likely to be 25-44 years old compared with survivors (10.53 vs. 54.29%) but more likely than survivors to be in the 65+ years age group (47.37 vs. 4.29%) (p < 0.01). More than 85% of these cases were from India (n = 31, 4.83%), Italy (n = 26, 29.21%), and China (n = 12, 13.48%). Among all 89 COVID-TB cases examined, 88.76% involved active TB, 8.99% had previous TB, and 2.25% had latent tuberculosis infection (LTBI). The proportions of pulmonary TB only, extrapulmonary TB only, and pulmonary TB/extrapulmonary TB (>1 site possible) were 79.78, 8.99, and 8.99%, respectively. Moreover, 5.62% were classified as central nervous system TB, 4.49% pleural TB, and 2.25% lymphadenitis. A total of 56.41% (44/78) of the COVID-TB patients had comorbidities, the most common of which was diabetes (24.36%, 19/78), followed by hypertension (17.95%, 14/78), HIV infection (6.41%, 5/78), hepatitis (3.85%, 3/78), epilepsy (3.85%, 3/78), chronic kidney disease (2.56%, 2/78), cerebrovascular disease (2.56%, 2/78), chronic obstructive pulmonary disease (2.56%, 2/78), asthma (2.56%, 2/78), or cancer (2.56%, 2/78). The non-survivors had more complications, such as hypertension (47.06 vs. 17.95%), hepatitis (17.65 vs. 0%), and cancer (11.76% vs. 0%), than survivors (p < 0.05). The 10 most common symptoms of COVID-TB at admission were fever (77.78%), cough (64.2%), dyspnea (35.8%), weight loss (16.05%), fatigue (11.11%), expectoration (9.88%), chest pain (9.88%), headache (8.64%), myalgia (8.64%), and vomiting (7.41%). The non-survivors had a higher percentage of dyspnea than survivors (72.73 vs. 30%) (p = 0.014). In terms of treatment, 88.52% of the 61 COVID-TB patients received anti-TB therapy, 50.82% received antibiotics, 22.95% received antiviral therapy, 26.23% received hydroxychloroquine, 16.39% received oxygen therapy, 11.48% received corticosteroids, 8.2% received interferon-alpha, 6.56% received traditional Chinese medicine, and 4.92% received intravenous immunoglobulin. The most widely used antibiotic was azithromycin (21.31%), followed by ceftriaxone (14.75%), moxifloxacin (4.92%), amikacin (3.28%), and meropenem (1.64%). The antiviral drugs used included lopinavir/ritonavir (11.48%), umifenovir hydrochloride (9.84%), tenofovir (6.56%), remdesivir (1.64%), lamivudine (1.64%), dolutegravir (1.64%), and favipiravir (1.64%). These treatments did not differ significantly between survivors and non-survivors. Features of lung imaging among the 89 patients were as follows: 52.81% had bilateral lesions, and 20.22% had unilateral lesions. The 10 most common imaging features included cavities (32.58%), infiltrates (31.46%), ground-glass opacity (19.1%), nodules (16.85%), pleural effusion (11.24%), fibrosis (12.36%), patchy shadows (8.99%), consolidation (8.99%), military lesions (5.62%), and reticules (5.62%). In addition, we found that non-survivors were more likely than survivors to have bilateral lesions (73.68 vs. 47.14%), infiltrates (57.89 vs. 24.29%), or tree in bud (10.53 vs. 0%) features (p < 0.05). Elevated laboratory findings in COVID-TB patients included neutrophil count (7.60 [6.93-7.60] x 109/L), D-dimer (1.407 [1.09-2.65] mug/ml), C-reactive protein (CRP, 77.10 [29.20-184.70] mg/L), erythrocyte sedimentation rate (ESR, 75.50 [55.75-88.50] mm/h), procalcitonin (PCT, 2.57 [0.50-5.76] ng/ml), ferroprotein (FER, 739.50 [511.50-952.50] ng/ml), aspartate transaminase (46 [27.55-78.50] U/L), lactate dehydrogenase (LDH, 384 [290.25-471.75] U/L), and creatinine (335.92 [189.51-396.92] mumol/L). Reduced laboratory indicators included lymphocyte count (0.99 [0.73-1.31] x 109/L) and hemoglobin (99 [83.5-114] g/L). Leucocyte count, platelet count, and alanine transaminase levels were in the normal range. The nonsurvivors had a higher leucocyte count than the survivors (12.9 [10.5-16.73] vs. 8.015 [4.8-8.97] x 109/L, P = 0.007). There were no significant differences between the survivors and non-survivors regarding the abovementioned laboratory examinations, except for the leucocyte count.

covid-19, clinical features, co-infection, risk factors, tuberculosis

PMC10293939_01

Female

This is the case of a 28-year-old Filipino female diagnosed initially with a right frontal pleomorphic xanthoastrocytoma (WHO grade II, IDH-wildtype), who underwent excision and then stereotactic radiosurgery of the residual tumor. She had a recurrence at 9 months from initial diagnosis, for which she was treated with intensity-modulated radiotherapy and temozolomide concurrently and adjuvantly. She had two more recurrences at 1 year and at 2.4 years from diagnosis. Various combinations of temozolomide and the EGFR inhibitor, nimotuzumab, were given for the recurrent tumor. Four months after the last recurrence, the patient was readmitted for progressive generalized body weakness and anorexia developing over 2 months, accompanied by intermittent fever. There was no associated headache, seizures, decrease in sensorium, or new focal neurologic deficit. At this time, she was on temozolomide and nimotuzumab treatment. Her past medical history includes histiocytosis in infancy and pulmonary tuberculosis during childhood. She has pet cats and is exposed to feline feces when she does gardening in her backyard. Upon admission to the hospital, she was persistently febrile. Her complete blood count showed leukopenia (WBC count 3,740 cells/muL; absolute lymphocyte count 374 cells/muL) and thrombocytopenia (platelet count 70,000 cells/muL). Temozolomide was discontinued. She later developed a temporoparietal headache and decreased sensorium. She became drowsy and asthenic but weaker on the left extremities (Medical Research Council muscle strength grading of right upper extremity 4/5, right lower extremity 3/5, left upper extremity 2/5, left lower extremity 1/5). There were no cranial nerve deficits, papilledema, or meningeal signs. On the 8th hospital day, a repeat cranial MRI with contrast was done to workup for tumor recurrence. The cranial MRI revealed multiple vari-sized enhancing lesions in both cerebral hemispheres and in the posterior fossa with perilesional edema on FLAIR sequence (Fig. 1). The known right frontal lobe tumor showed a slight decrease in size and mass effect. Due to the symptoms of fever, headache, and decreasing sensorium in the background of long-term temozolomide use and exposure to feline excreta, a central nervous system infection, particularly toxoplasma encephalitis, was considered. However, the multiple focal lesions precluded a lumbar puncture for this patient due to the risk of brain herniation. Serological workup for toxoplasma (VIDAS TOXO IgM and VIDAS TOXO IgG, enzyme-linked fluorescence assays by bioMerieux, Inc.) showed elevated IgM and IgG antibody titers (IgM 0.79 IU/mL [test cut-off = 0.55]; IgG >300.0 IU/mL [test cut-off = 4]). A tuberculosis interferon-gamma release assay was also done, which showed indeterminate results. The patient was treated for possible cerebral toxoplasmosis and was started on trimethoprim-sulfamethoxazole 800 mg/160 mg IV every 12 h. Three days from initiation of antimicrobials, there was lysis of the fever and gradual improvement of her sensorium. A repeat cranial MRI on the second week of treatment showed a slight decrease in the number and size of the enhancing lesions as well as the perilesional edema. Two weeks after hospital discharge, a thallium-201 SPECT scan of the brain was performed to distinguish between toxoplasmosis and tumor recurrence. SPECT images did not show increased tracer uptake in any of the lesions, a finding more consistent with cerebral toxoplasmosis (Fig. 2). The patient completed antibiotic therapy with oral trimethoprim-sulfamethoxazole at 800 mg/160 mg daily for 1 year. Serial cranial MRI images showed a further decrease and eventual resolution of the multiple enhancing lesions. The CARE checklist was accomplished for this case report, attached as online supplementary material (for all online suppl. material, see www.karger.com/doi/10.1159/000529830).

astrocytoma, case report, cerebral toxoplasmosis, thallium-201 single-photon emission computerized tomography, toxoplasma encephalitis

PMC9622786_01

Female

A 55-year-old woman with no past medical history presented with three weeks of hemorrhage of the oral mucosa at the Department of Hematology in August 2019. There were no complaints of fever, cough, fatigue, or ostalgia. Vital signs revealed a temperature of 36.5 C, heart rate of 80 beats/min, respiratory rate of 20 breaths/min, and blood pressure of 125/81 mmHg. The physical examination revealed unremarkable findings. Laboratory test results revealed a white blood cell count of 88.13x109/L (normal range, 3.5-9.5x109/L) with 67% neutrophils, 2% lymphocytes, 5% basophils, 1% eosinophils, 1% monocytes, 14% myelocytes, 10% metamyelocytes, with an erythrocyte count of 4.18x1012/L (normal range, 3.8-5.1x1012/L) and a platelet count of 640x109/L (normal range, 125-350x109/L). The lactate dehydrogenase level was 647 U/L (normal range, 135-214 U/L), while erythrocyte sedimentation rate, procalcitonin, liver, and renal function tests were normal. The abdominal ultrasound showed an enlarged spleen. Bone marrow examination showed markedly proliferated granulocytes. The quantitative reverse transcription polymerase chain reaction (RT-PCR) test for BCR/ABL p210 was positive at the time of diagnosis. Chromosomal analysis revealed 46, XX, t (9,22) (q34; q11). The patient was diagnosed with CML-CP and was started on imatinib (400 mg/daily). Due to sudden respiratory distress, she was admitted again 11 months later. Her temperature was 36.5 C, heart rate was 137 beats/min, respiratory rate was 34 breaths/min, and blood pressure was 89/64 mmHg. Her cough started 2 months before admission. A physical examination revealed moist rales at the base of the lung. Sputum culture revealed Stenotrophomonas maltophilia, filamentous fungi, and traces of Aspergillus fumigatus. Routine blood tests showed a white blood cell count of 6.78 x109/L, an erythrocyte count of 4.00x1012/L, and a platelet count of 269x109/L. A peripheral blood smear revealed no abnormal cells. Procalcitonin was 1.035 ng/mL (normal range, 0-0.05 ng/mL). The serum IgM test for toxoplasma, rubella virus, cytomegalovirus, herpes simplex virus and parvovirus B19 (TORCH) was negative. Influenza, mycoplasma pneumoniae, T cell spot test, Epstein-Barr virus (EBV), cytomegalovirus plasma 1-3-beta-d glucan test, and plasma galactomannan tests were also negative. An electrocardiogram showed sinus tachycardia. There were no abnormalities on the cardiac ultrasound. Chest computed tomography (CT) revealed ground-glass opacities, patchy shadows, and multiple nodules in both lungs and enlarged mediastinal lymph nodes ( Figure 1A ). She was diagnosed with septic shock and was treated with biapenem and voriconazole. The combination of antibiotic treatments was effective. The patient's respiratory distress was relieved; however, intermittent coughing remained. Another chest CT showed decreased patchy shadows and multiple nodules in both lungs ( Figures 1B, C ). She was readmitted 3 months later due to a fever (maximum of 38.5C). A CT scan showed an increase of the masses in the left lung compared with previous findings ( Figures 1D, G ). CT-guided percutaneous lung biopsy was conducted on October 28, 2020. The pathological examination showed extensive necrosis of the examined tissue. Periodic acid-silver methenamine staining was negative. Simultaneously, she underwent flexible fiberoptic bronchoscopy, which showed thick and yellow secretions. BAL fluid was sent for next-generation sequencing (NGS), which revealed EBV and Actinomyces odontolyticus. The patient received penicillin sodium and acyclovir for anti-infective treatment. The patient's symptoms improved, and she was discharged home from the hospital. One month later, the patient presented with worsening cough, white sputum, and intermittent fever (maximum of 38.5 C), and was readmitted. CT revealed a reduction in the size of the masses in the upper lobe of the left lung ( Figure 1E ) and an increase in the size of the masses in the lower lobe of the left lung compared with the previous scan ( Figure 1H ). Therefore, a second bronchoscopy and bronchoalveolar lavage were performed. Bronchoscopy revealed a white substance in the entrance of the dorsal segment of the left lower lobe. The BAL fluid was sent for NGS, which revealed EBV and Enterobacter cloacae complex Hoffmann cluster III. The patient underwent a second CT-guided percutaneous lung biopsy. Histopathological examination of the biopsied lung tissue showed proliferation and vascular infiltration of polymorphic lymphoid cells ( Figure 2 ). Immunohistochemical staining showed that the tumor cells were positive for Pax5, CD20, Bcl-2, EBER and (60%) Ki-67 and negative for Bcl-6, c-MYC, CD10, TdT, CD34, CD117, and MPO. MUM-1 staining was positive (20%); admixed T cells were positive for CD3 and CD7; tuberculosis-polymerase chain reaction was negative; and staining of mycobacteria and fungi were negative. Positron emission tomography/computed tomography (PET/CT) revealed an 18 F-fludeoxyglucose (FDG) increased uptake in the dorsal segment, posterior basal segment, and lateral basal segment of the left lower lobe ( Figure 3 ). FDG uptake was not detected in the mediastinal lymph nodes, thus excluding secondary lung infiltration of nodal/mediastinal DLBCL ( Figures 3G -I ). Bone marrow aspiration did not show involvement of lymphoma cells. BCR-ABL (RT-PCR) was 0.0%. Furthermore, laboratory results showed an EBV DNA load of 2.07x104 IU/mL (normal range, <5000 IU/mL) and lactate dehydrogenase level of 348 U/L. The patient was diagnosed with lymphomatoid granulomatosis (grade 3). She stopped imatinib treatment and instead received R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone) therapy. Her clinical manifestations improved, and chest CT scan revealed a reduction of the multiple nodules and masses in both lungs after 2 courses of chemotherapy ( Figures 1F, I ). Moreover, five months following imatinib withdrawal, flumatinib was then administered as a treatment for CML. The hematological remission of CML was maintained, and BCR-ABL transcript level remained undetectable by RT-PCR. As of August 16, 2022, the patient was still alive.

antibiotic therapy, biopsy, chronic myeloid leukemia, opportunistic infections, pathology, primary pulmonary lymphoma

PMC9425891_01

Female

The case is about a 42-year-old woman, who complained of a painful mass of her right breast. The mammography demonstrated a high-density mass lesion of size 2.7 x 2.2 x 1.7 cm, which was presented not well-circumscribed, irregular borders (Figure 1). The mass showed heterogeneous calcification. For making pathological diagnosis of the mass, core needle biopsy was taken. The histopathology of the tumor was intriguing, because there were 2 different components in the tumor. One of them was typical invasive ductal carcinoma (IDC) (Figure 2), the other one was presenting as osteosarcoma. Lots of immature trabeculae could be seen, and atypia osteocytes among them (Figure 3). The results of immunohistochemistry showed different presentations between them. The IDC parts of the tumor was positive for ER, PR, and CK8/18, but the osteosarcoma was negative for ER, PR, and Her-2. The component of osteosarcoma expressed SATB-2 (Figure 4). The patient underwent the radical operation of the lump. The gross appearance of the tumor revealed a solid mass with hemorrhagic (Figure 5). The mass was too firm to make the sections, so it was been decalcified. Routine microscopic examination revealed an invasive biphasic tumor comprising malignant epithelial and osseous tissue. It was the same as the histopathology of the core needle biopsy, as well as the results of immunohistochemistry. The final diagnosis was given, that was breast mixed metaplastic carcinoma, which was display a mixture of osteosarcoma (65%), with invasive ductal carcinoma (35%).

breast, case reports, diagnosis, immunohistochemistry

PMC7350519_01

Male

A 15-year-old boy was referred to University Children's Hospital of Krakow, Department of Oncology and Hematology, in December 2016, because of progressive pallor, bone pain, and upper respiratory tract infection. Physical examination revealed general lymphadenopathy and no hepatosplenomegaly. At admission, severe anemia (hemoglobin level of 6.0 g/dl), leukopenia (white blood cell count of 3.4 x 109/L), and thrombocytopenia (platelet count 45 x 109/L) were found, prompting a bone marrow examination. Bone marrow biopsy revealed 81% of lymphoblasts presenting expression of CD45, CD19, CD22, and CD10; thus, the diagnosis was pre-B-cell precursor ALL (pre-B-ALL). A normal male karyotype (46, XY) was found in the bone marrow cytogenetic analysis. None of the prognostic genetic abnormalities such as BCR-ABL, MLL-AF4, and ETV6-RUNX1 were found in leukemic cells. Cerebrospinal fluid examination revealed no lymphoblasts, and the patient was classified as CSN1 status. The treatment according to ALL IC-BFM 2009 protocol was started, beginning with cytoreductive prednisone prophase and methotrexate intrathecally. Good response to glucocorticoids was seen. Induction therapy (Protocol IA) was continued afterwards with prednisolone, vincristine, and daunorubicin once per week with four total doses each and Escherichia coli-derived l-asparaginase with eight total doses and methotrexate intrathecally. Bone marrow aspiration on day 15 revealed no blasts (M1 bone marrow) and minimal residual disease (MRD) of 0.05%, indicating a good response to therapy. According to treatment protocol, the patient was ultimately stratified to intermediate risk group. Further treatment according to Protocol IB was continued: four blocks of cytarabine, cyclophosphamide, oral mercaptopurine, and intrathecal methotrexate. During the induction phase, apart from short-term pancytopenia, the patient did not present major toxicities of induction therapy. Complete remission with negative MRD (<0.01%) was achieved on day 78 (at the end of induction). At the beginning of consolidation, in March 2017, the patient was admitted to our department because of unexplained fever lasting 3 days. On physical examination at admission, disseminated, single, pearly yellow nodules localized on the face, trunk, and extremities (Figure 1); bruises; and significant hepatosplenomegaly were found. Complete blood count revealed severe pancytopenia with hemoglobin level of 6.0 g/dl, leukocytes count of 1.2 x 109/L, and platelet count of 13 x 109/L. Owing to suspicion of pending relapse, bone marrow biopsy was performed. Bone marrow examination confirmed persistent complete remission with negative MRD of <0.01%; however, an increased number of histiocytes with hemophagocytosis (Figures 2, 3) was seen in bone marrow. Flow cytometric analysis of bone marrow cells revealed abnormal population of cells presenting SSChigh and high expression of CD45, CD64, CD14, and CD33, evaluated as macrophages (16% of all nucleated cells). Bone marrow core biopsy was not performed owing to low platelet count and poor coagulation functions not responding to substitution treatment. Because remission of ALL was confirmed, we started to explore other causes of pancytopenia. Firstly, the patient underwent infectious disease screening. Blood tests revealed elevated C-reactive protein (CRP) (44 mg/dl), with a low procalcitonin level. Blood and urine cultures, as well as viral panel testing for cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpes virus 6 (HHV6), HIV, parvovirus B19 (PVB19), hepatitis C virus (HCV), hepatitis B virus (HBV), hepatitis A virus (HAV), and herpes simplex virus (HSV), were negative, as were screening examinations for autoimmune and rheumatoid markers. Within the next several days, the general status of the patient deteriorated, high-grade fever persisted, and hepatomegaly and splenomegaly progressed. Severe hypoproteinemia (30 g/L), hypoalbuminemia (16 g/L), and hypofibrinogenemia (0.6 g/L) was observed. Additionally, an elevated level of ferritin (1,850 mug/L) and CD25 level [soluble interleukin (IL)-2 receptor--6,541 U/ml) were found. Cytotoxic tests of NK cells revealed their reduced activity (6%, normal range 9.9-26.1%). Finally, based on clinical manifestation (fever and splenomegaly) and laboratory tests (pancytopenia, hypofibrinogenemia, hemophagocytosis in bone marrow, high ferritin, and low activity of NK cells), the diagnosis was HLH according to HLH-2004 trial diagnostic criteria. Considering the probability of secondary HLH with malignancy in the patient, extensive investigations for pathogens were carried out; however, none of the infectious triggers (bacterial, viral, fungal, or parasitic) were found at that time. In the diagnosis of primary HLH, defect in SH2D1A was excluded. Additionally, owing to the appearance of new skin lesions on the face, trunk, and extremities of the patient, we decided to biopsy the nodules. Skin biopsy revealed diffuse infiltration by histiocytes expressing CD45 and CD68 but negative for CD1a, langerin, and S100 (Figure 4); thus, JXG was recognized. Furthermore, the DNA was extracted from the initial ALL bone marrow smears, with the bone marrow specimen showing histiocytic proliferation and current histiocytic lesions in the skin. The BIOMED-2-primer was used to amplify the immunoglobulin heavy chain gene. The PCR products were analyzed by capillary electrophoresis. There were predominant monoclonal amplifications of 305, 239, and 104 bp found in the bone marrow cells. Identical products were detectable in the histiocytic lesion of the skin, which finally proved clonal relationship between both diseases. No lymphoblasts were found in the skin biopsy. Despite intensive supportive therapy, patient's status deteriorated gradually. Serious enteral enteropathy with extremely low protein (23 g/L) and albumin (11 g/L) levels resulted in considerable peripheral edemas and hydrothorax. Because the patient stayed in complete remission of ALL with negative MRD status, further therapy according to ALL IC-BFM 2009 was ceased, and treatment, based on HLH 2004 protocol, was introduced. At the beginning, methylprednisolone and etoposide were given; however, no improvement was seen. Thus, cyclosporine and vinblastine were added after 2 weeks. Owing to remarkable fluid retention, cyclosporine was stopped eventually. The patient still needed everyday transfusion of red blood cells, platelet, and plasma concentrates, as well as intravenous immunoglobulin supply. He was fed by gastric feeding tube and then by jejunal tube to fulfill caloric requirements. In the beginning of April, the patient started to complain about bone pain of left scapula and upper extremities. MRI scan showed bone structure alterations of left clavicula, scapula, and humerus. However, biopsy of the lesion was not done owing to the poor general status of the patient, low platelet count, and persistent coagulation abnormalities. Despite multidrug, intensive therapy, there was no improvement, neither in patient status nor in bone marrow function or skin lesions. Progression of hepatosplenomegaly was observed. Moreover, the patient developed additional side effects of steroids, such as diabetes, hypertension, and adrenal insufficiency. Additionally, laboratory findings showed prominent pancytopenia, significantly elevated serum ferritin level, reduced fibrinogen level, and persistent hemophagocytosis in bone marrow. Looking for another treatment modalities of HLH, we decided to apply tocilizumab (IgG anti-IL-6 receptor). Once tocilizumab was given, a slow although unequivocal improvement of skin manifestation was seen. Increase of protein and fibrinogen levels, along with decrease of ferritin concentration, were achieved. Unfortunately, no change in blood parameters and features of hemophagocytosis in bone marrow were observed. Finally, a total of five tocilizumab doses were given. Because there was no further improvement, the patient was planned to have HSCT. In August 2017, the allogeneic HSCT from matched sibling donor was performed. Patient received treosulfan, fludarabine, thiotepa, and alemtuzumab as a part of his conditioning. Since day 15, reconstitution of leukocyte count > 1 x 109/L has been observed; neutrophils count > 0.5 x 109/L since day 17; and platelet count > 50 x 109/L since day 65 after HSCT. General and nutritional status of the patient gradually improved; however, some nodules on the skin of the face, trunk, and extremities were still present. One month after HSCT, the patient was discharged home. Ten days later, he was admitted to the hospital again owing to severe herpetic mucositis (WHO grade III). Because he started complaining of chest wall pain on the left side, X-ray was performed, and left side pleuritis was found. The pleura was punctured, and fluid examinations revealed high protein concentration and leukocytosis with presence of lymphocytes and macrophages. HHV6 PCR tests were positive, whereas aerobic and anaerobic bacterial, mycologic, and mycobacteria cultures, from both fluid and blood, were negative. Mycobacterium tuberculosis DNA by PCR test was not detected in pleural fluid. Despite negativity of tests, still, atypical mycobacterial infection was suspected in our patient, as he had been treated with immunosuppressive therapy. Therefore, we decided to introduce antitubercular agents on an empirical basis. Once isoniazid and rifampicin were given, remarkable regression of all skin lesions was observed. Gradual increase of platelet number was also seen within the next weeks. The patient continued with antitubercular drug therapy for further 6 months. Currently, 2 years after HSCT, the patient's general health status is good, in continuous remission of ALL, HLH, and JXG.

acute lymphoblastic leukemia, case report, hemophagocytic lymphohistiocytosis, juvenile xanthogranuloma, non-langerhans cell histiocytosis

PMC3735335_01

Female

A 68-year-old woman was admitted with gradual onset of bilateral weakness of the upper and lower limbs. She had been experiencing involuntary trunk movement, dizziness, and ataxia for six weeks, but was still able to perform her daily activities independently. Her symptoms progressed to include frequent headaches, bradykinesia, and postural tremor over her right hand and right arm, and tingling pain localizing to her right posterior auricular area. No skin rash, papullae, bullae, or ulcers were noted on her face, trunk, or limbs. The tremor in her hands progressed, such that she could no longer grasp objects, put on clothes, comb her hair, or stand on one leg. A visit to the neurologic outpatient clinic confirmed that muscle power in all four limbs was normal. However, her trunk and limbs were numb, and she reported pruritus over her entire trunk. One week before admission, she underwent magnetic resonance imaging of the brain, which revealed multiple small hyperintense spots in her basal ganglia, indicating lacuna infarcts, demyelinating lesions, and arteriosclerosis with tortuosity of the arteries. However, her symptoms and signs were not compatible with these findings, so continued observation was suggested. Four days later, she was noted to have urinary frequency, difficulty voiding, and a residual urine volume of 856 mL, all of which were indicative of a neurogenic bladder, so a Foley tube was inserted. No diplopia, slurred speech, loss of consciousness, dyspnea, or obvious weight loss was observed throughout the course of her admission. Her limb weakness became severe, and physical and neurologic examination revealed that the muscle power in her right upper and lower limbs had decreased from 5 to 4 and 5 to 3, respectively, and in the left lower limb had decreased from 5 to 4. Further, diminished sensation of pinprick and light touch was noted to be below T4. On admission, laboratory data showed mildly increased white cells and neutrophils. Electrolytes, renal and hepatic function, vitamin B12, and folate were normal. A lumbar puncture was performed, and showed lymphocyte-predominant pleocytosis and elevation of microproteins and glucose, but her white cell count was normal. No specific laboratory findings indicating tuberculosis, or bacterial or fungal infection were noted, and polymerase chain reaction results were negative for cytomegalovirus, herpes simplex virus, and Epstein-Barr virus. No malignant cells were apparent, and no positive findings of antibodies such as SS-A, SS-B, RA, C3, C4, or antinuclear antibody were noted. T2 weighted axial images on spinal magnetic resonance imaging revealed a patchy diffuse area of hyperintensity extending from C3 to T5, so the patient was diagnosed with transverse myelitis (Figure 1). Given that neuromyelitis optica and optic neuritis should also be suspected even if the visual field is normal, we arranged for visual evoked potentials, which were negative. Her right upper limb and bilateral lower limb weakness and incontinence of urine and stool was unresponsive to treatment. One month after admission, the patient complained of a cold sensation extending from her bilateral legs to her chest, with abnormal tremor and night sweats. She was treated with clonazepam 0.5 mg twice daily and imipramine 10 mg at bedtime to relieve her discomfort. However, two days later, she suffered from intermittent coldness, numbness, tightness, and a cramping sensation ascending from her leg to her chest, severe tingling pain with duration of 10-15 minutes, and a period of 5-10 minutes. These symptoms lasted throughout the day, with a visual analog pain score >9. Physical examination showed no limitation in range of motion, joint tenderness, hotness, or swelling, so the clinical impression was that of neuropathic pain. Rest did not relieve her pain, and she experienced difficulty sleeping. She was then treated with gabapentin 300 mg at bedtime, clonazepam 0.5 mg twice daily, and tramadol 100 mg three times daily. The patient reported that her pain was intractable, so the tramadol was gradually increased. Half an ampoule of pethidine was also given as needed. On the advice of an anesthesiologist skilled in pain management, 2 mL of patient-controlled analgesia (dihydroxyacetone phosphate and morphine 160 mg infused at a rate 0.2 mL per hour, with a loading dose of 2 mL, a dose ceiling of 10 mL over four hours, and a lockout interval of eight minutes) was arranged for two weeks. Given the potential problem of lethargy as a side effect of morphine, her pain medication was augmented by increasing the dose of her fentanyl patch to 24 mug per hour, along with administration of clonazepam 0.5 mg three times daily, gabapentin 300 mg three times daily, and a combination of acetaminophen 325 mg + tramadol 37.5 mg four times daily. We also added nonsteroidal anti-inflammatories, an antidepressant (sertra-line), anticonvulsants (tizanidine, baclofen), and acupuncture, to no avail. Her visual analog pain score remained at 7-8. The dose of gabapentin was gradually escalated from 100 mg to 300 mg three times daily, and titrated by 100-300 mg every 3-7 days to the usually effective daily dose range of 1800-3600 mg. Her pain became unbearably severe during rehabilitation, to the extent that she cried throughout the day. Morphine 10 mg was given via injection as needed, but caused general weakness, dizziness, dry mouth, and hallucinations, which prevented any further rehabilitation. Six weeks after starting the patient on medical treatment for her neuropathic pain, we resorted to an intrathecal morphine pump to maintain the lowest dose of morphine able to keep the therapeutic effects and side effects in balance. A catheter was inserted into the dural sac via the L4/5 space, with the morphine dosage maintained at 0.2 mL (0.5 mg) per hour. Her pain was relieved immediately during a preimplantation trial, so an intrathecal pump (Figure 2) was implanted and set to deliver a morphine dosage of 1.3 mL (3.25 mg) per hour during the day and 1.0 mL (2.5 mg) per hour at night. Her visual analog score decreased to 2-3, and the muscle cramps ascending from the leg to the chest became mild, lasting for about 10-15 seconds and appearing at intervals of about 30-60 minutes. Previous medication was stopped, with only tizanidine 4 mg three times daily being administered after implantation of the pump. Her pain, numbness and tingling, and cold, burning, and cramping sensations were relieved significantly and she was able to return to her rehabilitation program. After rehabilitation, muscle power in her lower limb improved markedly from 2 to 4. Her neurologic deficit also improved at this point, such that her training program of intermittent catheterization four times daily was discontinued in favor of spontaneous voiding. Functional status, such as ability to sit, improved from poor to fair. Her functional status improved from complete dependence to being able to perform activities of daily living with moderate assistance. Her functional independence score increased from 48 prior to implantation to 74 at the time of discharge, and further to 87 seven months after admission. Her Barthel index increased from 10 to 25 after four months of an aggressive rehabilitation program.

intrathecal morphine pump, neuropathic pain, rehabilitation, transverse myelitis

PMC6224049_01

Unknown

Data was collected from a 6-year-old ALGS patient undergoing a hybrid X-ray catheter/DSMRI study as described previously. Combined acquisition of functional (flow and volumes) at rest and peak dobutamine stress (20 mug/kg/minute) and three-dimensional (3D) morphologic MRI data (dual-phase), with concomitant central pressure monitoring, was performed and used to parameterize the computational simulations. Images were acquired using a 1.5T MR-scanner (Achieva, Philips, Best, Netherlands) and a Philips BV Pulsera cardiac X-Ray unit under general anesthesia, which was maintained constant throughout the procedure. Details of the imaging parameters are provided in Table A in S1 File. A novel modeling framework that integrates image data and detailed invasive/non-invasive measurements was used to obtain a faithful computational representation of the patient's physiology. A brief description of key aspects of the model is provided in the following sections (further details are available in the Technical Note in S1 File). The CRIMSON custom software (CardiovasculaR Integrated Modeling and SimulatiON; http://www.crimson.software/) was used to segment the aorta and main branches, including the coronaries, and the central pulmonary arteries, using a semi-automatic segmentation method to produce an analytical representation of the vessels (Fig 1) from the diastolic phase of the 3D-Steady-state free precession (SSFP) sequence. Details regarding this segmentation approach are found elsewhere. The 3D geometry was discretized into a volumetric finite element mesh consisting of 1,687,949 tetrahedral elements (characteristic dimension h = 0.8mm) and 325,463 nodes, with curvature-based refinement. Blood was modeled as an incompressible Newtonian fluid (density rho = 0.00106 g/mm3 and viscosity mu = 0.004g/mm s). Blood vessels were modeled using the Coupled Momentum Method, whereby an incompressible linear elastic membrane with spatially-varying structural stiffness is monolithically-coupled to the fluid domain. The linearized stiffness (E) of the aorta, its branches, and the central pulmonary arteries were prescribed according to the equation: where Psyst and Pdiast represent the catheter-derived systolic and diastolic pressures, respectively, and Dsyst and Ddiast the 3D-SSFP-derived systolic and diastolic diameters at the level of the aortic and pulmonary artery roots, respectively. Wall thickness was prescribed to be 1 mm throughout. This produced a linearized stiffness of 2.26 x 105 g/mm s2 for the systemic and 1.30 x 105 g/mm s2 for the pulmonary arteries. Expanding on previous developments by our group, we have designed a closed-loop coupled-multidomain (3D-0D) model consisting of image-based portions of the pulmonary and systemic circulations (where image data was available), and LPN (0D) models of the heart chambers and the arterial and venous distal circulations (see Fig 1). Parameter values for the LPN models for each condition are given in Tables B-F of the Technical Note in S1 File. Metabolic control of the coronary microcirculation was achieved using a method develop by our group, which has been tested against invasive patient data. The foundation of this LPN model relies on using CBF as a surrogate of myocardial oxygen delivery, and on dynamically adapting coronary microvascular resistance to eliminate any "myocardial hunger" (i.e. mismatch between oxygen demand and supply). The myocardial oxygen demand per heartbeat was computed from the cardiac workload, determined by the 0D heart model, after integrating the area of the ventricular pressure-volumes curves and the ventricular elastance function. Because the CMCM can reproduce patient coronary vasomotor responses to changes in cardiac workload, it has the ability to predict CBF adaptations in response to changes in the myocardial oxygen demand and coronary perfusion pressure gradient. This permits simulation of the coronary response to a generalized vasodilation state as seen during liver reperfusion and enables specific probing of the complex coronary microcirculatory responses. The model assumed a fixed oxygen extraction of 40% and 80% for the RCA and LCA respectively at Rest and 100% for both coronary circulations at Stress. RV and LV elastance functions were derived from ventricular cines and catheterization data, describing cyclic ventricular volume and intraventricular pressures, respectively, using methods described in Arthurs et al. Ventricular volume curves, obtained by manually contouring the endocardial borders of all cardiac phases of the cardiac MRI short-axis cines, were matched with the corresponding R-wave in the invasive pressure recordings to obtain time-varying elastance functions (further details in the Technical Note in S1 File). Ventricular volumetric parameters for the Rest and Stress conditions used to define their corresponding elastance functions are listed in Table 1. At peak DSMRI, cardiac output increased by ~45% from baseline. No regional wall motion abnormalities were noted. Tissue stiffness was kept constant through all three experimental conditions. The PRS condition was defined by imposing a 31% drop in MAP relative to the Stress condition, following Hilmi et al. definition of significant PRS. All simulations were performed in our custom parallel blood flow solver CRIMSON using 128 processors on a SGI Altix UV, using a total simulation time of 150 hours per case.

PMC9124143_01

Female

A thirty-five-year-old female presented with complaints of per rectal bleeding mixed with stools. She had recurrent episodes associated with crampy lower abdominal pain over a period of five days. Upon further enquiry, she also reported a history of productive cough for three months, night sweats, and weight loss of ten kilograms over the same period. Her medical history was significant for rheumatic heart disease and atrial fibrillation. The patient had a surgical history of mitral valvuloplasty two years prior to her current presentation. Her regular medications included warfarin 5 mg daily, carvedilol 25 mg twice daily, and furosemide 40 mg daily. The examination revealed a sick-looking middle-aged female who had pallor, bipedal edema, and no palpable lymphadenopathy. The precordial examination was positive for features of mitral stenosis and aortic regurgitation. Abdominal examination did not elicit any tenderness or palpable mass. Investigations done included a complete blood count with the following results: white cell count 9.24 x 109/L, hemoglobin 5.30 g/dL, and platelets 572 x 109/L. The prothrombin time was prolonged, and the international normalized ratio (INR) was 2.78. Renal and hepatic function tests were normal. Initial management involved withholding of warfarin and transfusion of three units of packed red cells. An urgent colonoscopy performed to evaluate hematochezia revealed segmental inflammation of the ascending colon with ulcerations and polyps covered with yellowish exudate, a distended ileocecal junction, and an aberrant vascular pattern with mucosal edema extending to the hepatic flexure (Figure 1). At endoscopy, the differential diagnoses were tuberculosis or CD. In view of her respiratory complaints and accompanying systemic symptoms, a computed tomography (CT) of the chest and abdomen was performed, which demonstrated right lung consolidation, focal subsegmental consolidations in the left lung, and subcentimeter-sized lymph nodes in the small bowel mesentery (Figure 2). Given her history of chronic cough and chest imaging findings, a sputum test was requested whose staining was acid-fast bacilli (AFB) positive. Biopsies of the samples obtained during colonoscopy revealed lymphocytic infiltration, necrotizing granulomas, and positivity for AFB (Figure 3). Serologic testing for human immunodeficiency virus (HIV) was negative. A diagnosis of pulmonary and extra pulmonary tuberculosis with gastrointestinal involvement was established. The patient was initiated on the intensive phase of antituberculous therapy consisting of rifampicin (600 mg/day), isoniazid (300 mg/day), ethambutol (800 mg/day), and pyrazinamide (1 g/day). Warfarin 5 mg daily was reinstituted prior to her discharge after a five-day hospital admission. The culture in Lowenstein-Jensen medium later isolated Mycobacterium tuberculosis complex, which was susceptible to the first-line drugs. She is followed up at the outpatient clinic with regular INR checks to ensure a therapeutic INR range of 2.0-3.0. Her warfarin dosage was increased from the initial 35 mg/week to 52.5 mg/week by the fourth week after discharge.

PMC5458707_01

Male

A 30-year-old male presented with a 1-year history of right ankle pain and swelling. He denied any history of recent infection but had had recurrent ankle pain that had been treated accordingly. When he visited our outpatient clinic, he was afebrile but had fullness of the right ankle when compared to the unaffected side (Fig. 1). There was no skin lesion, and the right ankle had almost a full range of motion except terminal restriction of dorsiflexion. Radiographs of the ankle showed apparently normal tibiotalar joint in comparison to the contralateral side (Fig. 2). We suspected osteochondral injury of the talus and advised magnetic resonance imaging (MRI) and it showed lesions over the tibiotalar joint with joint effusion and cartilage destruction of the ankle joint (Fig. 3). On admission, laboratory findings included a white blood cell count with normal values. The erythrocyte sedimentation rate was 30 mm/h and C-reactive protein was slightly elevated. Rest all laboratory investigations were normal. In view of long-standing symptoms and MRI findings, inflammatory/pyogenic arthritis or neoplasm like osteoid osteoma of talus was suspected. With the patient in a supine position, under spinal anesthesia, the tibiotalar joint was visualized with an arthroscope after placing two standard portals. Arthroscopy was preferred because it is minimal invasive and was ideal to get tissue of interest for further investigation. Whole articular cartilage has already destroyed with lesion in the distal tibia and talus (Fig. 4). Adequate debridement of the denuded cartilage and loose bodies with synovial tissue was done. In addition, microfracture of the exposed bone was done, and the specimen was sent to histopathological analysis and polymerase chain reaction (PCR)-GeneXpert studies. The patient was advised for nonweight bearing and ankle joint mobilization. Prophylactic antibiotic treatment was given postoperatively for 24 h. The GeneXpert for specimen showed Mycobacterium TB, without resistance for rifampicin (Fig. 5). Four combined anti-TB drugs (ethambutol, isoniazid, rifampicin, and pyrazinamide) were used for 9 months, and then reviewed periodically in the outpatient clinic and was kept nonweight bearing for 1 month. In view of destruction of articular cartilage, he was proposed for ankle arthrodesis at later date. Clinically, his range of motion was painless and full, he did complain of joint pain on weight bearing for long duration. Follow-up evaluation 2 years later showed no recurrence of infection. Patient has almost full range of movements with terminal restriction of the ankle dorsiflexion. He can walk for short distances of about 100 m with ease. He does drive a van with ease for his transport business. Hence, he is yet to decide for proposed arthrodesis.

ankle joint, ankle arthroscopy, arthritis, tuberculosis

PMC3420739_01

Unknown

In the case of the 51-year old proposita, the diagnosis of an AML M4eo was confirmed morphologically and cytogenetically by the characteristic inversion (16) (p13q22) in 12/2003. Because of a punctio sicca, no blood from the bone marrow could be aspirated for FACS analysis. A complete remission, also on cytogenetic level, was achieved after the first cycle of cytosine arabinoside, idarubicin, and etoposide induction therapy. This outcome was consolidated by high-dose chemotherapy with cytosine arabinoside and mitoxantrone as well as consecutive allogeneic PBSCT from an HLA-matched sibling donor after total body irradiation/cyclophosphamide (TBI/Cy) in 05/2004. Four weeks after the PBSCT, a 100% donor chimerism was detected. The patient experienced chronic graft versus host disease (GvHD), necessitating a low-dose systemic steroid treatment. In 11/2007, a hysterectomy was performed after the occurrence of a painful uterine tumor, yielding the diagnosis of a GS-expressing MPO, the monocyte marker CD68 and KiM1P, without any bone marrow manifestation of the AML (Figure 1). The donor chimerism remains 100%. The surgery was followed by radiotherapy of the pelvis and withdrawal of immunosuppressive medication, leading to limited GvHD with cutaneous and mucocutaneous manifestations. In 11/2008, recurrent epigastric pain leads to a gastroscopy documenting again a GS (expression of CD68 and MPO) of the duodenum, without bone marrow infiltration and detectable inversion 16 and still with 100% donor chimerism. The patient received high-dose salvage chemotherapy with cytosine arabinoside and mitoxantrone, followed by donor lymphocyte infusions (DLI) inducing a third complete remission. However, in 04/2009 a meningeosis leukaemia (227 cells/mm3 liquor, expression of CD68 and MPO) was diagnosed, and treatment with intrathecal cytosine arabinoside initiated. The patient received no systemic chemotherapy because of a reduced general state of health and died from meningeal leukemia progression in 03/2010.

PMC3964671_01

Male

A 37-year-old Caucasian man working as a mechanic presented to the emergency department with a solitary swelling on the right side of his chest wall. He had previously had an incision and drainage of the abscess on the same site while working in the Middle East. He was not diabetic and was immunocompetent. He had injected anabolic steroids in the pectoral muscles for body building in the past. On examination, he had a 5cm x 5cm abscess in the right axilla. It was incised and drained under general anaesthesia and he was discharged home with a course of oral amoxicillin and clavulanate 625mg three times a day for seven days. A routine bacterial culture of the wound showed no significant growth. The patient presented again a week later with recurrence of the abscess. Further incision and drainage was performed and again the swabs did not yield any bacterial growth. A week later, he presented for a third time with yet another recurrence. The abscesses were erythematous, tender and discharging pus. He underwent further drainage of the abscess cavities. On this occasion, a tissue sample was sent for histology and microbiology analysis. The impression at this time was one of hidradenitis suppurativa (Fig 1). These indurated and multiple abscesses required a fourth round of surgery. The histology was reported as 'chronic inflammation with multinucleate giant cells along with foci of caseating necrosis surrounded by granulomas' (Fig 2). There were no acid-fast bacilli demonstrated on special staining. However, the diagnosis was thought to be probable tuberculosis. The patient was referred to the respiratory physicians for treatment of tuberculosis. However, the tissue culture isolated a very resistant Mycobacterium fortuitum, and so he was treated with ciprofloxacin 750mg twice daily and doxycycline 200mg daily. He was unable to tolerate ciprofloxacin and was switched to a second line quinolone in the form of moxifloxacin 400mg daily and continued on doxycycline 200mg daily. Unfortunately, he developed side effects with the second quinolone and this was also discontinued. The extensive antibiotic resistance pattern meant there were few oral treatment options. Computed tomography of the chest excluded secondary pulmonary involvement. The respiratory physician referred him back for further surgical excision with a view to obtain clear margins. He was reviewed in the surgical clinic few weeks later. The wound had healed completely (Fig 3). Histology revealed only fibrous scar tissue and no evidence of any granulomatous inflammation.

PMC8249845_01

Female

Here, we present a case of advanced bladder urothelial carcinoma. A 66-year-old female patient was diagnosed with bladder occupying mass, left hydronephrosis, and left ureter dilatation in a local hospital due to painless hematuria for 2 months. The patient was then hospitalized in Henan Cancer Hospital. The results of enhanced CT (2019.4.4) showed: 1. Thickening of the lower ureter and nodules at the entrance of the vesicoureter, about 25mm*22mm in size, with fluid in the dilated upper ureter and renal pelvis, and possible atypical cell carcinoma. 2. There are multiple lymph nodes in the retroperitoneum and between the liver and stomach. 3. Multiple metastases in both lungs. 4. There are multiple swollen lymph nodes in the running area of the left iliac vessels ( Figure 1A ). Renal dynamic imaging and glomerular filtration rate were measured with 99m-Tc-DTPA. Diagnostic considerations: 1. No obvious abnormality in blood perfusion of the right kidney. 2. The right glomerular filtration function is normal. 3. Poor excretion in the upper right urinary tract. 4. No function in the left kidney ( Figure 1B ). In order to relieve the symptoms of left kidney compression, a percutaneous external renal pelvic drainage tube was placed on April 11, 2019. Cystoscopy was performed, and the pathological results of biopsy showed urothelial carcinoma. There was no clear muscle infiltration in the submitted tissues( Figure 1C ). Immunohistochemistry: P63+,CK20+,CK7+, CyclinD1+, Ki-67: 80% ( Supplementary Figure 1 ). The final diagnosis was stage IV bladder urothelial carcinoma with multiple lung metastases. Because the patient has only one normal kidney left. According to the patient's age, physical fitness score and considering the nephrotoxicity of cisplatin, we choose gemcitabine (1000mg/m2, d1 8, q21d) as a single agent for the first-line treatment. After two cycles of gemcitabine treatment, the efficacy of chemotherapy was evaluated as SD (stable disease) ( Figure 2A ). The efficacy of chemotherapy remained as SD after four cycles of treatment ( Figure 2B ) and it became PD (progression disease) after six cycles of treatment ( Figure 2C ). According to the patient's age, economic status, PD-1 donation policy and family's wishes, Sintilimab (200mg, on day1, q21d) was used for the second-line treatment for three cycles on 2019.9.20 2019.10.16 and 2019.11.12. The treatment efficacy is evaluated as PR (Partial response) ( Figure 3 ). Then Sintilimab was given for the fourth cycle of immunotherapy on 2019.12.04. One week later, on December 10, 2019, the patient developed chest tightness and shortness of breath, accompanied by gradual increase in dyspnea. The local hospital gave oxygen inhalation and anti-asthmatic treatment, but the symptoms did not alleviate. Chest CT examination considered infectious lesions of both lungs. Serological examination ruled out tuberculosis or Aspergillus infections. Subsequently, the patient was transferred to our hospital for further treatment. On admission, her blood oxygen saturation was 75%, and his skin was cyanotic. The breath sound of auscultation in both lungs is thick, and the wheezing sound can be heard. The results of chest CT examination on 2019.12.26 showed pneumonia in both lungs, that are more severe than earlier images ( Figure 4 ). The patient was suspected to had developed grade 3 immunotherapy-related pneumonia, and was given an intravenous infusion of methylprednisolone at 1 mg/(Kg.d) for 72 hours. After 3 days, the patient's chest tightness symptoms improved, and oxygen saturation reached 94%. The methylprednisolone was changed to oral administration and the dose was gradually reduced by 5-10mg per week. By March 23, 2020, methylprednisolone was reduced to 10mg/d orally, at which time the blood oxygen saturation had reached 96%. We performed chest CT to observe the changes of pneumonia, and the results showed that pneumonia of both lungs had improved significantly ( Figure 4B ). On January 14, 2021, the patient underwent whole-body enhanced CT evaluation. To our surprised, the results showed that the patient's lung metastases disappeared, and the local soft tissue shadow at the entrance of the ureter on the left side of the bladder disappeared completely ( Figure 5A ). The patient achieved progression-free survival for more than one year ( Figure 5B ). The current condition is generally good.

pd-1, advanced, case report, complete response, urothelial carcinoma

PMC9263211_01

Male

The now 26-year-old patient [case #17; Table 2 in our previous publication ] is the son of consanguineous Pakistani parents, who were healthy and had normal blood counts. One sister was healthy, a second sister suffered from hepatitis C, but had normal blood counts. He had been prone to infections, primarily recurrent bronchitis, since birth and was first seen in our clinic when he was five and a half years old with fever and coughing. He was growth retarded and had a microcephaly (<3rd percentile), clinodactyly of both hands and hyperpigmented skin above the knees and elbows. Apart from his microcephaly, imaging of the head, the thorax and the abdomen remained inconspicuous. Screening for causative infectious agents, including Mycobacterium tuberculosis, was unrewarding. Immunological analyses that were performed during the course of the disease revealed IgA deficiency and B-lymphocytopenia (Details are provided in Supplementary Table 1 ). Hematologic analysis at first presentation revealed a white blood cell count of 1.47 x109/L with an absolute neutrophil count of 0.76 x109/L and an absolute lymphocyte count of 0.47 x109/L, a hemoglobin level of 9.2 g/dL, MCV of 75fl, and a platelet count of 109 x109/L. Data on the long-term course of hematological parameters are provided in Supplementary Figure 1 . A bone marrow (BM) examination disclosed reduced cellularity of all three lineages with an erythropoiesis-restricted dysplasia that, together with the presence of a fluorescence in situ hybridization (FISH)-verified monosomy 7 in 18% of the analyzed nuclei, was consistent with the diagnosis of a hypocellular myelodysplastic syndrome in form of a refractory cytopenia. Although the appearance of monosomy 7 in IBMF is strongly indicative of an underlying SAMD9/9L or GATA2 deficiency, these disease-promoting germline causes were not known at that time.

nhej1, nhej1-deficiency, del(20q), monosomy 7, myelodysplastic syndrome, refractory cytopenia

PMC4590319_01

Female

A 27-year-old woman with mild myopia presented with blurred vision and photopsia of the right eye for 2 weeks. She had no particular medical or ocular histories. The patient's best-corrected visual acuity (BCVA) was 1.0 OD (oculus dexter) and 1.5 OS (oculus sinister). Relative afferent pupillary defect was negative. There were no abnormal ocular findings OS. Slit-lamp examination revealed no inflammation in the anterior chamber or vitreous. Funduscopic examination showed multiple, faint, subretinal white dots at the posterior pole to the equator and macular granular change (Figure 1A and B, arrowheads). In addition, retinal vascular sheathing was observed at the midperiphery (Figure 1B, arrows). Fluorescein angiography (FA) showed hyperfluorescence continuing from the initial phase corresponding to the white dots (Figure 1C, arrowheads) and the staining of the optic disk. The retinal sheathing sites showed vascular staining with leakages in the late-phase OD (Figure 1C, arrows). Indocyanine green angiography showed no abnormal appearance in the initial phase and multiple hypofluorescence at the wider area than the white dots (Figure 1D, arrowheads). Enhanced depth imaging optical coherence tomography (EDI-OCT) revealed the discontinuity of the ellipsoid zone at macular area OD (Figure 1E, arrows) and that the subfoveal choroidal thickness (SCT) was 295 microm. Humphrey perimetry (30-2 Swedish threshold interactive algorithm standard test) showed a mild blind spot enlargement OU (oculus uterque) (mean deviation [MD] value: -1.83 dB OD and -1.08 dB OS). Multifocal electroretinography (mfERG) showed entirely decreased amplitude, except normal central amplitude OD, and mildly decreased amplitude at the retinal site that corresponded to the peripapillary area OS. Infection screening, including tuberculosis, syphilis, human T-cell leukemia virus type 1, and toxoplasmosis, showed negative results on QuantiFERON and serological testing or with antibodies for these agents. The chest X-ray was normal and serum angiotensin-converting enzyme was within normal limit. The patient received a diagnosis of MEWDS OD and was followed up with no treatment. One month after the first visit, the white dots and retinal vascular sheathing spontaneously resolved. After 3 months, the ellipsoid zone at the macula restored and the SCT decreased to 237 microm, together with increased BCVA of 1.5 OD (Figure 1F). On Humphrey perimetry, the MD value improved to -0.28 dB OD and -0.69 dB OS.

choroidal thickness, enhanced depth imaging optical coherence tomography, inner retinal layer, retinal vascular sheathing

PMC8634345_01

Male

The patient was a 53-year-old man. Thirty years ago, the patient had a mung bean-sized red papule on the inner side of his left nipple without obvious inducement. The papule gradually increased in size, but there were no conscious symptoms. In the past year, the patient experienced erosion and a scab appeared in the center of the lesion. As a result, he visited our clinic ( Figure 1A ). There was no family history with similar symptoms. The patient had tuberculosis in the right chest wall 30 years ago and was cured back then.

contrast-enhanced ultrasound, dermoscopy, diagnosis, high-frequency ultrasound, sweat gland neoplasms, treatment

PMC8632055_01

Male

In December 2019, a 6-month-old boy was admitted to our hospital due to edema for 1 week and fever for 1 day. The child was the first child of a non-consanguineous marriage and with full term of 39W+2, was delivered by cesarean section, had a birth weight of 3,900 g, and had no remarkable details regarding medical or personal history. At admission, there was prominent edema on the whole body and pitting edema on the anterior tibial area. We diagnosed the patient with NS based on nephrotic-range proteinuria (263 mg/kg/day), obvious hypoalbuminemia (12.2 g/L). There were also several other abnormal laboratory results (Table 1). In particular, the coagulation function was altered with decreased antithrombins (AT) and slightly increased level of D-dimer and activated partial thromboplastin time (APTT). However, the prothrombin time (PT), fibrinogen degradation products (FDP), and fibrinogen (Fib) were in normal ranges (Table 1). The ultrasound showed enlarged kidneys (the left and right kidney were 8.5 x 4.9 x 4.0 cm and 8.6 x 4.9 x 3.7 cm, respectively) with hyperechogenicity of renal parenchyma, blurred cortical and medullary boundaries. The depth of pelvic and abdominal cavity effusion was 3.4 cm. A chest computerized tomography (CT) showed multiple bilateral pulmonary foci, partial pulmonary consolidation, bilateral pleural effusion, and poorly inflated adjacent pulmonary alveoli. His heart function was normal and the nervous system had no abnormalities. The routine urine test results of both parents were normal. We prescribed ceftriaxone for anti-infective treatment and other adjuvant therapies, such as infusion of plasma and albumin, to increase the colloidal osmotic pressure and manage the diuresis. He received the administration of intravenous enoxaparin sodium 0.06 ml/day (50 AxaIU/kg/day) for anticoagulant therapy at admission because of severe hypoalbuminemia and complicated fluid management. We also administered intravenous immunoglobulin intermittently to provide immune support. The levels of free triiodothyronine (FT3) and free thyroxine (FT4) were significantly reduced, and the level of thyroid-stimulating hormone (TSH) was significantly increased, but there were no evident abnormalities in ultrasound. The diagnosis of hypothyroidism was considered, and we administered oral levothyroxine sodium (12.5 mug/day). The child developed an intestinal infection caused by norovirus after hospitalization. Due to his young age and this infection, after excluding tuberculosis, we administered intravenous methylprednisolone (1.6 mg/kg/day) on the 4th day in the hospital. After 25 days of hospitalization, the child's general condition improved significantly, the edema subsided, the 24-h urine protein had decreased significantly (0.43 g/day), and the plasma albumin increased to 20.5 g/L. Analysis of coagulation showed that AT, D-dimer, APTT, PT, FDP, and Fib returned to their normal ranges. The child was discharged and continued to take adequate oral prednisone (2 mg/kg/day) for 2 weeks with a gradually reducing dosage (2 and 0.5 mg/kg/day alternatively in the morning) for 1 month. After that 2 mg/kg/day on an alternate day for 2 weeks, then reduce 2.5 mg every 2 weeks. Because of the young age at disease onset, we considered the child might have had congenital NS. Therefore, we performed trio whole-exome and mitochondrial genetic sequencing on the 5th day in the hospital. Briefly, 3 mL of peripheral blood was collected from the patient and his parents, and genomic DNA was extracted using a blood genome extraction kit (Tiangen). Capture sequencing was performed using the human total exome capture probe of JOY Orient. The capture probe covered the coding region of 19,396 genes in the human genome, and the capture target interval was 39 MB. A total of 429,826+ capture probes were designed and synthesized, and the capture probe covered 51 M. Sequencing was performed using the Novase Q6000 instrument. After obtaining the original sequenced reads, fine filtering of raw reads was required. Clean reads obtained in this way were compared with HG19/GRCH37 (reference genome). Software (GATK) was used for detection and analysis of single nucleotide polymorphisms and InDels. The coverage of the target area was 99.90%, and the average depth was 109-fold. The results indicated a novel hemizygous potentially pathogenic variant, c.2717A>G (p.His906Arg), in exon 17 of the TBC1D8B gene. This potentially pathogenic variant was derived from the mother (who had no history of symptoms and no proteinuria) and the father's gene was normal (Figure 1). The amino acid sequences for this site (His906) showed that it was identical in Homo sapiens, Pan troglodytes, Macaca mulatta, Canis lupus familiaris, Mus musculus, Rattus norvegicus, Gallus gallus, and Danio rerio (Figure 1). The minor allele frequency (MAF) of this site in the gnomAD database was 0.0005 (East Asia). Protein structure and function prediction software indicated the variant was probably damaging (Polyphen) or deleterious (SIFT). The child was followed up for 1 year (Table 2) and treated with oral prednisone, vitamin D, and calcium supplementation. During this follow-up period, the boy experienced 2 relapses of NS when alternate-day morning prednisone was reduced to 17.5 mg (March 2020), and the second recurrence was accompanied by a fever (June 2020) which indicated steroid-dependent NS. Adequate oral prednisone (20 mg/day) was given to achieve remission, followed by dose reduction. As of November 2020, the dose of alternate-day prednisone was 5 mg. The urine test results were normal (protein negative, 2.12 RBCs/HPF), and the 24-h urine protein was 0.12 g/day. The child's serum albumin returned to normal (42.6 g/L), as did his renal function (blood urea nitrogen, 2.87 mmol/L; serum creatinine: 17.5 mumol/L). And the patient didn't show any signs of steroid toxicity. We reduced the oral levothyroxine sodium dose to 6.25 mug/day, and measurements of thyroid function were in the normal ranges (FT3 5.71 pmol/L; FT4, 12.4 pmol/L; TSH, 0.7323 muIU/mL).

tbc1d8b, nephrotic syndrome, podocyte slit diaphragm protein, steroid-resistant nephrotic syndrome, steroid-sensitive nephrotic syndrome

PMC6157136_01

Female

A 36-year-old female patient presented with a 4-year history of right ankle pain. She had significate loss of weight and started physical activity just before the symptoms appeared four years ago. No history of trauma was reported. First diagnosis was synovitis, for which the patient underwent physical therapy with torpid outcome. She experienced paraesthesia along the posterior and medial aspect of the ankle and foot. Symptoms got worse at the end of the day, with cramping episodes in the foot. Physical examination revealed a positive dorsiflexion-eversion test provoking numbness of the foot. Tinel's sign was positive. Ankle range of motion was limited due to pain, scored 8 using the Visual Analog Score (VAS). The patient had a preoperative score of 40 points, according to the American Orthopaedic Foot and Ankle Society (AOFAS). Bilateral electromyography (EMG) was performed, disclosing abnormal adductor hallucis and adductor digiti quinti neurophysiologic parameters in comparison to the asymptomatic side. Initial plain radiographs showed a considerable (1.8 cm) posterior bone fragment in relation with the talus (Figure 1). CT scan was then performed, which showed the presence of an articulated accessory bone. At this point, talus bipartitus (TB) diagnosis was suspected (Figure 2). MRI disclosed the presence of an inflammatory process, bone fragment covered with cartilage, and what appears to be a degenerative synchondrosis as a consequence of posteromedial impingement (Figure 3). In this scenario, a surgical procedure was indicated due to increasing symptoms and several conservative treatment trials with no response. Preoperatory assessment included three-dimensional CT scan images to get full awareness of the bone fragment's specific anatomy. Anatomic relationship between the tibial nerve, posterior tibial artery, flexor hallucis longus, flexor digitorium longus, and tibialis posterior tendon and the bone fragment was assessed with the help of MRI. Though fixation of the accessory bone has been previously reported, in the index case, this was not an option because of its particular shape, with a medial protuberance invading the tarsal tunnel. Excision of the bone fragment was performed. A medial approach was used. Both tibialis posterior tendon and neurovascular bundle were identified and carefully preserved. The bone fragment was removed and the tunnel was released (Figure 4). Postoperative care included cast immobilization and a 30-day weight-bearing restriction. Postoperative radiographs showed the complete absence of residual bone fragment (Figure 5). Histological findings disclosed mature bone with articular cartilage surface. After 6 months of follow-up, the patient had a VAS score of 2 and an AOFAS score of 87. At a 2-year follow-up, VAS was 1 and AOFAS was 96. Patient had no residual pain and no recurrence of neurological symptoms.

PMC4411002_01

Female

Cardiac and abdominal ultrasound scans were repeatedly normal. Brain MRI scans detected increased peritrigonal signal of white matter at the age of 10 months and focal hemimegalencephaly with perisylvian polymicrogyria at the age of 7 years. From the age of 7 years, the girl had episodes of generalized tonic-clonic seizures refractory to antiepileptic therapy. She suffers from mild cognitive impairment and attention deficit disorder, and in the last years had temper tantrums and angry outbursts. On physical examination at the age of 10 years and 4 months, her weight was 35 kg (25th-50th centile), height 138 cm (25th-50th centile) and head circumference 60 cm (+ 5.2 SD). She had left hemihyperplasia, involving face, trunk and limbs (mainly legs) with diffusely soft and thick irregularly marbled skin and prominent capillaries and veins on the trunk, abdomen and limbs. Three small (diameter <0.5 cm) achromic spots were observed on the trunk. Her 3rd right finger was significantly larger than the contralateral one and she had a bilateral proximal 4/5 cutaneous syndactyly of the 2nd and 3rd toes. Besides macrosomia, she had dysmorphic features including malar hypoplasia, hypertelorism (inner canthal distance >97th centile, palpebral length + 1 SD), long philtrum (>97th centile) and high palate, and S-shaped scoliosis.

PMC8948481_01

Female

A 2-year-old girl presented with a history of recurrent chest infections and persistent wheezing that were not responding to treatment. She was HIV-negative, there was no history of contact with tuberculosis and all tuberculosis testing including Gene Xpert MTB/RIF was negative. Plain frontal chest radiograph demonstrated a well-defined lucency in the left lower lobe medially, with a curvilinear outline resembling an inferior accessory lobe and fissure. The right lung appeared smaller than the left, but the heart was normally positioned (Fig. 1). Bronchoscopy was performed and demonstrated anterior mid-tracheal compression with pulsation. There was also narrowing of the opening of the left main bronchus with medial and lateral compression with pulsation. The bronchial configuration was abnormal on the right side with an absent bronchus intermedius. A contrasted chest computed tomography (CT) scan showed an 'isthmus' of the lung in continuity with the right lung, extending from the right hemithorax across the midline (between the heart and descending aorta) into the left hemithorax, consistent with a horseshoe lung (Fig. 2). The arterial supply was from the right lung branches (Fig. 3A) and there was a clearly defined pleural separation from the left lung (the presumed 'isthmic fissure'). Arterial supply to the isthmus was via the right lower lobe vessels and venous drainage appeared to be directly into the right atrium. A small bronchial branch of the left lower lobe bronchial tree was noted to supply the isthmus, but this appeared attenuated across the vertebral body and descending aorta, resulting in selective air-trapping of the isthmic segment (Fig. B). Even though the plain radiograph demonstrated a possible smaller right lung, there were no CT features of right (or left) pulmonary hypoplasia. The pulmonary arteries were of adequate size, if not slightly plump. The heart was normally positioned on the left. There were, however, some significant associated venous abnormalities in the form of a scimitar-type vessel, which ascended from the right lung base peripherally to join another scimitar-type vessel descending from union of two superior segmental intervertebral veins, to enter the superior vena cava as it feeds into the right atrium (Fig. 3C). The right atrium was noted to be prominent. Other CT scan findings included an absent minor fissure and a bovine variant of the aortic arch with the left common carotid artery arising together with the brachiocephalic trunk from the aortic arch, a common variant. This appeared to cause some anterior impression on the trachea superiorly.

bronchoscopy, congenital venolobar syndrome, horseshoe lung, hypoplastic lung, scimitar syndrome

Axial multidetector computed tomography (MDCT) on lung window demonstrates an isthmus of basal lung in continuity with the right lung, extending across the midline between the heart anteriorly and the aorta and vertebral body posteriorly. There is a distinct pleural interface between the isthmus and the left lung.

PMC2654867_01

Female

A 36-year-old Swedish woman with a history of recurrent breast cancer and severe CRF presented at Vidarkliniken in Sweden. Vidarkliniken provides integrated AM health care in an inpatient and outpatient setting, primarily for patients with cancer, stress-related diseases and chronic pain. The woman had been treated for breast cancer with positive axillary lymph nodes 10 years previously (see Table 2 for details of anamnesis, findings and treatment). Additional to surgical removal she had undergone bilateral oophorectomy (as participant in a clinical trial), and had received adjuvant radiotherapy and hormone therapy which, however, was halted after 4 months because of side effects. Eight years later she started suffering from extreme tiredness, and after one further year a relapse was ascertained: a palpable sternum metastasis, confirmed twice by ultrasound-guided fine-needle biopsy. The metastasis was hormone receptor-negative in contrast to her primary breast cancer. On computer tomography two small changes in the lungs were considered as possible metastasis. The woman received palliative chemotherapy which was halted after 5 cycles because of severe side effects. Subsequently, she underwent radiotherapy of the breastbone. Both treatments had good clinical and radiological result: the sternum metastasis was no longer palpable, follow-up computer tomographies and skeletal scintigrams showed complete remission. Subsequently no further disease activity was observed, either radiologically or clinically.

PMC9982323_01

Female

We examined the case of a 36-yr-old primigravid woman with STs. She had a mosaic karyotype with 3 clones: 45X (69), 46XX (23), 47XXX (8), and 1000 interphase nuclei. Karyotype corresponds to STs. The morphotype is characteristic of the syndrome: short stature, obesity, low-hair growth, epicanthus, lymphedema, inverted nipples, and the curvature of the lower leg bones. Pregnancy was done by IVF with a donor egg, height 155 cm, weight 71.3 kg, and body mass index of 29.7 on registration. She was examined by the following specialists: an endocrinologist, cardiologist, geneticist, hematologist, urologist, and therapist. The endocrinologist diagnosed STs hypothyroidism and prescribed eutirox 75 mg once a day for a long time. The ultrasound of the thyroid gland showed a colloid cyst of small size, 0.55 cm. The cardiologist diagnosed chronic arterial hypertension of the first degree. Methyldopa was prescribed 250 mg once a day from the gestational age of 10 wk. During echocardiography, the aorta remained unchanged and not dilated; the valves were intact; the heart cavities were not violated; the systolic function was not impaired, and the diastolic function was type 1 impaired. In addition to STs, the geneticist diagnosed 2 gene polymorphisms: identified homozygous mutations in the fibrinolysis system gene, and a heterozygous mutation in the gene regulating the accumulation of homocysteine. The consequence of these mutations might be associated with a decrease in the fibrinolytic activity of the blood and the accumulation of homocysteine in the blood. After genetic analysis, the hematologist diagnosed congenital thrombophilia. A violation of folate metabolism was identified. Prescription: folic acid 800 gr, low-molecular weight heparin (LMWH) 0.4 ml subcutaneously 1 time per day under D-dimer control, acetylsalicylic acid 75 mg per day in the evening until 36 wk of pregnancy. The urologist diagnosed for chronic pyelonephritis in remission. Congenital malformations of the urinary system were not detected during the ultrasound study; however, a culture of urine revealed bacteriuria, which was treated with phosphomycin. In addition, phytourinary antiseptics were permanently assigned. The woman accepted calcium preparations of 1.0 gr to prevent hypertensive complications during the 38 wk of pregnancy. When carrying out an ultrasound of the abdominal organs, the following conclusions were obtained: intestinal pneumatosis, moderate reactive changes in the liver and pancreas, signs of chronic cholecystitis, the expansion of the renal sinus in both kidneys, and dilatation of the cups on the left. However, severe extragenital pathology has not been identified, as reflected in the relatively favorable course of pregnancy. Before pregnancy, hormone therapy was conducted using estradiol and micronized progesterone. After the embryo transfer, a standard supporting therapy of estradiol 1.5 mg was assigned, along with micronized progesterone 300 mg, 200 mg, 300 mg, and progesterone oil solution 2.5 ml intramuscularly. When a heartbeat occurs, estradiol is canceled. Table I presents an illustration of the drugs taken by a pregnant woman during pregnancy. Thus, the woman took: From the time of transfer to 6-7 wk, Estradiol 1.5 mg. Progesterone 2.5 ml in the form of an oil solution from the moment of transfer to 20 wk. Micronized progesterone from the moment of transfer to 36 wk was given. 800 mg micronized progesterone every day for up to 20 wk. and 700 mg after 20 wk. Progesterone stayed at the values of 49.38-64.56-61.08-58.8 ng/ml. At 30 wk, 500 mg was given in 2 doses; however, at 35 wk one evening dose for 7 days was canceled. Under LMWH, the dose was maintained once a day under the control of the D-dimer. Because of the premeditated training, the transfer is canceled and resumed when the ultrasound confirms a heartbeat. Upon receipt of the values of the D-dimer 0.178 mg/l-0.162 mg/l (at a rate of 0.23 mg/l). LMWH was canceled 48 hr before the delivery, and continued after the operation daily during stay in the hospital. When discharged from the hospital, a normal hemostasiogram LMWH is received up to 42 days after childbirth. From 10-36 wk, acetylsalicylic acid 75 mg was prescribed daily in the evening. Calcium preparations, 1.0 gr daily, from 10-38 wk. Phosphomycin once in 14 wk. Phytourinary antiseptics with courses of 2-3 wk and interruptions of 2-3 wk from 16 wk before childbirth. Methyldopa 250 mg once daily for 10 wk prior to delivery. Eutirox 75 mg for a long time. Ultrasound examinations were conducted according to the protocols for diagnosing chromosomal abnormalities (at 13 wk), congenital malformations of the fetus (at 20 wk), and at 16, 20, 24, and 32 wk for cervicometry. At 20 wk, low placentation was diagnosed (3.7 from the internal os). At 32 wk, this diagnosis was withdrawn. Considering IVF, the underlying pathology, the fetus was monitored for chronic arterial hypertension, congenital thrombophilia, and Doppler measurements at 26-27, 30-31, and 32-33 wk, without disturbing the uteroplacental and fetal-placental blood flow. Cardiotocography (CTG) was performed at 34-35 and 37 wk, with no pathology. During pregnancy, the woman gained 18 kg of weight. Blood pressure throughout the observation period remained stable at 110/70-120/80 mm Hg (while taking methyldopa 250 mg once a day from the 10 wk). An increase in blood pressure was noted at 35 and 37 wk of gestation, up to 140/90 mm Hg. Lower extremity edema was observed between wk 32 and 33. However, with the lymphedema characteristic of these women, stable blood pressure and the absence of proteinuria were noted. Thus, a drinking regimen and phytouroantiseptics to increase urine filtration were recommended. In clinical analyses such as complete blood count, urinalysis, and biochemical blood tests, pathology was not revealed. During the entire observation period, the woman was constantly disturbed by vomiting on an empty stomach in the morning. From the 20 wk, insomnia was observed due to active fetal movement at night. From the outcomes of the therapist, ultrasound of the abdominal organs, and biochemical blood tests, urinalysis did not reveal any pathology, and no action was taken. In addition, other methods that examined the state of the fetus, such as Doppler CTG, did not reveal any pathology. In the 37 wk of gestation, an increase in edema syndrome and systolic blood pressure of 150-160 mm Hg were observed. The patient was hospitalized in a third-level obstetric facility and delivered by cesarean section routinely at 38 wk. Indications for a planned cesarean section included pregnancy, IVF, severe pre-eclampsia, and lack of preparation of the birth canal. The girl was delivered at 2496 gr, a 48 cm increase, with Apgar scores of 7-8. In the postpartum period, on day 2 came colostrum. However, the child received solid foods in insufficient quantities. After discharge, breastfeeding continued, but pediatricians recommended the lure. Breastfeeding lasted approximately one month. Then, the child is entirely shifted to the mixture. Hormone replacement therapy continued for 42 days after birth. At that moment, the woman received estrogen-progestin replacement therapy to reduce her body mass index by 24 kg/m. The pregnant woman gave informed consent to conduct this study.

hypogonadism, infertility, progesterone, pregnancy, turner syndrome

PMC4491481_01

Female

A 26 year-old woman with no medical history of personal or family tuberculosis was admitted for a left sub-mandibular swelling which had appeared 12 months earlier. It began small then gradually increased in volume without alteration of the general condition. Many broad-spectrum antibiotics were attempted without any improvement. Examination showed a 5 cm painless, elastic left parotid mass, adherent to the skin and deeper layers, with mild inflammation of the overlying skin but without fistula or facial paralysis (Figure 1). Moreover, we found ipsilateral sub-mandibular lymphadenopathies. The contralateral parotid region was unremarkable. Otoscopy was normal and oral cavity examination showed neither left tonsillar deviation nor purulent secretions from the left Stensen's duct. The MRI showed a 4.6 cm, irregular and heterogeneous tumoral process of the deep lobe of the left parotid gland with a T1 hyposignal and a T2 hypersignal, and heterogeneous enhancement after gadolinium injection (Figure 2). Fine needle aspiration cytology (FNAC) of the mass was inconclusive. We, therefore, decided an exploratory extrafacial parotidectomy. In preoperative, parotid tissue appeared necrotic and purulent by places (Figure 3). Frozen section showed tuberculous lesions in both parotid and sub-mandibular lymph nodes. We, therefore, restricted surgery to a left lower pole parotidectomy. A check-up looking for second location tuberculosis (clinical examination, chest X ray, sputum analysis) was negative. The tuberculin skin test was positive at 12 mm. A prolonged (9 months) four drug antituberculous regimen (H: isoniazid, E: ethambutol, R: rifampicin and Z: pyrazinamid) was then started according to our usual protocol: 2 RHZE/7 RH. The evolution was satisfactory with no relapse after six years.

tuberculosis, endemic countries, parotid gland

PMC6505037_01

Male

A 78-year-old diabetic and hypertensive male patient, presented with pain, swelling and discharging sinuses in both knees, 5 weeks after sequential bilateral TKR at a peripheral hospital, with no response to cloxacillin and ofloxacin. Discharge revealed acid-fast bacilli (AFB), but was negative for cartridge-based-nucleic-acid-amplification test (Xpert MTB/Rif). Empirical anti-tubercular therapy (ATT) was initiated, (rifampin, isoniazid, pyrazinamide and ethambutol) with minimal response, stopped after seven months, followed by bilateral knee debridement and poly-exchange but the discharge continued. Eleven months after index surgery, he underwent implant removal and articulating antimicrobial cement spacer application in both knees (Fig. 1a) and was referred to our institute. He presented with difficulty in mobilization due to displaced cement spacer in both knees, thick purulent discharge from left knee and copious sero-purulent discharge from right knee. Laboratory investigations revealed Erythrocyte Sedimentation Rate (ESR) of 22 mm and a C-reactive protein (CRP) at 27 mg/L. All antibacterials were stopped, tissue samples excised from sinus edge and discharge from both knees sent for microbiological analysis. Bacteriology and mycology laboratory reports were inconclusive. In the mycobacteriology laboratory, the Ziehl Neelsen stain and Gene-Xpert MTB/RIF from the material was negative. Some growth was observed on MacConkey agar on day 3. Colonies were confirmed as AFB and grew on Lowenstein Jensen's media with 5% NaCl. Nitrate reduction test was negative. MGIT automated liquid culture system (Becton Dickinson, NJ, USA) revealed the growth of the same phenotype. As per the growth pattern and biochemical properties the isolate was identified as Mycobacterium abscessus. The isolate was sequenced for 16S ribosomal gene and confirmed as M. abscessus, The sequence was submitted to Genbank and granted Accession No. MH720215. Drug susceptibility test was done by broth micro-dilution assay as per CLSI guidelines. The isolate was sensitive to amikacin, clarithromycin, linezolid and rifampin but resistant to imipenem. The patient was started on rifabutin 300 mg, clarithromycin 1000 mg and injection amikacin 500 mg daily. Baseline audiometry, renal function tests, ECG and liver function tests were within normal limits. Serial QTc monitoring, renal function, electrolytes and liver enzymes were closely monitored. After 3 weeks of antibacterial, thorough debridement of right knee with sinus excision, and distal femoral canal curettage followed by arthrodesis using Ilizarov ring fixator was done. After two weeks, the left knee was debrided and left with antimicrobial impregnated cement spacer in-situ. After another 8 weeks of antibacterials, the left knee was re-implanted with revision knee prosthesis and the patient was mobilized with full weight bearing on both knees. The intraoperative tissue samples on both knees revealed negative culture for mycobacteria. Post-intervention, there was no fresh discharge from both knee joints (Fig. 1b). PET scan at end of four months revealed no metabolic uptake. Amikacin was replaced with oral levofloxacin due to bilateral sensory-neural hearing loss for higher frequencies after 6 months. By end of 7 months, his wounds were clean and dry, ESR, CRP were within normal limits. Ilizarov ring fixator was removed and knee brace used as the X-ray showed signs of trabeculae across the distal femur and proximal tibia. Currently the patient is on one-and-half year follow-up and is antimicrobial free for last four months. He is mobile without braces, is able to bear weight on both his legs for last two months, and a normal for age renal and liver functions. His latest X-rays showed bony ankylosis of right knee with stable revision knee arthroplasty implants in situ in his left knee (Fig. 1c).

mycobacterium abscessus, periprosthetic joint infection, total knee replacement

PMC6978278_01

Female

Rosa was referred by her general practitioner to a psychologist for burnout complaints and psychosomatic symptoms. She is a fifty-five year old woman originating from Azerbaijan and living in the Netherlands since 1994. Her complaints started three years before the referral, when she dropped out of work as a quality officer in a pastry factory. At her workplace, Rosa was very dedicated and often worked long hours. The factory, originally a family business, was taken over by an investor. This led to changes in the corporate culture resulting in exploitation, misbehaviour and loss of quality of the pastry. Rosa was unable to cope with these changes and this led to a halt of her work. She developed stress reactions that manifested themselves in allergies, bad sleep, fluid retention, and weight gain. In addition she also suffered from anger outbursts at unexpected moments, which she found very shameful. In the initial phase of her treatment, Rosa insisted on speaking about the losses she experienced in the pastry factory out of the conviction that this was the main cause of her complaints. She casually disclosed that she had destroyed biscuits made in the factory in various stores. Although she felt ashamed, she also explained this behaviour as an act of justice, as she found that the quality of the biscuits had deteriorated after she left her work. In this way Rosa expressed her anger and coped with the loss of her workplace. At the time that Rosa dropped out of her job, huge numbers of refugees fleeing the civil war in Syria were entering the Netherlands. They were housed in temporary accommodations and also in her place of residence. Meeting them in the shopping centre and seeing empty looks in the eyes of some of them filled Rosa with horror and physical disgust. Although being a refugee herself, she confessed, she did not have empathy for the newcomers.

diagnosis, long term, posttraumatic stress disorder, resilience, stress, trauma, violence, war

PMC6978278_04

Male

Peter is a sixty-four year old man who was referred for treatment of mood complaints. He was a field professional at different non-governmental organisations (NGO's), and led many missions, such as to war-torn Bosnia and Cambodia, and in the aftermath of the Tsunami in Thailand in 2004. In his professional career he experienced several life-threatening situations and was confronted with death in different forms. He lost colleagues due to accidents, murder and suicide. However, at the start of the therapy Peter does not report being burdened by these experiences and losses. First and foremost, he describes his anguish over bureaucracy and courses of action that he did not agree with, and that were taken at the time he was in the field. He preferred working intuitively, and from the view of trying to understand a crisis situation from a local perspective, a method that proved to be conducive. He felt a strong connection with his team members, but ran into conflict with his superiors about everlasting bureaucracy and, in his opinion, wasting of funds. As the years went by, bureaucracy got worse instead of better and Peter found it increasingly difficult to find his place in the organization. He stopped working three years before the start of the treatment. Since then he follows the news about NGO's fervently and still gets angry about how crises all over the world are tackled by them. At the same time, a mixture of positive and negative memories related to his working past are triggered. This confuses him and makes him sad. He also misses the meaningfulness of his professional life. Peter suffers from mood swings and anhedonia already for half a year, he is often at home, and has trouble absorbing the daily routine. However, he still enjoys spending time with his grandchildren. His appetite is normal, and he does not report having sleeping problems. In his whole life he has never experienced nightmares or flashbacks related to the missions and the threatening life events he has faced. Sometimes he suffers from irritability and can have an outburst of anger, mostly when he perceives that injustice is done. In the first sessions Peter was diagnosed with a persistent depressive disorder arising from excessive thinking and worrying about the predicaments linked to his professional career. He was, in particular, wrestling with many questions and moral dilemmas connected to his work at the NGO's. These can be framed within the moral injury concept, defined as "the enduring psychological, biological, spiritual, behavioural and social consequences of perpetrating, failing to prevent, bearing witness to, or learning about acts that transgress deeply held moral beliefs and expectations" (, p. 697). In the following sessions, more attention was paid to Peter's early psychosocial development in which no irregularities were found. Peter inherited a strong sense of justice from his upbringing. This brought him already at a young age into conflict with teachers and other authorities. However, this oppositional behaviour was not pathological to the extent that it would have met criteria for a personality disorder. Rather, it seems to be a character trait which causes that Peter is not always liked by others because of his criticism, but it does not appear to play a negative role in his family life and in relation to close friends. While recalling certain events linked to the missions, it was noticed that Peter would sometimes show strong emotions, mostly sadness and tears. However, these emotions would dissolve within seconds, morphing into expressing his anger about certain bureaucracy issues surrounding these events. This formed an indicator that "hidden" problems were present and they did surface later on in the treatment. Peter inclines to ignore and suppress his emotions in contact with people, mostly by moving a discussion to another topic, a phenomenon that often occurred in the sessions. Afterwards when he is alone, he rethinks the topics of a conversation, and only then he starts experiencing the corresponding feelings often resulting in rumination and a depressed mood. Further in the treatment, his thoughts and ideas about certain events during the missions were explored more in-depth. Through this process, it became apparent that Peter suffered both from moral issues regarding politically motivated decisions and acting of his superiors which were not always in the interest of the local population, and from the shocking events which he had personally experienced. In this probing process Peter also began to realize that his way of coping showed similarities with the coping mechanisms of the people he reached out to as the NGO professional, survivors that showed no emotions in the middle of a catastrophe and just went about their daily business. Peter came to realize that his work confronted him with seriously impacting life events. He dealt with the impact of these events by comparing himself to the victims and labelling his own experiences as insignificant in comparison with theirs. When Peter came to full realisation of this defence mechanism, he unexpectedly developed sleeping problems, nightmares and re-experiencing of the work related events (PTEs). At that point in the treatment, Peter underwent for the first time emotions related to the events experienced in the past. It was an enlightening and cathartic experience for him. Nevertheless, it also made him upset because he realised that he was about to develop a full blown PTSD, a condition which he thought he will never suffer from. Peter experienced numerous PTEs. The loss of several colleagues seemed to have had the strongest impact on him as many of them became close friends over the years. The knowledge that the suicides of his colleagues were a result of their inability to cope with constant horrors, was something Peter didn't want to face or think about until he was confronted with his avoidance in the therapy. He came to acknowledge that this fear came too close to his own anxiety related to losing control and committing suicide. Realizing that his own emotions were genuine and authentic responses to extreme experiences he had faced, helped Peter to find balance again. The depressive feelings were reduced to a great extent. Further, psycho education regarding the moral injury concept helped him realize that his anger, originating from the moral injuries, protected him from strong emotions linked to many personal losses over the last decades. Engaging into fights and disputes with his superiors was, even though justified in terms of content, an emotionally inadequate way of coping with the horrifying experiences and losses. The PTSD symptoms which emerged in a course of the therapy were successfully treated with EMDR. Peter is an example of the delayed type of trajectory, where a lack of giving meaning to experiences, in combination with maladaptive emotional coping and withdrawal from active work, led to evolving depressive symptomatology and, temporarily, to a full-blown PTSD. Moral issues played a significant role in the emergence of Peter's mood complaints, as he was coping with consequences of political decisions impacting his daily work, and with feelings of powerlessness to influence them. However, frustration about the moral dilemmas also acted as a camouflage for authentic and painful emotions arising from multiple life threatening experiences he had accumulated over time. Peter did not develop a PTSD earlier in life, even though he was confronted with many PTE's. PTSD symptoms developed only when Peter became aware of his emotional coping style. It remains an open question whether Peter would have developed PTSD at a later stage in his life without being triggered by the treatment? However, it remains the fact that Peter got referred because of suffering from mood complaints and a poor quality of life, something that changed significantly for the better at the end of the therapy.

diagnosis, long term, posttraumatic stress disorder, resilience, stress, trauma, violence, war

PMC6978278_05

Male

Behrooz is a twenty-seven year old man originating from Iran and residing as a refugee in the Netherlands. He was referred by a general practitioner with complaints of impulsivity and aggression outbursts. He was suffering from these problems for many years, but has not sought help earlier. The practitioner suspected Behrooz from ADHD, and asked for diagnostics and treatment. At time of the referral, it was unknown how and when Behrooz ended up in the Netherlands. The only information available was that he had lived illegally in the country for a long time, and that a residence permit was granted to him four years earlier, when the immigration department legalized all illegal immigrants through a general pardon. During his first interviews, Behrooz stood out because of his loud speaking and agitated behaviour. He was, in particular, angry about the way the Dutch society and politics had treated him. As Behrooz gained more confidence in the therapist, and realised that he was not unfamiliar with the lengthy and impersonal asylum procedures and their impacts on an individual, he started to disclose more about his remarkable past. Behrooz was born a few years after the Islamic revolution in Iran. His family was liberal and had been politically active for generations. As the youngest son, Behrooz started to participate in their political activities already at a very young age. He attended secret meetings and helped distributing leaflets in the streets. At the age of twelve, he was arrested and jailed by the Iranian secret service. He was brutalized and tortured for days, until he was released because his family had paid a ransom. Shortly after his release, the family arranged for Behrooz to leave Iran illegally and escape to neighbouring Turkey via the mountains. This turned out to be a frightening experience because he got lost on the way, and failed to meet the contact person who would guide him across the border. In the therapy sessions, Behrooz denied being bothered by these events. He stated repeatedly that so many people from Iran had similar experiences. He felt he was no exception and therefore should not be bothered by them. In Turkey, he eventually found domicile with an older man who gave him odd jobs, such as collecting scrap metal and selling it, in exchange for food and lodging. In company of this man Behrooz found protection and a sort of mentorship. This was important as he was still young, separated from his family, and illegally in the country with no rights whatsoever. Behrooz quickly got streetwise, learned about how to survive, and became a specialist in small businesses and arranging odd jobs for others. At the age of sixteen, his family in Iran informed him that the Netherlands has a separate asylum procedure with extra protective rules for minor refugees and that within this procedure his chances to be recognized as a refugee were substantial. They advised him to leave Turkey and join an aunt who was already living in the Netherlands for more than ten years. On arrival and asking for asylum, Behrooz was placed in a small-scale shelter, got a mentor and went to school, where he learned Dutch fluently in a short period of time. However, his asylum procedure did not fare well. The immigration authorities did not believe his narrative of flight and his request for protection, partly because of the young age at which he claimed to have been politically active and because of the length of time he had spend in Turkey. As a consequence, Behrooz was forced to leave the shelter immediately after his eighteenth birthday and, yet again, forced to find his way in illegality. He lived as a squatter for five consecutive years. He was seriously disappointed and outraged, as this situation reminded him of the time he had spend in Turkey. Moreover, he had developed different expectations about his future in the period he was accompanied as a minor asylum seeker. At the age of twenty-three Behrooz was finally granted a residence permit within a general pardon. He expected to be happy, but on the contrary felt seriously disappointed in himself and what he had achieved in life. Due to illegality he could not complete a vocational training and was obliged to find a layman's job as quick as possible or all his social benefits would be stopped. When the therapist inquired about his complaints, Behrooz indicated that he was mainly concerned about the fact that he had so little self-control and that he could rapidly become extremely verbally aggressive to other people. He felt very guilty and ashamed about it. In these outbursts he would accuse the other of being unreliable, lying and intentionally aiming to harm him. He added that being out of control also terrified him, because he had not any recollection of what had been said by himself or by others afterwards. This led to the hypothesis that he experienced dissociative phenomena (which was later confirmed in the therapy). The suspected ADHD was confirmed by a diagnostic interview, and extensive inquiries were made on PTSD. However, Behrooz denied suffering from nightmares or other re-experiencing phenomena. He insisted on being angry over the particular period in his life when he fought for the residence permit and felt abandoned by the Dutch society and the minister of immigration. The first intervention in a course of the treatment was to prescribe Behrooz a psycho stimulant (Dexamfetamine). This lead to reduction of the sensation of chaos in his head and a better control of emotions. Medication also caused that he became more accessible for constructive exploration of his life and emotions as he no longer got overwhelmed by anger during the sessions. Eventually Behrooz started to share his experiences from Iran and Turkey, and admitted for the first time that he has also occasionally suffered from nightmares for many years. As it turned out, he consciously wanted to keep that information to himself, because he developed a personal theory about the function of his nightmares. He suffered from them from the age of twelve, and believed that the nightmares were a way of dealing with his past. He also had the expectation that they would disappear when he worked through them. After re-evaluation of his complaints, the therapist concluded that Behrooz fulfilled criteria for the PTSD diagnosis and an inventory was made of his traumatic experiences. Behrooz received psycho-education about the symptoms of PTSD, such as hyper arousal and its similarities and differences with hyperactivity and impulsivity complaints of ADHD. These symptoms are often difficult to distinguish in patients with both disorders, especially in those who have been traumatized at a young age. In the follow-up sessions, the traumatic recollections were treated with EMDR. As a result, the nightmares disappeared and Behrooz also reported changes in his state of hyper alertness, a phenomenon he was never aware of as he had grown up with it and did not know better. After the trauma-focus treatment, Behrooz continued with his therapy and contributed a personal signification to his experiences. He redefined the survival skills he mastered in the forming periods of his life to personal capacities. Behrooz achieved a so-called posttraumatic growth. He began to create a newly balanced personal and professional future in which he started a vocational training as an electrician. The therapist played hereby an important role, advocating for Behrooz with the local government which paid the costs of the training. The rationale for development of specific symptoms in the course of Behrooz's life only became apparent when the therapist was able to build a trust relationship and together with Behrooz carefully and patiently map his personal history. He originated from an action-oriented family, had an inherited disposition to ADHD, and was tortured and traumatized at a very young age, leading to the evolution of survival strategies and dissociative phenomena of which he himself was unaware. As it showed during the therapy, his way of living was dictated by coping with PTSD with dissociative characteristics, expressing themselves in impulsivity and aggression. From the moment he got a residence permit, Behrooz relaxed and had more time to think and reflect on his life. Disappointment about what he had achieved dominated his thoughts, and the unanticipated continuation of his impulsivity and aggression drove him to find help. Although Behrooz has already made great progress in his therapy, the process is still not completed as the psychological damage inflicted at a young age demands prolonged consolidation and help in shaping a stable personal and professional future for himself.

diagnosis, long term, posttraumatic stress disorder, resilience, stress, trauma, violence, war

PMC6230408_01

Female

A 38-year-old Liberian female with a 12-week gestation presented to the emergency department with a 3-week history of low-grade subjective fever, night sweats, unintentional weight loss, gradually worsening abdominal pain, and intermittent spotting. Vital signs were stable on presentation, physical exam noticeable for gravida abdomen, otherwise unremarkable. Laboratory examination revealed beta hCG 118471, which was otherwise unremarkable. Pelvic ultrasound confirmed a 12-week viable intrauterine pregnancy. The patient was admitted to the hospital for close monitoring. Hospital course was complicated by massive pleural effusion, low-grade fever, progressive worsening abdominal pain, and spontaneous abortion. Non-contrast-enhanced computed tomography of the chest (Figure 1) revealed large right-sided pleural effusion, and contrast-enhanced computed tomography of the abdomen and pelvis (Figure 2) revealed bilateral hilar adenopathy, ascites, thickening and enhancement of the peritoneum, and mottled nodular-appearing soft tissue consistent with omental caking suspicious for peritoneal carcinomatosis. She underwent extensive workup including surgical and oncologist consultations for possible exploratory laparotomy and discussion of treatment options for presumed ovarian neoplasm. Blood work revealed elevated carbohydrate antigen (CA) 125 and positive QuantiFERON-TB Gold, but adenosine deaminase, CA 19, alpha-fetoprotein, and inhibin B were within normal limits. Diagnostic laparoscopy with biopsy revealed significant pelvis ascites and diffuse miliary lesions throughout the peritoneum. She underwent dilatation and curettage; histopathologic examination showed chronic granulomatous inflammation with no evidence of neoplasm. Special stains on tissue sections and ascitic fluid stain revealed rare acid-fast bacilli, suggestive of mycobacterial granulomatous peritonitis. Additional questioning indicated a history of positive PPD skin test a year prior without follow-up treatment. The patient was placed on four-drug anti-tuberculous therapy and had a complete recovery.

PMC6689839_01

Female

A 4 years old girl, was brought by the parents to the emergency unit of the "Hopital Saint Jean de Dieu" in Tanguieta, north of Benin at lunchtime. The parents referred abdominal pain and tenderness, fever, vomiting and anorexia since 48 hours, treated with local herbs infuse. The patient was agitated but confused, Glasgow Coma Scale 12 (E3, V4, M5), arterial blood pressure 75/50 mm Hg, heart rate of 135 beats/min, body temperature 38.9 C and respiratory rate of 22 cycles/min. Abdominal test revealed a remarkable symmetrical distention, with bulging flanks, positive fluid thrill. Crying on every attempt of abdominal palpation, which revealed tenderness and pain on all the abdomen. The percussion of the abdomen was dull on all the quadrants, no peristalsis. The patient was tachypnoic with no particular findings on the thorax examination. Abdominal ultrasound exam revealed diffuse and massive ascites of mixed liquid/solid content. Laboratory findings included a normal cell counts: white blood cells 1300 cells/mm3 (normal value 5000-10000 cells/mm3), hemoglobin 7.7 g/dl (normal value 12-15 g/dl), sodium 136 mEq/L (normal value 135-145 mEq/L), potassium 5.6 mEq/L (normal value 3.5-5.1 mEq/L), ESR 44 mm/h (normal value 3-13 mm/h). Obtained the consent from the parents, nasogastric and vescical catheters were positioned, and the patient was brought to the operatory room, candidate to emergency explorative laparotomy. Under general endotracheal anesthesia with halothane, the emergency laparotomy with midline incision, revealed 4 liters of purulent/alimentary free peritoneal fluid, massive retroperitoneal lymphomegaly, multiple caseous nodes diffuse on the peritoneum and the bowel, measuring about 0.5 to 4 mm of diameter, and some bigger nodules (up to 1.5 cm) covered by caseous mucus with the suspect aspect of miliary peritoneal tuberculosis. On the middle jejunum 3 major perforations on the antimesenteric side of the bowel were identified, surrounded by hyperemic and inflamated tissue with the typical aspect of typhoid bowel perforation. Some intestinal hyperemic intestinal typhoid lesions were also present, but not perforated yet. The surgical findings are shown in Figure 1, Figure 2. The surgical procedure included a lavage of the abdominal cavity and exploration of all the bowel for small lesion or perforations. A primary closure of the 3 perforations was performed with a separate stitch technique always used in the hospital: a single-layer suture with 6 large vicryl 2/0 "U" stitches, through the seromuscular layer at 1cm from the perforation, to use the healthy tissue to close the perforation in a part of the bowel where there was less inflammatory involvement, with introflection of the perforation itself. A sample of the purulent material was taken for analysis, together with 2 peritoneal nodules. Considering the severity of the abdominal contamination, a delayed primary closure was planned, 3 drains were placed and a laparostomy was done fixing a grease gauze to the open aponeurosis with a continuous non-absorbable suture covered with sterile sponges. The samples sent for laboratory analysis showed a high load of acid fast bacilli on Ziehl-Neelsen staining and positive serology for Salmonella tiphy bacillus. The patient was very unstable throughout all the procedure, requiring correction of fluid and electrolyte imbalance, and one blood transfusion. A combined therapy of ciprofloxacine and metronidazole was administered intravenously ad the end of the surgical procedure for the treatment of the typhoid fever clearly recognized by the experienced local surgeon. A specifical treatment for the miliary peritoneal tuberculosis was not started due to the not certain origin of the peritoneal lesions. The general condition of the patient got worse hour by hour with a progressive septic shock and multi-organ failure. The young girl died 18 hours after the surgical procedure.

typhoid fever, abdominal tuberculosis, tuberculosis, typhoid intestinal perforation

PMC7303758_01

Male

A 30-year-old previously well man presented with a four-week history of progressive right-sided hearing loss, wide-based gait, and cognitive disturbance characterized by short-term memory loss, impaired attention span, and verbal fluency. The patient had neither a personal nor family history of pertinent medical problems, and he did not smoke, drink excessive alcohol, or take illicit drugs. On examination, he had cerebellar signs characterized by dysdiadochokinesis and ataxia of gait. MRI of the brain at presentation demonstrated multiple hyperintense lesions in the corpus callosum, periventricular white matter, cerebellar hemispheres, and leptomeninges (Figure 1). MRI of the spine was normal. The CSF showed a small pleocytosis with normal cytology and an elevated protein 3.06 g/L. There was an absence of oligoclonal bands in both CSF and serum. CSF microbiologic investigations revealed a Gram-negative stain, syphilis serology, and cryptococcal antigen. PCR analysis of the CSF did not detect EBV, CMV, HSV, VZV, enterovirus, M. tuberculosis, or fungal pathogens. Widespread triphasic waves consistent with encephalopathy but with no focal or generalised epileptic activity were demonstrable on an electroencephalogram (EEG). CT of the chest, abdomen, and pelvis did not reveal any lesions. The full blood count, electrolytes, creatinine, and liver function tests were normal. The ANA, ANCA, anticardiolipin antibodies, and lupus anticoagulant were negative. Evaluation for autoimmune and paraneoplastic encephalitis with serum and CSF antibodies to NMDAR (N-methyl-D-aspartate receptor), AMPAR (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor), LGI1 (leucine-rich glioma-inactivated 1), Caspr 2 (contactin-associated protein-like 2), GABA (gamma-aminobutyric acid) B receptor, and IgLON5 were negative, and ANNA-(antineuronal nuclear antibody-)1, ANNA-2, PCA (Purkinje cell antibody), PCA 2, Ma 1, Ma 2, CV2/CRMP5 (collapsin response mediator protein 5), Tr, and SOX antibodies were also not detected. Antiaquaporin-4 antibodies and anti-heat shock 70 antibodies were negative. The differential diagnosis included acute disseminated encephalomyelitis, aquaporin-4 negative neuromyelitis optica, neurosarcoidosis, and primary angiitis of the CNS. Despite treatment with intravenous methylprednisolone 1 g daily for 3 days followed by a tapering course commenced at 1 mg/kg daily, he suffered progressive bilateral hearing loss over the following four weeks and impaired vision from the right eye. Audiometry demonstrated low-frequency sensorineural hearing loss bilaterally. Neuropsychometric assessment revealed severe global cognitive impairment including difficulties with verbal fluency, as well as deficits in short-term memory and executive function. A biopsy of the cerebellum and meninges was performed due to disease progression and lack of response to the high-dose corticosteroid therapy. The histopathology showed mild, nonspecific perivascular inflammation and a diffuse pial infiltrate dominated by CD8 T lymphocytes and macrophages with microinfarctions in the territory of the small pial arteries. There was no evidence of vasculitis or malignancy. Culture and PCR analysis of the specimen excluded mycobacterial or fungal infection. The patient developed painless scotomata, and a branch retinal artery occlusion (BRAO) of the right temporal retina was identified on fundal photography and retinal fluorescein angiography (Figure 2). Subsequently, Susac's syndrome was diagnosed based on the triad of encephalopathy, right BRAO, and bilateral sensorineural hearing loss. Methylprednisolone 1 g daily for 3 days was subsequently readministered followed by oral prednisolone 1 mg/kg daily concurrently with intravenous cyclophosphamide 1 g (15 mg/kg) monthly for 6 months and intravenous immunoglobulin (IVIg) 2 g/kg loading and 0.4 g/kg per month for 6 months. Adjunctive treatments included cotrimoxazole prophylaxis against Pneumocystis jiroveci, risedronate for osteoprotection, and aspirin to aid vessel patency. Clinical remission was achieved by 6 weeks, but there was no improvement in the sensorineural deafness on the right side. Maintenance of remission was attempted with methotrexate 20 mg (0.3 mg/kg) weekly following cyclophosphamide. Another clinical relapse, however, occurred 3 months after the maintenance therapy with methotrexate was started, characterized by recurrent bilateral hearing loss, bilateral BRAOs, and new T2 hyperintensities shown by MRI of the brain. Further remission was achieved with methylprednisolone 1 g daily for 3 days, and plasma exchange was administered daily for four consecutive days. In addition, rituximab 375 mg/m2 weekly for four weeks was used as an induction agent, and methotrexate was replaced with mycophenolate mofetil (MMF) 1.5 g BD. Prior to rituximab, enumeration of lymphocyte subsets on peripheral blood revealed 302 x 106 CD19+ cells/L with CD19 suppression (<25 x 106 cells/L) maintained for 18 months following therapy. Oral prednisolone was slowly tapered to a maintenance dose of 12.5 mg (0.18 mg/kg) daily. Despite this treatment, the patient relapsed again two months later, i.e., 11 months following initial treatment, suffering a generalised tonic-clonic convulsion, encephalopathy, recurrent bilateral hearing loss, fresh BRAOs, and new MRI lesions. His neurological status improved after methylprednisolone 1 g daily was administered for 3 days. His dose of oral prednisolone was increased to 1 mg/kg daily, IVIg 2 g/kg monthly was recommenced, and MMF continued at a dose of 1.5 g BD. MRI brain with MR venogram demonstrated right transverse venous sinus thrombosis. A procoagulant screen was positive for the lupus anticoagulant. Review of a previous MR venogram 3 months prior showed that the thrombus had been present for some time and was not changing in morphology or size. For these reasons, aspirin rather than warfarin was continued as an anticoagulant. A further clinical relapse occurred 3 months later, i.e., 14 months (Figure 3) after initial treatment was commenced, characterized by sudden painless partial visual loss in the right eye with new BRAO encroaching on the central retina, persisting hearing loss, and MRI changes demonstrating diffuse cerebellar, leptomeningeal, and parenchymal enhancement. Infliximab 5 mg/kg was started using a loading regimen at 0, 2, and 6 weeks for induction and then 8 weekly treatments for maintenance. Over the following 4 weeks, there was both clinical and radiological remission of disease. His dose of prednisone was tapered completely from 12.5 mg daily over 4 months. The thrombus resolved, and the patient returned to work. Two years after remaining on the maintenance infliximab therapy, the patient has been free of relapses, the visual acuity is normal, and there are no cognitive deficits on follow-up neuropsychological testing. He continues to be troubled by partial bilateral deafness, for which cochlear implantation has proven helpful. Consideration is being given to stepping down immunosuppression to MMF.

PMC5574474_01

Female

A 14-year-old healthy female presented with pain to the medial aspect of her left sole for 1 year in duration. Pain occurred with first step in the morning, as well as after running, and disappeared within 15 min. She was diagnosed with a flat foot at another clinic, but the use of an orthotic device aggravated the pain. The patient had no history of any trauma or other diseases. Her body mass index was 32.1 kg/m2. Physical examination revealed a soft mass located on the medioplantar surface of the left foot. There was no numbness of the sole and a negative Tinel's sign; however, tenderness was detected at the distal end of the tarsal tunnel. The pain in the medial aspect of her left sole occurred when she attempted ankle dorsiflexion and hindfoot eversion. The weightbearing exam revealed flattening of the arch consistent with pes planus (Figure 1). Radiographs demonstrated a longitudinal arch of normal height and a soft-tissue enlargement. Magnetic resonance imaging (MRI) and computed tomography (CT) scans revealed significant hypertrophy of the abductor hallucis muscle and slight hypertrophy of the flexor digitorum brevis muscle in the left foot (Figure 2). A nerve conduction velocity test was not performed because the patient and her parents did not provide consent. The patient was diagnosed with unilateral hypertrophy of the abductor hallucis muscle with entrapment of the medial plantar nerve. Two injections of triamcinolone acetonide and lidocaine at the point of tenderness every other month resulted in resolution of the pain. She experienced no restriction in her activities of daily living except for running 20 months later.

abductor hallucis muscle, entrapment syndrome, medial plantar nerve, muscle hypertrophy, tarsal tunnel syndrome

PMC5621112_01

Male

A 56-year-old caucasian male patient, with history of active cigarette smoking (35 pack/years), hypertension and coronary heart disease (for which he underwent a double coronary artery stenting), presented with recurrent hemoptysis of mild abundance which first occurred no less than 4 months before. He also reported fatigue and weight loss amounting to 6 kg in 4 months. There was no associated history of fever, night sweats or extra-thoracic symptoms and no household contact of tuberculosis. Upon admission, the physical examination showed a patient in a good condition (performance status 1) with no fever and no chest abnormalities except for few rhonchi on lung auscultation and a slightly enlarged supraclavicular lymph node. There was no clubbing, no extra-thoracic signs and no other superficial lymph nodes meeting size criteria for lymphadenopathy. Frontal chest x-ray revealed a mediastinal widening probably due to grossly enlarged right paratracheal and left paratracheal nodes as well as a mild left parahilar infiltrate with irregular borders (Fig. 1). Electrocardiogram was in sinus rhythm, with a heart rate at 90 bpm. PR and QT intervals were normal, axis at 90 , without ST segment abnormalities or other waves and intervals. Blood tests showed an elevated white cell count exceeding 21,000 cells/mm3 with a lymphocyte count amounting to 13,750 and mild thrombocytosis. An elevated C reactive protein level (41 mg/l) was also noted, hinting to a biological inflammatory syndrome. Tests for hemostasis and blood biochemistry yielded a normal result. Lipid tests revealed hypertriglyceridemia (2.48 g/l). Urinalysis showed proteinuria (400 mg per day) with albumin presence, as well as hematuria. Serum protein electrophoresis was normal though. Chest x-ray findings urged us on performing a chest computed tomography (CT) scan. On the mediastinal window, it showed bilateral mediastinal and axillary lymphadenopathies, as well as enlarged supraclavicular lymph nodes on the left side. On the parenchymal window, CT revealed an ill-defined heterogeneous attenuation in the left upper lobe with blurred margins, as well as a solitary contralateral pulmonary nodule (Fig. 2). Abdominal and pelvic CT showed an adenoma of the left adrenal gland, bilateral simple kidney cysts and a subrenal aortic aneurysm. Brain CT scan showed no anomalies. Bone scintigraphy showed no evidence of osseous metastatic disease. Hepatitis B and C serologic tests were negative. Immunological blood tests (antinuclear antibodies, extractable nuclear antigen antibodies, anti-dsDNA, anti-neutrophil cytoplasmic antibodies, cryoglobulin) were negative. Total immunoglobulins E level was normal. Looking for histological evidence of a potential tumoral process, fibrobronchoscopy was performed, showing a mild bronchial stenosis of the upper lobe branch and thickening of the bifurcation between culmen and lingula branches with no evidence of endoluminal tumor. Aspiration cytology was benign. Bronchial biopsy examination could not prove malignancy, showing an inflammatory mucosa. We eventually came to terms with performing a surgical biopsy of Virchow's node. Pathology slides showed a B cell lymphomatous process that might tally with lymphocytic lymphoma of CLL type (tumoral subtype of old Kiel classification). Immunohistochemistry confirmed the B phenotype with CD5, CD20 and CD23 expression and a Ki-67 index exceeding 50% which heralds a transformation into diffuse large B cell lymphoma (DLBCL), also known as Richter syndrome (RS) or transformation. Additionally, one of the nodes was infiltrated by a malignant epithelial process with poorly differentiated large tumoral cells, hinting to a non-small cell carcinoma (NSSC). The latter were cytokeratin, TTF1, Napsin A positive and p40 negative in immunohistochemistry, which corroborated nodal metastatic disease of an adenocarcinoma. Taking into consideration that no clinical or radiological signs apart from the left upper lobe pulmonary lesion were found, we concluded to a pulmonary origin of the carcinomatous process thus making the diagnosis of primary adenocarcinoma of the lung. Flow cytometry immunophenotyping was carried out showing normal proportions of B cell lymphocytes (CD19+ CD5- CD20+ CD22+) and T cell lymphocytes (CD3+ CD5+), amounting to 6% and 80% respectively, which are normal proportions for B and T populations. Bone marrow aspiration and biopsy were then performed. Pathology examination showed massive infiltration of medullary spaces by small-sized lymphocytes with a few large atypical prolymphocytic cells, highly suggestive of CLL, which corroborates the lymph node biopsy examination findings. Besides, BCR-ABL transcript molecular testing was negative. The diagnosis of metastatic adenocarcinoma of the lung associated with RS was made. Treatment consisted in chemotherapy, associating carboplatin, docetaxel and cyclophosphamide in the scope of a multidisciplinary approach. The course was unfavorable since the first days of therapy. In fact, the patient's condition worsened swiftly after the first course of chemotherapy as he presented with severe dyspnea in relation to a superior vena cava (SVC) syndrome. CT showed an obstruction of the SVC, a major increase in the mediastinal lymph nodes enlargement, an extension of the left upper lobe mass as well as a left adrenal gland metastasis (Figs. 3 and 4). Echocardiography revealed a small pericardial effusion. These findings urged us on prescribing corticosteroids and palliative radiation therapy. Within a fortnight, the patient showed further signs of deterioration with the onset of atrial fibrillation and a severe fatal infectious process.

b cell lymphoma, chronic lymphocytic leukemia, lung cancer, lymphadenopathy, richter syndrome, second lung malignancy

PMC5357739_01

Female

A 24-year-old Sri Lankan woman with drug resistant focal dyscognitive seizures experienced daily seizures despite treatment with carbamazepine 800 mg twice daily and clonazepam 2 mg twice daily. She was on no other medication and otherwise well. Lamotrigine was started with the aim of improving seizure control and slowly titrated to a dose of 150 mg in the morning and 200 mg in the evening over a period of 6 months. Her seizure frequency reduced. Fifteen months after initiation of lamotrigine, she complained of productive cough with yellow sputum. She was afebrile. Chest examination was normal. Lymphadenopathy was detected in the right cervical chain. Other lymph nodes, tonsillar tissue and spleen were of normal size. Spirometry was within normal limits. High resolution CT chest and neck showed extensive bilateral cervical lymphadenopathy and patchy ground-glass nodules in multiple lobes but no intrathoracic adenopathy. Full blood count, serum chemistries, as well as testing for rheumatoid factor, anti-citric citrullinated peptide antibodies, antinuclear antibodies, human immunodeficiency virus, Epstein-Barr virus, cytomegalovirus, toxoplasma and tuberculosis were all normal or negative. Erythrocyte sedimentation rate and c-reactive protein were elevated at 95 mm/h (normal < 23 mm/h) and 16 mg/L (normal < 5 mg/L) respectively. Histology of an excisional lymph node biopsy showed reactive follicular hyperplasia with capsular thickening without malignancy or granuloma. A review of prior blood testing revealed intermittent low-grade eosinophilia since introduction of lamotrigine (see Table 1). A diagnosis of lamotrigine-related pseudolymphoma was made. Lamotrigine was gradually withdrawn and her lymphadenopathy and pulmonary findings (which also likely represented a medication toxicity) have resolved.

anticonvulsants, drug hypersensitivity syndrome, eosinophilia, pseudolymphoma

PMC6545345_01

Male

A 55-year-old Caucasian man, with a smoking history of about 40 pack years, being diagnosed with UC four months ago, presented to the emergency department with a week-long history of low-grade fever, dry cough, and gradually worsening shortness of breath resulted in severe hypoxemic respiratory failure. The patient was medicated with a daily dosage of 4 g of oral mesalazine. He was also initially treated with intravenous pulse doses of glucocorticoids with a subsequent tapering of prednisolone regimens for a three-month period. Specifically, glucocorticosteroids have been discontinued twenty days before hospital admission. The bowel symptoms remitted within the follow-up intervals. No history of intolerance to salicylates was noted. He had no history of chronic organic solvent or occupational exposures. On admission, he was apyrexial, hemodynamically stable, tachypnoeic with nineteenth breaths per minute. Lung auscultation revealed non-musical rhonchi bilaterally, especially in middle and lower lung fields. The rest of the physical examination was unremarkable. The chest imaging disclosed a bilateral interstitial micro-nodular pattern (Fig. 1) not revealed in a previous chest X-ray four months ago. High-resolution computed tomography (HRCT) of the chest revealed a diffuse centrilobular ill-defined micronodular pattern (Fig. 2). Arterial blood gas studies performed in resting and breathing from room air showed respiratory insufficiency with pH, partial pressure of oxygen (PaO2), partial pressure of carbon dioxide (PaCO2), HCO3 and oxygen saturation (SaO2) values of 7.46, 51 mmHg, 35 mmHg, 25.8 mmol/L and 85% respectively, while it was observed further deterioration on limited exertion (PO2: 40 mmHg, PCO2: 30 mmHg, SaO2: 81%). The white blood cell counted 19.103 per microliter, without peripheral eosinophilia or other increased inflammatory markers. The differential diagnosis was broad and included miliary tuberculosis, opportunistic lung infections (such as fungal infections, Pneumocystis jiroveci pneumonia, and viral infections), HP, vasculitis, an extra-intestinal manifestation of UC and pulmonary complications caused by mesalazine. Initially, exclusion of infectious etiologies was mandatory, and for this reason, bacterial, fungal, viral and mycobacterial cultures were sent, yielded no isolation of an infectious agent. Bronchoscopy revealed normal airways and the BAL cellular analysis demonstrated a predominance of lymphocytes and an eosinophilia (recovery 60%, macrophages 54.3%, lymphocytes 39.6%, neutrophils 2.3% and eosinophils 3.8%. Lymphocyte CD4+/CD8+ ratio was 1.5. The transbronchial biopsy findings confirmed lymphocytic alveolitis (Fig. 3). Further workup for tuberculosis such as Mantoux test and blood T- SPOT Tuberculosis (T-SPOT TB) test were all negative as well as real-time reverse transcriptase polymerase chain reaction (RT-PCR) for Pneumocystis jirovecii, serology for viruses and cytologic exams. Furthermore, pulmonary function tests revealed an obstructive ventilatory pattern (Tiffeneau-Pinelli index: 57% of the expected value and forced expiratory volume in 1 second: 1.18ml, 34% of the expected value). Diffusion of carbon monoxide was not carried out owing to the strong dyspnea affecting the patient. Blood samples were sent for vasculitis screen which were normal. While ceftriaxone and azithromycin given intravenously failed to bring any clinical improvement, the mesalazine withdrawal was decided. After a two-day drug interruption, a surprisingly fast clinical recovery was noticed. Specifically, gas abnormalities remission with an elevation of PaO2 up to 73 mm Hg and forced expiratory volume-one second (FEV1) elevation up to 900ml was noticed (FEV1: 1.98ml, 60% of the expected value). In follow up intervals over a two year period the patient was asymptomatic. There was a gradual improvement of chest imaging (Fig. 4) and pulmonary function tests until full recovery within three months. Histopathologic findings obtained by lung biopsy before discontinuation of the drug establish the underlying lung disease process. Subacute HP typically presented with ill-defined nodular opacities in a centrilobular distribution (Fig. 2) that histologically reflect the presence of cellular bronchiolitis, poorly-formed noncaseating granulomas and bronchiolocentric interstitial pneumonitis with a predominance of lymphocytes (Fig. 3). However, in this Case, the lung biopsy was not necessary as the marked clinical and imaging improvement strongly established a relationship between the use of mesalazine and subsequent lung injury.

bal, bronchoalveolar lavage, drug reaction, fev1, forced expiratory volume-one second, hp, hypersensitivity pneumonitis, hrct, high-resolution computed tomography, hypersensitivity pneumonitis, lung injury, mesalazine, paco2, partial pressure of carbon dioxide, pao2, partial pressure of oxygen, rt-pcr, reverse transcriptase polymerase chain reaction, uc, ulcerative colitis, ulcerative colitis

PMC8573811_01

Female

Mrs TN is a 61-year-old woman from Gauteng Province in South Africa (SA). Informed consent was obtained from the patient. She is a patient with RA and at the time of presentation had been managed with disease-modifying anti-rheumatic drugs (DMARDs) including methotrexate and oral corticosteroids. In addition, she was enrolled in a biological therapeutic trial using a selective JAK1 inhibitor. She was not known to be HIV-infected and her known comorbid conditions included hypertension and dyslipidaemia. She was initially admitted to hospital in May 2019 with a diagnosis of multi-lobar pneumonia, for which she received empiric antibiotic therapy and was later discharged. Subsequent follow-up at the rheumatology clinic revealed worsening lung infiltrates, despite a lack of symptoms and clinical complaints. She was referred to the pulmonology clinic for further assessment, and her clinical examination was noted to be remarkably normal with an oxygen saturation of 93% on room air. Pulmonary function testing showed a post bronchodilator forced expiratory volume in 1 second to forced vital capacity ratio (FEV1 /FVC) of 0.79, total lung capacity of 4.78 L (109.26% of predicted) and a diffusion capacity for carbon monoxide per alveolar volume (DLCO/VA) of 0.34 nmol/ min/kPa/L (21% of predicted). The low DLCO may be due to a ventilation/perfusion (V/Q) mismatch secondary to underlying lung disease. Her initial chest radiograph from May 2019 showed 2 discrete solid lung nodules in the left mid to upper lung zones measuring 15 mm x 17 mm and 17 mm x 19 mm, respectively. In addition, the left lower zone revealed an ill-defined area of ground glass opacification (Fig. 1A). A repeat chest radiograph in July 2019 revealed that the lesions had increased in size (Fig. 1B). A computed tomography (CT) scan of the chest revealed multiple, well defined, peripheral and patchy air space opacifications with airbronchograms involving the left lower lobe and abutting the oblique fissure. This was associated with pulmonary nodules and left pleural thickening (Figs 2A and B). Initial blood results revealed a C-reactive protein (CRP) of 5 mg/L, erythrocyte sedimentation rate (ESR) of 20 mm/hr and a normal full blood count. Sputum investigations were negative for tuberculosis. Metastases should be bilateral, and the evolution and doubling time is unlike malignancy. In addition, infections, pulmonary infarctions and vasculitic lesions could be considered, but the patient's normal CRP and ESR were not consistent with an acute inflammatory state. Owing to the peripheral nature of these lesions, she underwent a CT-guided transthoracic lung biopsy, which revealed fibrous connective tissue with evidence of chronic necrotising granulomatous inflammation and fungal organisms with the morphological features of Cryptococcus (Figs 3A and B). Ziehl-Neelsen staining was negative for acid- and alcohol-fast bacilli. A diagnosis of pulmonary cryptococcosis was made. The JAK1 inhibitor was discontinued and the patient was started on oral fluconazole at a dose of 400 mg 12-hourly for the duration of 1 month. Follow-up chest radiography revealed partial resolution of the lesions noted previously (Fig. 4A). Fluconazole 200 mg twice daily for 3 months and then 200 mg daily thereafter was continued. Subsequent repeat CT imaging done 6 months after initiation of therapy revealed resolution of lung nodules and masses, with some residual fibro-cavitary lung changes remaining in areas previously involved by mass formation (Fig. 4B). The patient has fortunately maintained a stable clinical condition and remains well, without deterioration of her lung functions and her RA has remained stable.

janus kinase inhibitors, opportunistic infections

PMC6199181_01

Female

An 8-year-old girl presented to the emergency department 72 hours after sustaining blunt trauma to the chest during a bumper car rear-end collision when she was thrown forward into her seatbelt. She complained of chest pain and worsening shortness of breath. She had a history of asthma for which she had never been admitted to the hospital and was not taking any medications. Her vital signs and oxygen saturation were stable upon admission. Pulmonary auscultation revealed diminished breath sounds in the lower half of the right lung. The patient's chest radiography showed atelectasis of the lower half of the right lung (Fig. 1). A CT scan revealed complete obstructive atelectasis of the right middle and lower lobes and ground-glass opacity in the right upper lobe (Fig. 2). There was no abdominal lesion. The history of trauma, clinical presentation and radiological findings led to a diagnosis of a pulmonary contusion following blunt trauma and complicated by obstructive atelectasis. Few hours after admission, patient's respiratory state deteriorated with polypneic breathing, chest retractions and hypoxemia (pulsed oximetry 80%). She was transferred to the pediatric intensive care unit where nasal high-flow oxygen therapy (oxygen flow rate of 15 L/min, fraction of inspired oxygen up to 0.3) was administered for 48 hours. Although stabilized, dyspnea persisted and required nasal oxygen (3-4 L/min) for a week. Chest physiotherapy did not result in marked expectoration. Chest radiography and CT scan on day 7 showed no improvement. A bronchoscopy was performed on day 8 and revealed a large mucous plug occluding the right main bronchus. There were no underlying endobronchial lesions, nor foreign bodies. The right lung fully expanded after the plug was removed. The patient's breathing also improved substantially. Haemophilus influenzae was found in sputum culture at a concentration of 105 colony-forming units per mL and treated with amoxicillin/clavulanic acid. As the patient presented recurring coughing during exercise, inhaled corticosteroids were also prescribed, alongside with inhaled short-acting beta 2-agonists as needed.

Admission CT-scan showing complete obstructive atelectasis of the right middle and lower lobes and ground-glass opacity in the right upper lobe consistent with a pulmonary contusion in an 8-years old girl after bumper car collision.

PMC3658225_01

Male

A 32-year-old otherwise healthy Hispanic man from Chile was brought in by Emergency Medical Services for multiple and brief episodes of spontaneous loss of consciousness, lasting 20-40 seconds each over the previous 2 days prior to admission. He denied shortness of breath, impaired exercise tolerance, diaphoresis, orthopnea, paroxysmal nocturnal dyspnea, headache, nausea, fever, chills, cough, sore throat, flu-like symptoms, skin rash, arthralgias, leg swelling, trauma, or seizures. However, he reported feeling that his heart skipped beats occasionally (irregular heartbeat) but denied chest pain and dizziness. On further questioning, the patient admitted to have gone on a camping trip in a wooded area, but denied any tick or spider bite. Incidentally, he also recalled having been bitten by a fish on his right leg during swimming about a month ago and was treated with an antibiotic. Social history: Patient was a furniture deliverer. Besides smoking 1/2 pack of cigarettes per day for 10 years, he also admitted to recent use of marijuana, cocaine, and alcohol. He was sexually active with one female partner and practiced safe sex. Family history: Mother had hypertension, but denied any sudden cardiac death in the family. Vital signs: Oral temperature, 97.7 F; pulse, 45 beats per minute (bpm); blood pressure, 139/88 (sitting and standing); respiratory rate, 16 breaths per minute; and oxygen saturation by pulse oximetry was 98% while breathing room air. Head: Normocephalic and no trauma noted. Examination of the head, eyes, ears, nose, and throat were normal. Neck: No jugular venous distention, rigidity, or lymphadenopathy was noted. Lungs: Bilateral fair air entry without rales or wheezes. Heart: Bradycardia with variable first heart sound and normal S2, but no murmurs, rubs or S3 were noted. Abdomen: Bowel sounds present, soft and nontender. No hepatomegaly or abdominal bruits noted. Extremities: There was no edema or clubbing. No effusion or joint tenderness noted. A residual old healed scar behind the right leg was noted. Peripheral pulses were full. Skin: No rash or ecchymoses noted. Neurological exam: The neurological examination was nonfocal. There was no asterexis. On arrival in the emergency department, the patient was found to have a heart rate of 40 bpm and the initial electrocardiogram showed a bifascicular block (Figure 1). The patient continued to have transient, witnessed episodes of loss of consciousness with normal and stable blood pressure. He was hospitalized for continuous cardiac monitoring that showed progression to bifascicular block and subsequently to complete heart block with ventricular escape within the first hour. Subsequently, the patient had a brief episode of asystole, lasting for 30 seconds. He was given atropine 1 mg by IV push and continued to have asystolic episodes briefly without hemodynamic compromise. In the first few hours of cardiac monitoring, the patient had fluctuating variable atrioventricular (AV) blocks: first degree AV block with prolonged PR interval, Wenckebach type-2, a higher degree block with 5:1 block, and a complete heart block with ventricular escape (Figure 2). As the patient had persistent complete heart block with recurrent loss of consciousness without hemodynamic compromise, a transcutaneous pacemaker was placed and subsequently a transvenous pacemaker was placed with good capture (Figure 3). Results of a complete blood cell count, serum chemistry panel, liver function profile, lipid profile, urine analysis, serum alcohol level, emergency toxicology, drugs of abuse urine, and cardiac enzymes for all normal. Erythrocyte sedimentation rate was 15, but C-reactive protein was elevated (Table 1). Chest radiograph showed no active disease, infiltrates or effusion. A transthoracic echocardiogram showed concentric left ventricular hypertrophy with normal left ventricular systolic function without any pericardial effusion, possibly due to the strenuous nature of his work. However, it showed right ventricular enlargement and abnormal septal motion consistent with conduction abnormality. A gallium scan was performed that showed increased uptake, suggestive of myocarditis. Of the various diagnostic markers in this patient (Table 2), screening for Lyme disease was positive with Lyme titer Ab elevated at 2.25. The diagnosis of Lyme carditis was confirmed on the 5th day when the Western blot results were found to be positive for Lyme disease. The patient was started on intravenous ceftriaxone 2 gm/day with continuous cardiac monitoring. Subsequently, patient symptoms improved from complete block to 2:1 AV block, and eventually to sinus bradycardia 1st degree block. However, within 3 days of treatment with ceftriaxone, the patient had a remarkable improvement in symptoms and remained completely asymptomatic After 14 days of intravenous ceftriaxone, continuous cardiac monitoring of the patient showed remarkable improvement with sinus bradycardia at 50 bpm with 1st degree AV block without any further episodes of asystole or complete heart block, or any symptoms of loss of consciousness (Figure 4). The patient was discharged home on amoxicillin 500 mg PO tid for another 4 weeks. During subsequent followups at 1 month and 3 months after the antibiotic treatment, the patient showed normal sinus rhythm with 1st degree AV block.

lyme carditis, transient heart block

PMC8054742_01

Female

A 38-year-old woman with a medical history of type I diabetes mellitus and SPS initially presented to inpatient rehabilitation with intractable and painful muscle spasms due to SPS. The diagnosis of SPS was confirmed by elevated anti-glutamic acid decarboxylase antibody levels (>250 IU/mL). Her symptoms were episodic in nature and triggered by light palpation along the lower limbs. Emotional distress also worsened symptoms. Episodes would last up to 8 h per day. Examination was notable for severe and painful muscle flexor spasms, which were clonic and diffuse. The spasms were particularly notable in her left lower limb with corresponding left ankle inversion, and right upper limb with elbow flexion and forearm supination. The patient underwent serial up-titration of oral baclofen up to 15 mg 3 times a day and diazepam up to 20 mg every 6 h, with concurrent IVIG cycles, with only transient symptom control. Her symptoms made her non-ambulatory and limited her tolerance to using a wheelchair for mobility. She also required moderate-to-maximum assistance for bed mobility, transfers and lower limb dressing. The patient was subsequently referred to the spasticity clinic to be assessed for ITB therapy. She underwent a trial of a single bolus of 50 mug baclofen via a lumbar puncture at the L3-L4 interspace (Fig. 1A and Fig. 1B), resulting in a significant decrease in spontaneous spasms, which lasted for hours. She demonstrated modified independence on transfers and ambulation following the test dose procedure, without requiring an assistive device. The patient was then referred to neurosurgery and ultimately implanted with a SynchroMed II intrathecal delivery system (Medtronic, Inc. Minneapolis, Minnesota, USA), with the catheter tip placed at the T8 spinal level. Her post-procedural course was complicated only by a transient post-dural puncture headache. To date, her ITB has been titrated to 186 mug per day with simple continuous delivery. The patient was weaned off oral baclofen and required only intermittent oral diazepam, with 5 mg once or twice daily. To date, she has mild allodynia in the left lower limb. She attained complete functional independence with ambulation and continues ambulating without needing an assistive device. She remains independent in bed mobility, lower limb dressing, and transfers. She continues ITB therapy with occasional IVIG cycles, directed by neurology. Her baclofen dose has been stable for 36 months following the titration phase of therapy. She has experienced no lasting adverse effects from ITB therapy.

intrathecal baclofen, intrathecal therapy, stiff-person syndrome

PMC9852524_01

Male

A 58-year-old male with no significant personal or familial medical history was admitted with abdominal pain and distension. A submaxillary lymph-node biopsy led to the diagnosis of follicular NHL (grade I-II, phase IV). He reported having dark (tea color) urine and yellowish discoloration of the facial skin and sclera that gradually spread to the whole body. He also complained of persistent abdominal distension, abdominal pain, fatigue, and decreased appetite. Physical examination showed that he had a chronic disease appearance with jaundice of the skin and sclera, and soybean-sized lymph nodes were palpable in the left submandibular region. These enlarged lymph nodes were hard, without significant tenderness, and had poor mobility. Abdominal examination revealed distended abdomen. Multiple masses of different sizes can be touched in the entire abdomen, including the left lower abdomen, with a palpable 15 cm * 20 cm mass with clear boundaries, hard quality, and mild tenderness. Abnormal hepatic function was detected: the patient's alanine aminotransferase (ALT) level was 330 U/L, aspartate aminotransferase (AST) level was 353 U/L, total bilirubin (TBIL) level was 40.33 mumol/L, and direct bilirubin (DBIL) level was 24.21 mumol/L. The patient was treated with medication to protect the liver and decrease the enzyme levels and jaundice, but the jaundice continued to worsen; a hepatic function test performed revealed an ALT level of 168 U/L, AST level of 323 U/L, and TBIL level of 361 mumol/L. Magnetic resonance imaging and computed tomography of the abdomen both revealed numerous filling lymphomatous lesions in the abdominal cavity (Figure 1A), and magnetic resonance cholangiopancreatography showed external pressure stenosis in the middle segment of the common bile duct, expansion of the intrahepatic bile duct, and beak-like expansion of the intrahepatic bile duct (Figure 1B). With continued worsening, relief of the obstructive jaundice by puncture drainage was urgently needed to ensure the success of subsequent chemotherapy. ERCP was performed, but failed because of the infiltration of lymphoma into the duodenal bulb, which resulted in narrowing of the descending junction (Figure 1C). Percutaneous transhepatic cholangio-drainage was not performed due to the patient's poor coagulation and the expansion of the right hepatic duct. The patient's jaundice continued to worsen; a hepatic function test performed revealed an ALT level of 211 U/L, AST level of 301 U/L, TBIL level of 485.6 mumol/L, and DBIL level of 340.2 mumol/L. Therefore, EUS-BD was selected as a workable drainage method, and the patient provided informed consent to undergo the procedure. So, EUS-guided transgastric anterograde common bile duct stenting was performed under general anesthesia (Figure 2, Supplementary Video S1). The duration of this operation was about half an hour.

biliary stent, endoscopic ultrasound, lymphoma, obstructive jaundice, treatment

PMC9329833_02

Male

Case #2 (SqP mimicking SialP at the mouth floor) A 47-year-old Asian male visited the Department of Oral and Maxillofacial Surgery at the Yonsei Dental Hospital complaining of a papillary mass under the tongue that had occurred a month before without a specific event. There was no pain or other remarkable symptoms. He had a past medical history of treated tuberculosis. On clinical examination, an exophytic verrucous mass was observed from the floor of mouth to the lingual frenum (Figure 3A). It had a maximum diameter of about 1.5 cm, and showed a pink surface color similar to the surrounding normal mucosa. In addition, the lesion was soft on palpation, with no observable tenderness or induration. It was excised and submitted for histopathologic examination under a clinical impression of SqP. Low-power histopathological examination revealed an exophytic papillary mucosal epithelium with an underlying adenomatous submucosa compartment (Figure 3B). The submucosa compartment was composed of a "superior" hyperplastic and microcystic-like portion and an "inferior" dilated and tortuous ductal portion (Figure 3C). The superficial papillary mucosa had focal atypical features such as bulbous rete ridges and disorganized basaloid proliferation (Figure 3D). In the superior submucosa portion, the overall epithelial structure was adenomatoid, with hyperplastic squamous epithelium overlined by a layer of ciliated columnar epithelium (Figure 3E). Microcystic or microductal structures were seen within the superior hyperplastic ductal epithelium. In the inferior submucosa portion, indistinct micropapillary-like projections were seen within the dilated columnar ductal epithelium (Figure 3C). The inferior portion lacked any evidence of tumorous adenomatous proliferation. Differential diagnosis between SqP and SialP was required. IHC staining revealed that CK7 was only positive in the ductal epithelium of the inferior portion and in a single layer of luminal epithelium in the superior submucosa portion (Figure 3F). Importantly, diffuse S-100 expression and abluminal SMA staining typically seen in SialP were not seen in this lesion. The superior submucosa portion did not show SMA (+) myoepithelial cells, consistent with a general excretory duct histology rather than the salivary gland tumor, SialP (Figure 3H). These findings indicated a definite tumorous papillary growth in the superficial mucosa with extension to the superior excretory duct and additional presence of reactive ductal dilation. Although the overall lesion did not present definite cellular pleomorphism or loss of polarity, since the epithelial basal cells showed bulbous architecture, we evaluated the lesion for the possibility of early-stage malignant transformation. The IHC results showed that the Ki-67 proliferation index and p53 expression were minimal and localized at the basal layer in both the lesional epithelium and adjacent normal mucosa (Figure 3I). This pattern suggested that the mild epithelial atypia in Case #2 was more likely to be benign and reactive rather than premalignant, as occasionally seen in SqPs. The final diagnosis was SqP with mild atypia and ductal extension.

oral cavity, oral pathology, oromaxillofacial, papillary lesion, salivary gland, sialadenoma papilliferum, tumor

PMC6997440_01

Female

A 4-year-old (estimated) Pit Bull cross intact female (25 kg) was presented for routine evaluation after it was adopted from the streets. The results showed that she had asymptomatic D. immitis infection as indicated by the presence of microfilariae in Knott's modified test and a positive D. immitis antigen test, although seronegative for Anaplasma spp., Ehrlichia spp., and Borrelia burgdorferi (SNAP 4DX Plus , IDEXX Laboratories Inc., Westbrook, ME, USA). She was seronegative for Leishmania infantum (TR DPP canine visceral leishmaniasis, Bio-Manguinhos, Brazil). The routine physical examination showed no clinical signs of the disease and the hematological and urine examination results were normal. The heartworm pre-treatment tests included blood work (blood urea nitrogen test, creatinine, alanine transaminase, and alkaline phosphatase levels and complete blood count), Doppler echocardiogram and chest X-rays. The blood work and Doppler echocardiogram were normal; however, the X-rays showed mild right atrioventricular enlargement and mild increase in interstitial and bronchial pulmonary pattern (Figures 1, 2). Since the organic arsenical drug is unavailable in Brazil, the treatment option was the use of slow-release injectable moxidectin (ProHeart SR-12, Zoetis, Campinas, Brazil) biannually (0.5 mg/kg) instead of annually in combination with 30 days of doxycycline (Doxifin , Ourofino, Cravinhos, Brazil) (10 mg/kg/BID). The owner was duly informed and clarified about the off-label alternative treatment and after her formal consent the administration of both drugs was initiated on the same day. When the dog was presented for evaluation 6 months following the first moxidectin injection it was informed that she could be pregnant as she had been in heat approximately 30 days before the visit and she lived with an intact male dog. Abdominal ultrasound was performed, and pregnancy was confirmed. Therefore, chest X-rays for lungs evaluation were precluded. All the other pre-treatment examinations were repeated, and the results were within the reference range. No microfilariae were detected by Knott's modified test and D. immitis antigen test was negative. Since a D. immitis-infected dog receiving alternative treatment must present microfilariae and D. immitis antigen test negative results 6 months apart to confirm the elimination of the parasite, a second moxidectin injection (0.5 mg/kg) was administered 6 months after the first and the animal was kept under observation. Within 1 week following the second injection, the animal gave birth to three healthy puppies. Blood work, Doppler echocardiogram, and chest X-rays were unchanged when she was presented 6 months after the second moxidectin dose and serological tests with the heat pre-treatment sample confirmed that heartworm had been successfully eliminated. Since the animal was free of infection, the owner was advised to continue with the moxidectin injections annually.

doxycycline, heartworm, macrocyclic lactone, microfilariae, vector-borne disease

PMC7305842_01

Male

Four-year- and eight-month-old, previously well, male child presented with abdominal pain, loss of appetite, low-grade intermittent fever, nausea, vomiting, and progressive abdominal distension of ten days duration. He has also cough of five days duration. There was no history of yellowish discoloration of eye or skin, bleeding or previous history of jaundice, urinary complaints, and change in urine or stool color. He has no history of contact with chronic cougher or with tuberculosis-diagnosed patients. On examination: Blood pressure 90/60mm, pulse rate 88/minute, respiratory rate 20/minute, and temperature 37 C. There was decreased air entry and dullness in the lower lung field bilaterally. Distended abdomen, fluid shift was positive; the liver was palpable 6cm below the right costal margin, total liver span 11 cm, and tender. There was some palmar pallor, otherwise normal. On investigations, hepatitis A antibody immunoglobulin M was reactive, with a titer of >10.11. Other viral markers (hepatitis B, hepatitis C, and human immunodeficiency virus test was negative). Echocardiography study was normal. Other investigations are listed in Table 1. Ultrasonography examination revealed minimal ascites, hepatosplenomegaly, and small bilateral pleural effusion. Ultrasound guided-pleural tap revealed no cells, lactic acid dehydrogenase 15 IU/L, gene Xpert for tuberculosis was negative and bacteriologic culture was negative. Gastric aspirate was also done for gene Xpert and found to be negative. Based on those investigations, the diagnosis of anicteric acute viral hepatitis A with unusual manifestations of pleural effusion and ascites was made. He was managed with supportive treatment (hydration, rest, antiemetics, a well-balanced diet). The liver enzymes were corrected within two weeks, ascites and pleural effusion disappeared after two weeks. Liver and spleen sizes were normalized after one month of follow-up.

ascites, hepatitis a, pleural effusion, unusual manifestation

PMC5279079_01

Male

A 57-year-old male had a 3-year history of heartburn and a 1-year history of cough. The patient began to suffer heartburn, regurgitation, nausea, bloating, and vomiting 3 years ago. Acid could reflux to his mouth sometimes. He had to pad the head in order to reduce the incidence of reflux while sleeping. The patient began to cough while symptoms of regurgitation and heartburn aggravated 1 year ago. The endoscopy result was esophagitis LA-C and atrophic gastritis with erosion. The patient was diagnosed as having GERD in a local hospital and received treatment of life adjustment and medicine including PPI and gastrointestinal prokinetic drug. The symptoms of cough, heartburn, and vomiting were relieved after taking drugs such as PPI in the beginning. However, the patient felt that symptoms were aggravated in the past 2 months and reoccurred after he stopping using drugs. He had a 5-kg weight loss during a period of 2 years. The body mass index of the patient was calculated to be 19.3 after hospital admission in our center. Physical examination revealed only abdominal slight tenderness. The DeMeester score was 1.56 and the result did not meet the standard of acid reflux disease. The lower esophageal sphincter pressure was lower than normal, all swallowing is invalid peristalsis. Because the patient's 24-hour pH monitoring did not meet the standard of acid reflux disease, the patient completed upper gastrointestinal radiography to exclude other causes. The results of the upper gastrointestinal radiography revealed esophageal reflux disease and possible gastritis; hence, SMA oppression syndrome (descending part of duodenal dilation, the contrast agent blocked through the tract, formation characteristic of penholder oppression) was considered (Fig. 1). Abdominal CT scan revealed a 25 angle between the SMA and the aorta, a distance of 7.8 mm. The patient was diagnosed as having SMA syndrome. We combined laparoscopic Toupet fundoplication with duodenojejunostomy to manage SMA syndrome complicating extraesophageal symptoms.

PMC4901177_01

Male

The patient was a 48-year-old male, smoker (30 pack-years), but not yet seriously ill. The patient was vaccinated against TB as a child. He is married and resides in an apartment with his family. The patient arrived at the hospital complaining of sudden hemoptysis. He reported that he had been coughing more than usual during the last month and had been short of breath upon exertion. He was afebrile and had lost 20 kg over the course of 9 months. A posteroanterior chest X-ray showed diffuse bilateral infiltrates (Fig. 1). A sputum examination repeatedly demonstrated massive smear positivity and a finding of acid-fast bacilli, which was followed by culture positivity 3 weeks later. A Bactec MGIT 960 examination produced a positive result on the 8th day and PCR tests results were also positive. The Mantoux TST showed an induration of +15 mm. Typing demonstrated Mycobacterium tuberculosis complex (MTB) with preserved sensitivity to first-line antituberculous medications. HIV test results were negative. First-line antituberculosis treatment (AT) was started immediately with a combination of rifampicin, isoniazid, ethambutol and pyrazinamide. After 2 months, sputum samples were both culture-negative and smear-negative for MTB. Given the extent of the disease, the initial phase of AT treatment was extended to 3 months, with a follow-on phase of bi-therapy with rifampicin and isoniazid for 6 months. Treatment was effective with no adverse effects. Radiograph findings gradually regressed and the patient's clinical condition improved significantly (Fig. 2). The patient's wife was examined during the course of a TB contact investigation.

contact investigation, latent tuberculosis infection, preventive chemotherapy, tuberculosis

PMC4901177_02

Female

The patient was a 47-year-old female, smoker (31 pack-years), employed as a maid, presenting as not seriously ill. The patient resides in the same household as her husband and was vaccinated against TB as a child. She visited the hospital for the purpose of undergoing a TB contact investigation. No reported pulmonary complaints, apart from a long-standing cough in the mornings. She was afebrile, no reported weight loss, no perspiration. The TST was positive with an induration of +16 mm; HIV test results were negative. A chest X-ray showed infiltrates in the upper right and middle fields on both right and left sides. Sputum tests were repeatedly smear-negative, but culture and Bactec MGIT 960 tests were positive. Genome testing demonstrated a positive finding of the MTB gene. Sensitivity to first-line AT was preserved; the patient started AT treatment with the same combination used for her husband (an initial phase lasting 2 months, and a follow-on phase lasting 4 months).

contact investigation, latent tuberculosis infection, preventive chemotherapy, tuberculosis

PMC4901177_03

Female

The third report involves the daughter of the aforementioned married couple: a 23-year-old female, vaccinated against TB as a child, mother of a 4-year-old child, smoker since youth (6 pack-years), presenting as not yet seriously ill. The patient occasionally works as a waitress in a bar and resides with her son and parents in the same apartment. She participated in the TB contact investigation on the basis of being a close contact of her father. During the previous month, the patient noticed a cough and weight loss of 3 kg. She was afebrile, no perspiration, and reportedly felt quite well. TST results showed an induration of +16 mm; HIV test results were negative. A chest X-ray showed findings of pulmonary infiltrates in both lungs with numerous caverns in the right upper lobe (Fig. 3). The patient was hospitalized immediately. Sputum was smear-positive and culture-positive for MTB for a period of 2 months. Mycobacterium testing with the Bactec MGIT 960 was also positive. The patient was started on first-line AT therapy with a combination of rifampicin, isoniazid, ethambutol, and pyrazinamide. Her sputum was smear-positive and culture-positive for MTB for a period of 2 months. Given the extent of the findings, the initial phase was extended to three months, and the follow-on phase involved bi-therapy with rifampicin and isoniazid in a daily regime for 4 months.

contact investigation, latent tuberculosis infection, preventive chemotherapy, tuberculosis

PMC4901177_04

Male

The patient was the 4-year-old male, son of the abovementioned 23-year-old patient. The child had never been vaccinated against TB due to the lack of TB risk within the family. He resides in the same household as his mother and grandparents. The family reported no health problems for the child. A posterior-anterior chest X-ray showed no pathology in the lung parenchyma. TST results showed an induration of +16 mm and Interferon gamma release assay (IGRA test) was positive. As a very close family contact, the boy was started on isoniazid chemoprophylaxis at a dose of 5 mg/kg of body weight, which was continued for 6 months as treatment for an identified latent tuberculosis infection.

contact investigation, latent tuberculosis infection, preventive chemotherapy, tuberculosis

PMC4703342_03

Male

A 37-year-old male from Georgia came to France in October 2012. He had HIV infection since 2006 inconstantly treated with HAART. Other medical conditions were adrenal insufficiency, cirrhosis due to chronic HCV, and treatment-controlled tuberculosis. VL was diagnosed in 2010 and treated in Georgia with meglumine antimoniate and L-AmB (doses and schedules unknown). In November 2012, he presented hepatosplenomegaly, lymphadenopathies, infiltrated cutaneous lesions, anemia, number of CD4 lymphocytes = 133/mm3, viral load < 50 copies/mL, and parasitemia of 6 Leishmania/ml. He received a course of L-AmB followed by maintenance therapy for 5 months (Fig 1B). In May 2013, he had weight loss, hepatosplenomegaly, anemia, number of CD4 lymphocytes = 177/mm3, viral load < 40 copies/mL and parasitemia of 12 Leishmania/ml. L-AmB treatment was intensified, but renal insufficiency and acute thrombocytopenia occurred. In June, the splenomegaly and parasitemia remained unchanged. A course of meglumine antimoniate was administered. Despite pre-existing liver disorders, the treatment was well tolerated except for mild neutropenia. One month later, a marked clinical improvement was observed and parasitemia decreased to 0.2 Leishmania/ml. In July, maintenance treatment with miltefosine (150 mg/day for 3 months) was started. Parasitemia was negative, the number of CD4 lymphocytes increased from 169 to 540/mm3, and viral load was undetectable. Parasitemia remained negative through 18 months.

PMC9251566_01

Female

This study was approved by the Institutional Review Board of Northwell Health. Table 1 summarized the clinical and laboratory findings of the three patients. Patient 1 was an 89-year-old woman who presented with persistent leukocytosis and weight loss. She was diagnosed with MDS/MPN-U on bone marrow biopsy and treated with hydroxyurea (500 mg, Oral Daily). Her hematological parameters showed progressive improvement and the response lasted about 30 months in terms of leukocytosis. During this period, she had a median white blood cell (WBC) of 20.5 x 109/L, a median hemoglobin (Hb) of 10.3 g/dL, and a median platelet of 198 x 109/L. With disease progression, her platelet count has been gradually elevated while the WBC count was relatively stable. She eventually developed significant leukocytosis (56.2 x 109/L at peak) and thrombocytosis (752 x 109/L at peak) (Fig. 1G). During the entire clinical course, her WBC ranged from 13.2 to 75.0 x 109/L, Hb from 6.7 to 11.3 g/dL, mean corpuscular volume (MCV) from 96.7 to 122.1 fl, and platelet from 67 to 752 x 109/L, and she received ten RBC transfusions. She has been hospitalized twice for a total of 26 days, which occurred within the last two months of her life. She received palliative care and died 33 months after diagnosis. Patient 2 was an 84-year-old man with multiple comorbidities. He presented with severe shortness of breath, productive cough, and had marked thrombocytopenia. Complete blood count (CBC) showed WBC of 16.2 x 109/L, Hb of 9.2 g/dL, and platelet of 32 x 109/L. There was a possibility that acute febrile condition might partly contributed to his thrombocytopenia. During the hospitalization, he received two RBC transfusions and five platelet transfusions, and became refractory to platelet transfusion. He subsequently developed sepsis and was treated with vancomycin and Zosyn. Bone marrow biopsy findings were consistent with MDS/MPN. He received supportive care and died of multiorgan failure ten days after the admission. Patient 3 was an 81-year-old man with a history of hepatitis C and cirrhosis who was admitted for leukocytosis, worsening anemia, and marked thrombocytopenia. He was diagnosed with MDS/MPN-U on bone marrow biopsy and initially treated with a hypomethylating agent. After treatment, his leukocytosis significantly improved, but anemia and thrombocytopenia persisted. During the clinical course, the WBC ranged from 2.6 to 14.6 x 109/L, Hb from 6.6 to 9.2 g/dL, platelet from 6.0 to 27.0 x 109/L. He became transfusion dependent after the diagnosis of MDS/MPN-U and received a total of nineteen RBC transfusions over the entire clinical course. He had multiple hospitalizations lasting for 43 days and the last admission was complicated by sepsis. He received palliative care and died two months after diagnosis. Splenomegaly was present only in patient 3 (19 cm in length by CT scan). Serum lactate dehydrogenase level was elevated in patient1 and patient 2. The CBC at presentation showed a median WBC count of 16.2 x 109/L (range, 14.6-58.5), a median Hb level of 9.2 g/dL (range, 7.3-10.6), a median MCV of 99.7 fl (range, 85.5-100.4), a median corpuscular hemoglobin (MCH) of 31.6 pg (range, 28.9-32.3), and a median platelet count of 32.0 x 109/L (range, 27.0-216.0). Differential cell count revealed greater than 80% neutrophils and less than 10% immature granulocytes in all the patients. The absolute monocyte count was >1 x 109/L in two patients (patient 1, patient 2), but the monocyte percentage was only increased (10%) in patient 2. There was no increase in peripheral blood blasts, lymphocytes, or eosinophils in any of the patients. The absolute reticulocyte counts were 65.0 k/ul and 63.8 k/ul in patient 1 and patient 3, respectively. Bone marrow biopsy showed marked hypercellularity in all the patients, including two patients with myeloid predominance and one patient with erythroid predominance (patient 2). Myelopoiesis and erythropoiesis showed normal maturation in all the patients. Megakaryocytes were normal number in two patients and markedly increased in one patient (patient 3). Multilineage dysplasia was evident in two patients while only dyserythropoiesis was present in patient 1. Bone marrow aspirate smear iron stain showed >15% ring sideroblasts in two patients (patient 1, patient 2). Other bone marrow findings included multiple lymphoid aggregates (patient 1), presence of granulomas and increased macrophages with focal hemophagocytosis (patient 2), megakaryocytosis and fibrosis (patient 3). (Fig. 1A-1F) Immunohistochemical studies revealed bone marrow involvement by 10% B cells with SLL/CLL phenotype (patient 1), 7% CD34-positive blasts (patient 2), and significantly increased megakaryocytes (patient 3). There was no increase in CD34-positive blasts in patient 1 and patient 3. In patient 1, flow cytometry analysis detected a minute population of monoclonal B-cells (positive for kappa, CD19, dim CD20, CD23, CD5; negative FMC-7, CD10, CD38) with SLL/CLL phenotype in both peripheral blood and bone marrow specimens. There was no increase in myeloblast or monocyte, and myeloid granularity was normal in bone marrow. In patient 2, flow cytometry of bone marrow showed increased myeloblasts (positive for partial HLA-DR, partial CD5, CD7, CD11b, partial CD13, CD33, partial CD34, partial CD117 and negative for CD2, CD3, CD4, CD56), increased monocytic cells (positive for partial HLA-DR, CD4, CD11b, heterogeneous CD13, partial CD14, CD15, CD33, CD64 and negative for CD2, CD34, CD56, CD117), and decreased myeloid granularity. The monocytic cells demonstrated an aberrant immunophenotype including partial expression of HLA-DR and heterogeneous expression of CD13. In patient 3, flow cytometry of bone marrow revealed mildly decreased myeloid granularity with no increase in blast. Conventional cytogenetic analysis revealed a normal karyotype in patient 1 and -7/-7q abnormalities in patient 2, patient 3. FISH studies using probes for MDS panel confirmed the cytogenetic findings and showed no additional abnormalities. BCR-ABL fusion was not detected in any of the patients. NGS studies (OnkoSight Myeloid panel comprising 37 genes, Bioreference laboratories) identified four to six somatic mutations in each of the patients (Table 2). CSF3R T618I mutation was present in all the patients with a variant allele frequency (VAF) ranging from 27% to 49%. In addition, patient 1 harbored TET2, SF3B1 and CSF3R S810Qfs* mutations; patient 2 harbored ASXL1, U2AF1, SETBP1, KRAS, and RUNX1 mutations; patient 3 harbored TET2, U2AF1, SETBP1, PTPN11, and ZRSR2 mutations. CSF3R S810Qfs*, KRAS, and PTPN11 mutations were present as subclones. NGS study was also performed in patient 1 when her CBC indices showed response to the treatment. The NGS revealed a disappearance of the CSF3R S810Qf*6 mutation, significantly decreased CSF3R T618I VAF, and a stable SF3B1 mutation.

csf3r mutation, chronic myelomonocytic leukemia, colony-stimulating factor 3 receptor (csf3r), myelodysplastic/myeloproliferative neoplasm, next generation sequencing

PMC3361897_01

Male

A 7-month-old boy presented with left axillary lymphadenopathy persisting for two to three weeks. His past medical history was unremarkable with the exception of recurrent oral candidiasis. His parents were first-degree relatives. Family history was negative for genetic disorders or tuberculosis. He was vaccinated with BCG at the age of three months. On admission, routine physical examination was unremarkable with the exception of lymphadenopathy with a diameter of 5x5 cm in the left axillary region. There was a BCG vaccine scar on his left shoulder. The tuberculin skin test was positive (15x15 mm). Thoracic computed tomography and abdominal ultrasonography were normal. The lymph node biopsy was performed and pathohistological examination showed a widespread infiltration of lymphohistiocytes. A few small granulomas without caseous necrosis were present. Ziehl Neelsen stain for acid-fast bacilli showed the presence of multibacillar histiocytes. M. tuberculosis complex PCR and culture were negative. Routine immunological evaluation including serum IgG, IgA, IgM, IgE, peripheral blood lymphocyte subsets and phagocyte respiratory burst assay were normal. Whole blood samples were in vitro activated with BCG, BCG plus IL-12 and BCG plus IFN-gamma as described previously. IL12p40 production was increased after stimulation with BCG plus IFN-gamma (Figure, a). In contrast, IFN-gamma production to BCG plus IL-12 was blunted (Figure, b). IL-12Rbeta1 molecule expression on activated T cells was found to be negative by flow cytometric analysis (data not shown). DNA sequencing of the IL12RB1 gene revealed a new homozygous mutation (64+1G>T). The patient's parents and brother were heterozgyous for this mutation and healthy. So, following the genetic analysis, the healthy brother was vaccinated with BCG at the age of three months. The patient was treated with isoniazide (INH), rifampicin (RIF) and ethambutol for the first two months and then treatment continued with INH and RIF for another six months. Drainage of purulent material from the operation wound discontinued at the fourth month of the treatment. Eight months passed since the end of treatment and he is doing well with the exception of oral candidiasis.

PMC3994693_01

Male

A 65-year-old male patient, with poorly controlled diabetes mellitus, presented to us with painless, progressive diminished vision in both eyes over 4 months (asymmetrical involvement; right eye defect more than left eye). On examination, right eye had only perception of light and left eye had vision of counting fingers up to 2 feet. Fundus showed features of optic atrophy. His neurological examination was unremarkable. There were no signs of meningeal irritation. He was negative for HIV, HBsAg and HCV done by ELISA as a routine presurgical investigation. His chest X-ray was unremarkable. Mantoux was negative. Sputum AFB (done in the postoperative period after the tissue cultures showed growth of tuberculosis) was negative. Sputum for acid fast bacilli was negative. He had an FBS = 176 mg/dl, PPBS = 231mg/dl, and Hb1Ac = 8.2%. Magnetic resonance imaging (MRI) of brain with orbit showed a lesion, which was heterogeneously hypointense on T1W and hyperintense on T2W, located in the orbit, encircling the optic nerve and was extending through the optic foramen into the cranial cavity. On gadolinium contrast T1W imaging, the lesion was brilliantly enhancing and was extending onto the planum sphenoidale [Figure 1]. Mild enhancement was also noted in the right orbit. The paranasal sinuses were normal. A working diagnosis of orbital meningioma was made. A left supraorbital craniotomy and deroofing of the orbit was followed by subtotal excision of the lesion. The tumor was grayish, mildly vascular, firm, nonsuckable and was encircling the left optic nerve and was extending into the optic canal. The frozen section examination was suggestive of granulomatous pathology and hence the specimen was subjected to microbiological examination as per our departmental protocol for suspected infections (aerobic, tubercular and fungal staining, and cultures). Histopathological examination showed multi-septate hyphae suggestive of fungus. On day 5, growth of Aspergillus flavus was noted on fungal culture. The patient was started on antifungal drugs immediately (Inj. Voriconazole 400 mg on day 1 followed by 200 mg daily for 14 days, followed by oral Voriconazole 200 mg, twice daily for 4 weeks, to be reviewed with repeat imaging). On day 28, all three cultures tubes for tuberculosis [BACTEC 460 Tb system (Becton Dickinson, USA) using the 12 B vials] were positive. He was started on antitubercular drugs as per his body weight (Isoniazid 300 mg once a day, Rifampicin 600 mg once a day, Pyrazinamide 750 mg twice daily, Ethambutol 800 mg once a day, and Benadone 20 mg once a day). He was discharged on 14th postoperative day with no change in his visual status. He, however, had a cerebrovascular accident and succumbed to it on 38th postoperative day.

aspergillus, co-infection, fungal, granuloma, orbital, skull base, tuberculosis

PMC5553646_01

Unknown

This increasing trend of elderly road users is not only specific to Korea itself but also to other developed and developing countries as well, and several studies have investigated the risk of collisions by the elderly by distinguishing subgroups among the elderly with a cut-off age of 75. Li et al. investigated elderly collision risk and showed that frailty is the overriding factor for increased older driver deaths per mile, while excessive crash involvement, which affects other road users, played a lesser role and becomes apparent by age 75. In another traffic safety study, although older drivers have been defined as persons aged 65 years and older, the traffic accident data-based results presented here show that 65- to 74-year-old drivers are relatively safe compared to drivers in their 20s and even compare well to drivers in their 30s. They suggested that older drivers with elevated crash risk levels should be defined as 75 years old and older. Braver and Trempel concluded that when drivers reach the age of 75, there is an upturn in fatality risk, and two thirds of the deaths in crashes involving drivers aged 75 and older were of the drivers themselves, and Rita et al. applied the same cut-off value by grouping the elderly into younger-olds and older-olds in their study. This study had two research objectives related to the elderly occupants of motor vehicles. First, the confounding effects of seat position and seatbelt use on elderly occupants were analyzed with eight-year road crash data in Seoul, South Korea, between 2008 and 2015. Second, the elderly group was further divided in two age groups, a younger-old group aged between 65 and 74 years and an older-old group aged 75 years and older to assess whether the growing elderly population and changing physical and mental capabilities of the elderly population may necessitate reconsiderations of relevant traffic safety policies. In this study, two injury levels were defined, severe (fatal and major injuries) and non-severe (minor injuries), and three seat positions (driver, front passenger, and rear seat) were considered with an emphasis on older drivers, who are becoming increasingly common. A Multinomial logit model was adopted to compare multiple age groups using odds ratios. This study helps to raise public awareness about the importance of seatbelt use by elderly road users. Moreover, the accompanying relevant traffic safety regulations could reduce exposure to collision risk by the growing elderly population. In addition, increasing public awareness about the fact that the choice of seat position affects the injury severity outcome could contribute to reducing injury severity levels in collisions involving the elderly. Overall, the results of this study strongly suggest that elderly road users should acquire a better understanding of their risks if involved in a collision and that the almost universal cutoff of 65 years when grouping the elderly requires reconsideration. Immediate attention is needed from both traffic safety agencies and the public, especially in rapidly aging countries such as South Korea.

PMC5516737_01

Female

Our patient is a 52-year-old Malay woman who presented with a three-week history of intermittent pyrexia. This was associated with an unintentional weight loss of 10 kg over three months. She has a past medical history of asthma, hypertension, and hyperlipidaemia. There were no specific localizing symptoms including cough, sputum, haemoptysis, dysuria, abdominal pain, or diarrhoea. There was also no history of travel. Parameters revealed pyrexia of 40 degrees Celsius and sinus tachycardia of 113 beats per minutes but normal blood pressure. Physical examination was unremarkable with normal heart and breath sounds. Abdomen was soft, nontender with no palpable masses. There was no cervical, axillary, or inguinal lymphadenopathy. There were no neurological deficits and stigmata of liver disease. Initial investigations showed microcytic hypochromic anaemia with a haemoglobin of 9.8 g/dL and mean cell volume of 75.2 fL. Renal function was unremarkable, but there was a raised lactate dehydrogenase (LDH) level of 2140 U/L. Other blood results are summarised in Table 1. A computed tomography scan of the thorax abdomen and pelvis was performed, and it showed bilateral homogenous adrenal masses measuring 3.7 x 5.4 x 6.4 cm on the left and 5.5 x 2.7 x 5.9 cm on the right (Figures 1 and 2). There was also a prominent left supraclavicular lymph node measuring 0.8 cm and a few subcentimetre mediastinal lymph nodes measuring up to 0.8 cm. Early morning cortisol was subsequently found to be low at 242 nmol/L and short Synacthen test with 250 mcg of tetracosactide did not show adequate cortisol response (Table 1). Acid Fast Bacilli stain and culture alongside with Polymerase Chain Reaction for Tuberculosis (TB PCR) of the patient was negative. A left adrenal biopsy was performed, and histology revealed sheets of large lymphoid cells with a prominent intravascular growth pattern. The neoplastic cells were positive for CD20, CD79A, MUM1, BCL6, and BCL2. There was no expression for CD10, consistent with a nongerminal centre B-cell origin. MYC was positive in 70% of tumour cells and Ki-67 proliferation index was 90%. CD5 was positive; Cyclin D1 and SOX11 were negative, which also excludes mantle cell lymphoma. Bone marrow biopsy did not show any marrow involvement (Figure 6). The patient was reviewed by a Hematologist, and the decision was made to manage her as for Stage 4 Diffuse Large B-Cell Lymphoma (DLBCL) in view of organ involvement. Her Eastern Cooperative Oncology Group (ECOG) status was zero, and International Prognostic Index (IPI) was one because of raised lactate dehydrogenase. She was treated with six cycles of R-CHOP and four cycles of intrathecal methotrexate chemotherapy. Remarkably, repeat computer tomography scan after four cycles of R-CHOP chemotherapy showed interval regression of bilateral adrenal masses with nearly normal adrenal glands (Figure 3). The left enlarged supraclavicular and mediastinal nodes remained stable in size. A Positron Emission Tomography (PET) scan six weeks after completion of both R-CHOP and intrathecal methotrexate revealed no fluorodeoxyglucose (FDG) update in the chest, abdomen, or pelvis and the enlarged left supraclavicular lymph node showed mild-FDG avidity that was smaller in size compared to previous computed tomography scans. This was discussed in a multidisciplinary tumour board, and it was decided to consider this as a reactive lymph node (please see Figures 4 and 5). She remained in complete remission five months after chemotherapy and have since returned to work. However, repeat Synacthen test showed persistent adrenal insufficiency, and she remained on hydrocortisone replacement therapy. She is being monitored closely by a Hematologist and an Endocrinologist.

PMC4414437_01

Female

Unconditional logistic regression models were used to assess the characteristics of different groups of the NADC patients at ORCI. Compared to HIV negative patients, HIV positive patients were more likely to be older (Odds ratio (OR) = 1.02, 95% CI: 1.01-1.04); female (OR = 1.78, 95% CI: 1.12-2.82); have advanced cancer stage (OR = 5.82, 95% CI: 1.24-27.29); have received radiotherapy (OR = 3.5, 95% CI: 2.10-5.7); have not received chemotherapy (OR = 0.21, 95% CI: 0.13-0.34); and have fewer co-morbidities (OR = 0.52, 95% CI: 0.41-0.67) (Table 1). Though not statistically significant, HIV-positive patients were more likely to reside in Dar es Salaam (OR = 1.57, 95% CI: 0.98-2.54) and have tuberculosis (OR = 2.54, 95% CI: 0.95-6.81). When stratified by year, a more than two-fold increase in HIV-positive NADC cases occurred in 2008, with most of the increase resulting from a rise in the number of HIV-positive squamous cell carcinoma of the eye cases. The population of newly diagnosed NADC cases with HIV also became older overall over the 11-year period, increasing from an average of 27 years old in 2002 (median = 36) to 42 years old in 2012 (median = 40). To determine differences in the population of patients with a known HIV status and patients with no recorded HIV status in their medical records, these two groups were compared. Patients with a known HIV status were more likely to be female (OR = 1.42, 95% CI: 1.08-1.87); received radiotherapy (OR = 1.42, 95% CI: 1.06-1.90); have more co-morbidities (OR = 1.34, 95% CI: 1.19-1.51); and have tuberculosis (OR = 8.11, 95% CI: 3.22-20.40), compared to patients with no recorded HIV status (Table 2). Patient characteristics of the three studied NADCs are documented in Table 3 to describe differences in these groups of patients. Ano-rectal cancer patients had the oldest age at diagnosis and Hodgkin's lymphoma patients had the youngest; Hodgkin's lymphoma patients were also more likely to be male; squamous cell carcinoma of the eye patients were most likely to have a reported and positive HIV status; and Hodgkin's lymphoma patients tended to have more co-morbidities (Table 3).

hiv, non-aids-defining cancer, ocean road cancer institute, squamous cell carcinoma of the eye, tanzania

PMC10076841_01

Female

A 7-year-old child was referred with the main symptom of shortness of breath one year prior to admission. She started experiencing repeated respiratory tract infections, feeding issues, and failure to thrive at the age of six months, although she was not bluish. She received a pulmonary TB diagnosis and had 9 months of therapy. She continued to report having dyspnea, and an echocardiogram showed that she had multiple muscular VSDs with a left-to-right shunt and pulmonary hypertension with a total diameter of 1-1.4 cm. The results of a physical examination revealed a heart rate of 115 beats per minute, a respiratory rate of 21 breaths per minute, and a room air oxygen saturation of 98%. Her height was 122 cm, and her body weight was 18 kg. Regular first and second heart sounds were audible during auscultation, as well as a loud intensity holosystolic murmur grade 3/6 in the lower left sternal border. The patient had a D-shaped LV and severe PH with a TVG of 69 mmHg and a transVSD gradient of 15 mmHg. We chose to use the jugular vein approach to accomplish percutaneous transcatheter VSD closure. Preprocedural 98%; patient underwent general anesthesia. The patient was intubated using ETT No. 5.5% and 30% FiO2. 100% post-intubation saturation TEE revealed several muscular VSD with 2-3 mm and 12 mm diameters, 3 mm spacing between VSD, L to R shunt, AR (-), and TR mild with septal leaflet tricuspid prolapse. (Figure 1A). The decision was made to catheterize the right heart. The right femoral artery of the patient was punctured, and the patient then inserted a 4F sheath, heparin 1.000 IU, and MP sidehole 5F catheter. The right jugular vein was punctured; the MP sidehole was 5F and the sheath 6F was used. Following right cardiac catheterization (Qp:Qs 3.5, PVRi 5.23WUmsq, PVR 4.55 WU, PVR/SVR 0.16), we made the decision to correct the defect using an Amplatzer Septal Occluder (AGA) No. 16 mm using transjugular method. Through the muscular VSD, a 5F MP sidehole diagnostic catheter was introduced under the direction of transesophageal echocardiography (TEE). A 5F MP sidehole diagnostic catheter was introduced under the direction of transesophageal echocardiography (TEE) from SVC, RA, RV and LV through muscular VSD (Figures 1B-D). Using 0.035'' Amplatzer stiff wire, we change to 8F delivery sheath (Figure 1E). Full device deployment was successfully performed with several episodes of PVC storm and severe bradycardia (Figures 1F-H). Echocardiography evaluation showed no complications before, during, and after deployment of the occluder device (Figure 1H). Her symptoms and appetite steadily improved a week after the operation. She was able to engage in moderately intensive activities three months after the treatment without experiencing any discomfort. Her TVG was 60 mmHg and 50 mmHg six months and one year after the procedure, respectively, with still visible evidence of PH. However, 1.5 years after the procedure, her TVG dropped to only 18 mmHg, her visible indicators of PH subsided, and the PA dilator treatment was discontinued. Her body weight had increased to 28 kg, and she had no complaints. The patient's ECG showed sinus rhythm during our most recent clinic visit.

echocardiography-guided, muscular vsd, pulmonary hypertension, single device, transjugular

PMC9871031_01

Male

A 68-year-old male with a history of dilated cardiomyopathy and pacemaker implantation 2 years prior was hospitalized with repeated chills, fever and weakness for 20 days. After examination in the local hospital, the WBC count (10.38x109/L) and CRP level (75 mg/L) were both increased. Moxifloxacin, meropenem and vancomycin were used for anti-infection treatment, but they were ineffective. The patient was transferred to the provincial hospital, indicating that the WBC count (11.5x109/L) and CRP level (173 mg/L) were further increased, but procalcitonin did not increase (0.08 ng/mL). To identify the pathogens causing infection, the patient came to our hospital for treatment. However, the patient's condition further deteriorated, and the inflammatory markers continued to rise (18.26x109/L WBCs and 15.95x109/L neutrophils), with negative results for hepatitis B virus, hepatitis C virus, human immunodeficiency virus, and Treponema pallidum as well as culture of blood, sputum and urine. Acid-fast staining of sputum was also negative, indicating that pulmonary tuberculosis was preliminarily excluded. The erythrocyte sedimentation rate (32 mm/h) and procalcitonin (0.08 ng/mL) of the patient were negative. Serum 1,3-beta-D-glucan (G) assay, galactomannan antigen (GM) assay and filamentous fungus examination of bronchoalveolar lavage fluid (BALF) were performed. The G assay showed that serum 1,3-beta-D-glucan was 243.63 pg/mL (normal reference interval was 0-60 pg/mL), and the GM assay showed that galactomannan was 1.13 mug/L (normal reference interval was 0-0.5 mug/L), while BALF culture was negative. Echocardiography showed a 38.6x26.2x30.0 mm vegetation (white arrow) adhered to the right cardiac pacemaker and tiny mitral subvalvular vegetations, which aroused our concern (Figure 1). CT angiography showed pulmonary embolism, and laboratory examination showed coagulation dysfunction with abnormal elevation of prothrombin time (30.8 s), fibrinogen (4.33 g/L), D-dimer (3860 mug/L), and fibrin degradation product (13,000 mug/L). Doctors considered that pulmonary embolism was probably caused by the shedding of vegetation, so they performed pulmonary artery thrombectomy, removal of the cardiac pacemaker and implantation of a temporary pacemaker. Then, pathological examination and pathogenic examination of the cardiac tissues, cardiac pacemaker and vegetation were performed. According to the ultrasonic morphological characteristics of this vegetation accompanied by some tiny flocculent floaters and positive serological results, we suspected that it might be caused by filamentous fungal infection. Therefore, a resident physician used caspofungin as an empirical antifungal treatment, administering 70 mg on the first day and 50 mg once a day thereafter. Histopathological digital slices of the vegetations demonstrated multiple fibrinoid and hemorrhagic necrosis with extensive inflammatory infiltration, accompanied by hyaline sporophores and filamentous hyphae, 2-7 mum in diameter, dark in HE staining (Figure 2). Antler-like filamentous hyphae were stained by Gram staining of the vegetations (Figure 3A). Septate hyphae with branches at acute angles were shown in bright blue by fluorescence staining (Figure 3B). The colony cultured from vegetations was grayish-green and velutinous (Figure 3C). Lactophenol cotton blue staining showed that the top of the smooth conidia stalk expanded to form an inverted flask-shaped top cyst with a single-layer sterigma, and unstained conidia were spherical, forming a blue chrysanthemum (Figure 3D). A phylogram was constructed utilizing the ITS sequence of the isolated strain Aspergillus fumigatus ZJPPH1 along with 18 available sequences with the highest homology retrieved from GenBank by MEGA11 (Figure 3E). After confirming that the infection factor was Aspergillus fumigatus, we changed caspofungin to 0.2 g of voriconazole every 12 hours for anti-Aspergillus fumigatus infection treatment. However, on the second day, the patient had severe liver and kidney dysfunction with abnormal decreases in serum albumin (55.2 g/L), albumin (32.4 g/L), and cholinesterase (3824 U/L) and abnormal increases in glutamic pyruvic transaminase (3214 U/L), glutamic oxaloacetic transaminase (2199 U/L), glutamyl transpeptidase (214 U/L), lactate dehydrogenase (1259 U/L), total bilirubin (83.7 mumol/L), direct bilirubin (42.2 mumol/L), total bilirubin (41.5 mumol/L), creatinine (185.2 mumol/L) and urea (17.21 mmol/L). The liver and kidney function indices of the patient were normal and stable during treatment with caspofungin, so we reused caspofungin as the antifungal drug at 50 mg once a day and continued to use caspofungin for 42 consecutive days of continuous antifungal treatment. We performed a series of surgical interventions on the patient (we described the operation process in detail in the Supplementary Materials). G and GM assays were performed again, and the results showed that serum 1.3-beta-D-glucan (14.87 pg/mL) and galactomannan (0.79 mug/L) decreased significantly compared with the previous levels, which suggested that the anti-Aspergillus treatment was effective. The patient improved; his inflammatory markers, including WBCs (7.54x109 /L) and CRP (9.3 mg/L), returned to normal, and he was discharged. One year later, the patient had recovered well, with normal routine blood and inflammatory indicators. He underwent permanent pacemaker implantation and was discharged from the hospital. According to our latest follow-up, he had recovered well.

ae, aspergillus endocarditis, aspergillus fumigatus, culture, fever, vegetation

PMC518976_02

Female

At the time of diagnosis this patient was a 9 year-old female with a one year history of pain and swelling about her left knee. She had experienced a fall and related all symptoms to the fall. She was seen in her local emergency room by her family physician; there was no diagnosis or treatment. Approximately one month prior to her representation, she was struck in the left knee by a basketball and developed worsening pain. She was seen by an orthopedic surgeon (December 1999) and was noted to have a valgus posture of both lower extremities, exaggerated on the left by external rotation and she walked with a mild limp. The left knee had no effusion but was hypersensitive to light touch over the lateral aspect where there was soft tissue swelling just below the knee. There was no obvious mass in the area, although firm palpation was difficult because of patient discomfort. Plain films were normal and an MR was ordered that revealed an apparent meniscal cyst in the lateral aspect of the left knee [Figure 7]. Biopsy of the cystic structure was performed (November 1999) that revealed a high-grade synovial cell sarcoma. Metastatic work-up consisting of nuclear bone scan and CT of the chest were negative. Amputation was offered by the local care team that included a radiation oncologist because of their concern about possible contamination of the joint space and uncertain functional outcome. The patient was referred to St. Jude Children's Hospital for further evaluation and treatment. At the time of her evaluation after referral (January 2000), there was a well healed scar with no excessive swelling. There was mild tenderness on the lateral aspect of her left knee. Additional imaging studies showed abnormality at the site of prior surgery equivocal for residual tumor. There was no evidence of abnormality in the joint space. The tumor bed was explored. There was no physical evidence of compromise at the level of the joint space. She underwent wide local excision with placement of afterloading catheters. Six catheters were placed in a parallel array with 1 cm spacing. Radio-opaque clips were placed to delineate the tumor bed and assist in brachytherapy planning [Figure 8]. The margins of the resection were involved with tumor, as demonstrated by field biopsies and assessment of the margins of resection. Satellite tumor nodules were present in the resection specimen. Four days after surgery the six afterloading catheters were loaded with 82 seeds representing 302 mCi of I125 (Figure). The dwell time of the implant was 62 hours and the patient received a total implant dose of 2480 cGy delivered at 40 cGy/hr. Two weeks later the patient began external beam irradiation at 180 cGy/day and received a course of treatment and total external beam dose of 5040 cGy using 6 MV photons with treatment delivered with two beams using a CT based treatment plan [Figure 9]. Radiation therapy was completed in March 2000. The patient suffered moist desquamation corresponding to the radiation therapy portal that was predicted based on the treatment and the use of a tissue equivalent bolus material which was placed on the wound on alternating days during her course of external beam irradiation. She was able to return home on the last day of treatment. On routine follow-up, only 4 months after treatment, left leg appearing to be slightly longer than her right leg by less than 1 cm. No corresponding gait problems were reported. Nearly one year after treatment (January 2000) physical examination showed good range of motion at the left knee; however, there was significant valgus angulation. An MR study was reviewed by Orthopedic Surgery and was noted to show growth arrest laterally and predominantly involving the distal femoral physis [Figure 10]. Based on these findings, the family was informed that an epiphysiodesis of the distal femoral physis would likely be required to prevent additional deformity. Due to the angulatory deformity, an osteotomy of the distal femur would be required. Because of high-dose irradiation and concerns about bone healing, osteotomy and epiphysiodesis were deferred until the three year evaluation was performed. At that time, the patient had a significant valgus deformity. The morbidity of the deformity was such that ambulation was difficult. The patient underwent a closing wedge correcting osteotomy, which was fixed with a contour plate. The patient subsequently fractured the plate secondary to early and unprotected weightbearing (against medical advice). She was placed in a cast and ultimately healed her osteotomy. She continues to have a significant limb length discrepancy and will require future lengthening procedures. She remains without evidence of disease nearly 4 years after treatment.

PMC9733668_01

Female

The case is a 67-year-old female with hypertension, hyperlipidemia, and left breast cancer for which she underwent a mastectomy and adjuvant chemotherapy from 2016 to 2017. In July 2020, she was diagnosed with a second malignancy:locally advanced pancreatic head adenocarcinoma, received neoadjuvant chemotherapy from August 2020 to January 2021, surgical resection (total pancreatectomy, extended right hemicolectomy and portal vein resection) in May 2021, and adjuvant chemotherapy from 18 October 2021 to 31 October 2021. In December 2021, she attended a routine clinic review and was found to be significantly malnourished:she had extremely poor oral intake, wasting of muscle bulk, a body mass index of 18.9, and severe hypoalbuminemia (albumin 15 g/L; reference range 40-50 g/L). Her vital signs were stable:temperature of 36.2 degrees Celsius, blood pressure was 103/67 mmHg, heart rate of 91 beats per minute, and SpO2 96% on room air. She was admitted for inpatient enteral nutrition support. She remained well for a week before developing acute AMS. Clinical examination revealed a gradual decline of her Glasgow Coma Scale (GCS) from 15 to 11 over several days, but was otherwise unremarkable with no focal neurological deficits. An extensive biochemistry panel revealed hyperammonemia (with an initial ammonia level of 144 umol/L; reference range 16-53 umol/L), hypophosphatemia (0.57 mmol/L; reference range 0.94-1.50 mmol/L), and micronutrient (zinc, copper, selenium, vitamin A, vitamin D2, vitamin D3, vitamin E) deficiencies. There was suspicion of an acute coronary syndrome in view of new anterolateral ST segment elevations on her electrocardiogram and raised troponin levels, but this was ruled out with a negative coronary angiogram and attributed to stress cardiomyopathy with a depressed ejection fraction of 25%. Neuroimaging (computed tomography and magnetic resonance imaging of brain, magnetic resonance angiogram of brain) was normal. An electroencephalogram showed severe diffuse encephalopathy with generalized triphasic waves suggestive of metabolic encephalopathy. Basic microbiological investigations including aerobic and anaerobic blood cultures, she was initially managed for metabolic encephalopathy, likely contributed by constipation, hyperammonemia, electrolyte imbalance, and stress cardiomyopathy. Her mental status improved to normal with regular opening of bowels and electrolytes correction. However, her neurological status gradually deteriorated from a GCS of 15 to 3 over the next 2 weeks, associated with multiple episodes of hypoglycemia. There was no improvement to her mental status after correction of hypoglycemia. Thus, a repeat workup including neuroimaging, electroencephalogram and lumbar puncture was performed. A comprehensive panel of microbiological investigations---including aerobic and anaerobic bacterial blood cultures, fungal blood cultures, viral serology panel,1 sputum cultures, urine cultures, cerebrospinal fluid (CSF) cultures, CSF meningoencephalitis panel,2 tests for syphilis infection and tuberculosis infection:was also sent. The investigations were significant for hyperammonemia (234 umol/L), positive urine cultures for Escherichia coli, and positive sputum cultures for Klebsiella pneumoniae and Stenotrophomonas maltophilia. She was started on intravenous (IV) Meropenem and Minocycline to cover for these organisms, and concomitantly worked up for the underlying etiology of hyperammonemia. A liver duplex ultrasound revealed possible right portal vein thrombosis. Hence, she underwent a percutaneous transhepatic biliary drainage, portal vein angioplasty and stenting. Her ammonia levels improved transiently to 74 umol/L but rose back up again after several days post-procedure with no improvement in neurology. Her blood and endotracheal aspirates were sent for Ureaplasma and Mycoplasma cultures. She had earlier been commenced on a course of Minocycline (IV Minocycline 200 mg loading dose, followed by 100 mg every 12 h for a week) to cover for the Stenotrophomonas pulmonary infection, as well as for empirical coverage of possible Ureaplasma infection. The blood culture eventually returned positive for Ureaplasma urealyticum. By this time, she had completed a week of Minocycline, and was continued on another week of Azithromycin (Oral Azithromycin 500 mg once daily). A repeat Ureaplasma blood culture thereafter was negative. The patient had undergone chemotherapy with TS-One (Tegafur, Gemeracil, Oteracil) in October 2021. However, her medical oncologist felt that the time frame (TS-One was given more than 6 weeks before her presentation of hyperammonemia) was not compatible with TS-One as the cause of her current encephalopathy or hyperammonemia. Finally, a metabolic panel for urea cycle disorders was sent and returned negative. Simultaneously, supportive treatment was initiated to promote ammonia clearance with lactulose, rifaximin, sodium benzoate, and hemodialysis, as well as to reduce ammonia production through dietary protein restriction. Retrospectively, we found that her mentation improved most dramatically with a combination of: (1) lowering her ammonia levels with dialysis, (2) treatment of Ureaplasma infection with the appropriate anti-microbials, (3) treatment with high dose thiamine for presumed thiamine deficiency, and (4) nutritional replacement for micronutrient deficiencies. The final diagnosis was metabolic encephalopathy contributed by thiamine deficiency (causing a Wernicke-like state), exacerbated by hyperammonemia from Ureaplasma infection, and micronutrient deficiencies related to a post-pancreatectomy state. Subsequently, with the appropriate treatment and normalization of ammonia levels, she recovered to full neurology and was able to follow instructions. However, her protracted intensive care unit (ICU) stay was complicated by critical illness myopathy. She was discharged from ICU after 41 days but eventually succumbed to nosocomial infections and passed on day 83 of her hospital stay. Table 1 shows the timeline of events that occurred.

ureaplasma urealyticum, altered mental status (ams), cancer, chemotherapy, hyperammonemia, immunocompromised

PMC4746402_01

Male

A 53-year-old man had been experiencing obstructive jaundice and significant weight loss for 1 month. He had been healthy until the jaundice occurred and was not taking a medication on a regular basis. No history of parasitic infestation was noted. Physical examination revealed no obvious finding except for slightly icteric sclera. Abnormal indicators of initial laboratory tests included total bilirubin at 2.3 mg/dL (0.3-1.5), direct bilirubin at 1.6 mg/dL (0-0.5), aspartate aminotransferase (AST)/alanine aminotransferase (ALT) at 122/131 IU/L (<36 IU/L), alkaline phosphatase (ALP) at 464 IU/L (42-121), and CA19-9 at 838.6 (0-37) IU/L. The imaging, including ultrasound and magnetic resonance cholangiopancreatography (MRCP), demonstrated extensive intraductal tumors in the pancreas and biliary system, including the left hepatic duct, the anterior branch of right hepatic duct, the common bile duct down to the distal part, and the entire length of pancreatic duct (Figure 1). Neither lymph node nor distant organ metastasis was detected. Therefore, clinical staging was T2N0M0. Given the patient's preferences, good performance status, and limitation of disease in the bile duct and pancreas, we planned to perform surgery. The patient underwent right percutaneous transhepatic biliary drainage (PTBD) using an 8.5 Fr. self-retaining catheter. Ten days later, left portal vein embolization (PVE) was performed. A follow-up CT scan was conducted to assure adequacy of the liver remnant. One month later, the operation was carried out. Regarding intraoperative findings, apart from the lesions depicted on preoperative imaging, there was a 2 cm mass-forming lesion at segment 4 of the liver (Figure 2(a)). We decided to perform left trisectionectomy, pyloric-preserving pancreaticoduodenectomy, and total pancreatectomy (Figure 2(b)). The postoperative course was uneventful, except for diabetes mellitus requiring insulin administration. The surgical specimens consisted of the liver (segments 1-5 and 8), gallbladder, extrahepatic bile duct, duodenum, entire pancreas, and spleen. Examination of specimens disclosed numerous intraductal papillary lesions present almost throughout the entire specimen (Figure 3). The histopathology revealed intraductal papillary neoplasm with gastric phenotype of bile duct and pancreas (Figure 4). The IPNB was diffusely located in the dilated intrahepatic bile ducts of B2, B3, B4, and the extrahepatic bile duct, while the majority of the lesion was low-grade intraepithelium neoplasm (Figures 3(b) and 4(b)). High-grade lesions were noted on the left hepatic duct, medial segment duct, and B4 as well as the distal extrahepatic bile duct (Figure 3(b)). The invasive foci were found at B4 and distal bile duct (Figures 3(b) and 4(d)-4(f)), the invading tumor forming a 2 cm subcapsular mass at S4A (Figure 4(d)), and an infiltrative lesion located at the wall of the duodenum (Figures 4(e) and 4(f)), respectively. Metastasis was found in lymph node along common hepatic artery (station 8). In the pancreas, the main pancreatic duct was dilatation, pronounced mostly at the distal part. Low-grade intraepithelium neoplasm (IPMN) was presented in the pancreatic head as intraductal soft pink growths plus multiple indurated nodular lesions (Figures 3 and 4(c)). The epithelium of the distal duct was denuded and the pancreas parenchyma presented atrophic changes. No high-grade lesions or invasive foci were seen in the pancreas. The patient received Gemcitabine-Cisplatin chemotherapy due to lymph node involvement in the pathological result. A CT scan was performed 5 months after the operation, showing no tumor recurrence. After the 4th cycle of chemotherapy, the patient developed cholangitis and was admitted at a provincial hospital. During admission, a CT scan was performed revealing multiple peritoneal metastases. In addition to the advancement of the disease, the patient's performance status was also poor. Therefore, the patient received only supportive treatment and eventually passed away. The overall survival time after surgery was 8 months.

PMC10133556_01

Male

A 48-year-old male presented with a four-day history of acute onset progressive weakness of the lower limbs. The weakness started in the right lower limb and then progressed to involve the left lower limb leading to an inability to get out of the bed without support within 4 days of onset of symptoms. He also complained of sensory loss below the level of the upper abdomen with tingling and paresthesia in bilateral lower limbs. This was associated with a constant, deep-seated, ill-defined pain with dysthesias without any positional variation in the lower back and both lower limbs suggestive of a funicular pain. He also complained of urinary and stool retention. He had a history of fever with mild headache from 3 days prior to the onset of the weakness which persisted till admission (7 days). There were no significant past interventions, medical or family history. He belonged to the lower socio-economic strata and was a rickshaw puller by occupation. On examination, he was febrile and had a catheter in situ. He had hypotonia and motor weakness of lower limbs. The power was 2/5 in the right and 3/5 in the left lower limb, with absent deep tendon/superficial reflexes (anal/bulbo-cavernous) and mute plantar. He had brisk tendon reflexes in both the upper limbs. There was also complete loss of pain and temperature sensation below the T6 level. The sensorium, cognition, optic disc, cranial nerves, cerebellar system, and power in upper limbs were normal on examination. With this history and examination, the possibility of an acute transverse myelitis was considered. The routine investigations including blood and urine cultures were negative. The contrast enhanced magnetic resonance imaging (CEMRI) of cervical-dorso-lumbar spine showed a T2W/STIR hyperintensity in the spinal cord extending from C7 to D11 vertebral level with partial enhancement, suggestive of a longitudinal extensive transverse myelitis (LETM). The CEMRI brain showed multiple T2W/FLAIR hyperintense lesions in the left frontal, right parietal and left temporal, periventricular white matter, pons, medulla and bilateral cerebellar lobes without any diffusion restriction or post contrast enhancement (Figure 1). Contrast enhanced MRI orbit did not reveal any significant abnormality. With these imaging findings, the diagnosis was revised to an encephalomyelitis. Infective, inflammatory, and demyelinating causes for LETM were investigated. Serum Antinuclear Antibody [ANA], Anti-Neutrophil Cytoplasmic Antibodies [ANCA] and Serum Neuromyelitis optica [NMO], Myelin oligodendrocyte glycoprotein [MOG] antibodies were negative. ELISA for serum viral markers of Hepatitis B, Hepatitis C and HIV were also negative. Serum Acetylcholinesterase (ACE) was normal [40 U/L]. Pathergy test was negative. Contrast enhanced computer tomography of chest and abdomen (CECT) did not reveal any abnormality. Visual evoked potential (VEP) showed bilateral normal P100 latency. The CSF examination showed decreased glucose, i.e., 67 mg/dl against the corresponding random blood sugar of 152 mg/dl and increased protein of 133 mg/dl with a cell count of 70 cells/mm3 (i.e., lymphocytes-56 cells/mm3, neutrophils-14 cells/mm3). No atypical cells were found. CSF gram stain, Ziehl-Neelsen [ZN] stain, India ink and CSF cultures were non-contributory. CSF neuroviral panel (Measles, Mumps, Epstein Barr, Parvo B19, Enterovirus, Varicella zoster, West Nile, Herpes simplex viruses) was also negative. CSF Cartridge based Nucleic Acid Amplification Test [CBNAAT] for Tuberculosis and Venereal Disease Research Laboratory [VDRL] was negative. However, CSF antigen was positive for Cryptococcus neoformans (CRAG) by lateral flow assay. Hence, a diagnosis of cryptococcal encephalomyelitis presenting as a LETM was made based on the clinical presentation and investigations. As the patient was immunocompetent and did not have any occupational exposure, detailed evaluation for any presence of cryptococcus in lungs/sinuses and CD4 counts for immunodeficiency were done but were found to be normal. The clinical team started the patient on 4 weeks of induction therapy with intravenous liposomal amphotericin B at 5 mg/kg [250 mg] every 24 h and oral fluconazole 200 mg every 8 hourly. After 3 weeks of antifungal therapy his motor power improved to 4/5 and 5/5 in the right and left lower limbs, respectively. His bladder and bowel symptoms resolved completely. His sensory loss resolved, although he had occasional paresthesia. He was discharged in a stable condition with an advice to continue oral fluconazole 400 mg/day for 12 months. The patient is in follow up, he had no side effects, tolerated the medicines and on subsequent examination has now regained full functional capacity. The follow up imaging done after 6 months showed near complete resolution of lesions (Figures 2, 3).

letm, cryptococcal antigen, cryptococcus, immunocompetent adult, longitudinally extensive transverse myelitis

PMC4284005_01

Female

Table 1 shows the age distribution of the sports injuries. The proportion of sports injuries in the 10-19-year-old age group was the greatest, followed by the 20-29-year-old and the 30-39-year-old age groups. The proportion of cases in the 10-19-year-old age group was significantly higher among females than among males (61.5% vs 49.9%), while that in the 30-39-year-old age group was significantly higher among males than among females (7.1% vs 2.5%). Table 2 shows the common injury sites in basketball players. The most common injury site was the knee (male: 41.7%, female: 50.4%), followed by the foot and ankle (male: 24.8%, female: 23.8%), lower back (male: 11.8%, female: 11.4%), and upper extremity (male: 9.7%, female: 5.1%). There was a higher proportion of females than males presenting with a knee injury, and there was a higher proportion of males than females presenting with upper extremity injuries.

osgood–schlatter disease, anterior cruciate ligament injury, basketball, sex, sports injury

PMC9215351_01

Male

A 65-year-old immunocompetent man presented to our hospital with an 11-year history of a huge erythematous erosive plaque on his neck. The lesions developed from a pigeon's egg-sized nodule 11 years ago. Physical examination showed a reddish nodular plaque with superficial erosions, tough textures, well-defined borders on his neck in a size of 18 x 10 cm and verrucous proliferating nodules behind his left ear with no abnormalities on neurological examination (Figure 1). Apple jelly nodules were seen on diascopy. He was previously healthy and had no fever, dry cough, fatigue, or other complaints. He denied any history of contact with tuberculosis patients. Initially, sarcoidosis was diagnosed based on biopsies of skin lesions or lymph nodes and he was treated with prednisone acetate and azathioprine over 10 years. However, the skin lesions are still gradually expanding. Laboratory examinations including syphilis, human immunodeficiency virus tests, peripheral blood lymphocytes count, microscopic examination of Mycobacterium leprae, IgM and IgG levels against NDO-LID as well as MMP-II for leprosy, acid-fast staining of sputum smear and anti- Mycobacterium tuberculosis antibodies showed negative results. The measurement of enzyme-linked immunospot assay for tuberculosis (T-SPOT.TB) and leprosy were also negative. A computed tomographic (CT) scan revealed multiple enlarged lymph nodes in bilateral neck, submandibular and mediastinum. Histopathological examination of the lesion on the neck showed necrosis and epithelioid-cell granuloma (Figure 2A) in the dermis, which infiltrates lymphocytes, epithelioid cells and Langhans giant cells (Figure 2B) and negative findings of periodic acid-Schiff, silver and Ziehl-Neelsen stains. Single polymerase chain reaction (PCR) tests for rpoB and hsp65 genes of the skin lesions did not identify Mycobacterium tuberculosis until nested PCR for the same genes were performed. Tissue cultures from the lesions grew caseous yellow colonies at 37 C in Lowenstein-Jensen medium after 40 days. The isolate's 16S ribosomal RNA and hsp65 gene sequence were 100% homologous to Mycobacterium tuberculosis strain FDAARGOS_756. The patient was eventually diagnosed with lupus vulgaris. Resistance testing showed that the pathogen was sensitive to isoniazid, rifampicin, ethambutol, streptomycin and pyrazinamide. The patient received the antituberculosis regimen including rifampin, isoniazid, ethambutol, pyrazinamide for two months followed by isoniazid and rifampicin for 4 months (2HRZE/4HR). After six months of follow-up, the lesions were almost completely cleared, leaving residual scar and hyperpigmentation (Figure 3) and the enlarged lymph nodes were smaller than before on CT scan with no adverse effects during treatment.

t-spottb, cutaneous tuberculosis, diagnosis, lupus vulgaris

PMC7701897_01

Male

A 10-year-old male with no past medical nor family history presented with a one-year history of progressive pain, swelling, and reduced range of motion of the left shoulder. Initially, patient started complaining of intermittent shoulder pain with an 8/10 intensity, more prominently at night without preceding trauma nor weight changes. Patient was referred to our pediatric upper extremity clinic after an interventional radiologist performed a percutaneous biopsy that revealed GCTB. During the physical examination, patient was anxious with left shoulder guarding. The left proximal humerus had a diffuse hard consistency mass with warmth, tenderness, visible vascularity and painful range of motion. Distal pulsation (+2) was palpable with adequate capillary refill. Neurological status was intact with an adequate gross sensation and two-point discrimination, and no paresthesia. Preoperative radiographs showed an expansive lytic lesion at the left proximal humerus without any "soap bubble" appearance nor any visible fracture or dislocation. See Fig. 1. A magnetic resonance image (MRI) showed a primary heterogenous lesion surrounding the epiphyseal area of the lateral proximal humerus; with a minor involvement of periarticular subchondral bone, and displacement of the adjacent tendon and muscles. See Fig. 2. Chest radiographs and computerized tomography (CT) scan did not presented any evidence of pulmonary metastasis. Based on the previous biopsy and imaging, surgery was schedule for tumor resection by a pediatric upper extremity orthopaedic surgeon with more than 10 years of experience. At surgery, a deltopectoral approach was used to demarcate the tumor. A synovectomy and interval split lateral to bicep tendon was performed to access the greater tuberosity. A friable grayish tissue in the periarticular area of subacromial and subdeltoid bursa was seen with intact cortical bone of greater tuberosity. Limited to no extension to metaphyseal was seen with intact subchondral bone at periarticular humeral head. Extensive curettage and bone saucerization of atypical tissue was performed with augmentation therapy of phenol through the bone window. See Fig. 3. Shoulder reconstruction was deferred as the joint appeared to be stable intraoperatively. Proximal humerus cavity was then filled with four milliliters of cement. Wound was closed in layers without complication. See Fig. 4. Finally, the shoulder was immobilized with a Velpeau Arm sling. Histopathological examination showed a red to brown, soft friable tissue (measuring 3.0 x 0.4 x 0.2 cm) with hemosiderin laden mononuclear cells; confirming the diagnosis of GCTB. During the two-week postoperative visit at the outpatient pediatric orthopaedic clinics, patient started on rehabilitation therapy with active-assisted mobilization. Lastly, the six-month follow up evaluation showed that the patient had no guarding and reported significant pain improvement. Despite a limited improvement of active ROM, full passive ROM was preserved. Follow up radiographs showed filled cavity of epiphysis and subchondral bone of articular humeral head without evidence of recurrence. Patient is currently evaluated every 6 months for recurrence or metastasis of GCTB. See Fig. 5. This manuscript was structured according to the Updating Consensus Surgical Case Report (SCARE) Guidelines.

epiphysial plate, giant cell tumor of bone, growth plate, proximal humerus, skeletally immature

PMC10436479_01

Male

We aim to follow the CARE guidelines for cases reports. A 34-year-old man was admitted to the hospital with chest tightness and a cough that had been present for 6 days. He described having dyspnea that was gradually worsening. His other complaints included bloating, acid reflux, and heartburn. His blood pressure was 139/97 mm Hg, his heart rate was 85 beats/min, and his oxygen saturation was 98% with supplemental oxygen. His Holter monitoring showed sporadic atrial premature beats, sustained ST-T changes, and an abnormal Q wave of the posterior wall. Laboratory investigations demonstrated an elevated white blood cell count of 13.90 x 109/L, a D-dimer level of 5100 ng/mL, and an N-telencephalon sodium peptide precursor (B-type natriuretic peptide) level of 843.20 pg/mL; however, the level of troponin-T was normal. The patient's medical history and physical examination showed no significant abnormalities. An echocardiogram revealed a substantial amount of pericardial effusion and a 7.9 x 2.3 cm2 heterogeneous hypoechoic mass located in the left visceral pericardium. The mass was found to have a broad base and to be adjacent to the left ventricle and atrium ( Figure 1A ). CMRI and CT examinations were requested for the further diagnosis and assessment of the relationship between the tumor and its adjacent structures. Both of these imaging studies noted a large mass situated superior and inferior to the left side of the heart and adhering to the left ventricular free wall. The tumor completely covered the left atrium, superiorly extended between the ascending aorta and the superior vena cava, and partly encased the pulmonary artery trunk and the left pulmonary artery. In addition, CMRI showed that the irregular soft-tissue mass was asymmetrically hypointense on T1-weighted images and heterogeneously hyperintense on T2-weighted images and fat suppression images ( Figures 1B-F ). The first-pass perfusion images showed that there was no enhancement during the early phase; however, during the balance phase, the lesion appeared slight enhancement. Delayed enhancement images showed that part of the tumor presented mild to moderate patchy enhancement ( Figures 1G-I ). There were large pericardial effusions and bilateral pleural effusions, primarily on the right side. The CT imaging showed that the pericardium was invaded by a cystic solid lesion, and it presented local, unevenly thickened, and nodular changes. After the injection of contrast medium, the solid composition and septa of the tumor were slightly enhanced ( Figure 2 ). CT scans of the head, chest, abdomen, and pelvis were negative, with no evidence of metastasis. Pericardial drainage under ultrasound guidance was performed before CT examination to relieve the patient's chest tightness symptoms, and examination of the bloody pericardial fluid found a few short spindle-shaped cells with dyskaryosis. The patient subsequently underwent a CT guided percutaneous needle puncture biopsy in the CT room. Histopathological examination of the tissue samples showed spindle cell tumors with a typical structure of hematoxylin-eosin staining arranged in vague fascicles or sheets, which was most compatible with a diagnosis of monophasic SS ( Figures 3A, B ). Immune and molecular pathology results were as follows: AE1/AE3(CK) (individual +), EMA (+), Nestin (+), SMA (weak +), CD 34 (-); CD56(56C04)*(+), SYN (-), INI-1*(+), and CD99 (+). Fluorescence in situ hybridization (FISH) testing was positive as an SS18 (SYT) break-apart probe found that the SS18 gene was broken, thereby further supporting the diagnosis of PSS ( Figure 3C ). Given that the tumor has invaded the major vascular structures and could not be completely excised, the patient was not considered for surgical treatment. He elected to receive a doxorubicin-ifosfamide chemotherapy regimen in the oncology department. After six cycles of chemotherapy, the tumor had significantly shrunk, which was very well observed via CT imaging ( Figure 4A ). The patient then received one radiation treatment and was discharged home. Four months later, the patient came to the hospital for follow-up examination. CT images showed tumor relapse in the contralateral pericardial cavity. The tumor was located adjacent to the right atrium and the right ventricular junction, but there were no signs of recurrence at the site where the primary tumor had been located ( Figure 4B ). The patient underwent eight cycles of gemcitabine-based combination chemotherapy with acceptable tolerance. There was a slight reduction in tumor size ( Figure 4C ), but the second round of chemotherapy did not seem to be as effective as the first, possibly due to the change in the chemotherapy regimen. Unfortunately, the patient died 17 months after receiving his diagnosis and initiating chemotherapy.

cardiac magnetic resonance imaging, computed tomography, echocardiogram, multimodal imaging, pericardial synovial sarcoma

(B) Enhanced CT image of the coronal reconstruction showing the tumor circumscribing the ascending aorta, the superior vena cava, and the pulmonary artery.

PMC6029463_01

Male

This case describes a 23-year-old male who was struck by a motor vehicle. Upon arrival at our hospital, the patient had a GCS of 8. FAST exam, chest radiograph, and computed topography (CT) of the head and cervical spine were obtained and were negative. Exam of the lower extremities revealed abrasions over the left knee and tenderness over the lateral joint line with an effusion. The right knee was diffusely tender to palpation without effusion. The patient had palpable pulses in both feet with well-perfused extremities. Ankle brachial indices were performed and found to be >0.9. He demonstrated guarding and pain with the attempted Lachman maneuver of the left knee and slight opening of the left knee joint with varus stress. Radiographs were obtained and revealed a left knee Segond fracture (Figure 1). Magnetic resonance imaging (MRI) of both knees was performed to evaluate for ligamentous injury. Left knee imaging demonstrated the Segond fracture along with a grade III lateral collateral ligament (LCL) tear with retraction (Figure 2), a grade II tear of the popliteus tendon and anterior cruciate ligament (ACL) (Figure 3), and a grade I medial collateral ligament (MCL) injury (Figure 4), as well as partial thickness tears of the biceps femoris and vastus medialis. Right knee imaging revealed a grade III tear of the ACL and MCL (Figure 5), grade II tears of the posterior cruciate ligament (PCL) (Figure 6), LCL, and popliteus tendon, and a medial meniscus tear. The patient was placed in bilateral hinged braces with the left knee unlocked and the right knee in locked extension to aid with transfers from a bed to a wheelchair. The patient was also given a left foot drop boot for a foot drop discovered during a secondary exam. On hospital day three, the patient was discharged home. Nine days after the accident, the patient presented to the clinic. He noted that the left-sided foot drop was improving. On that side, he had 5/5 strength of his extensor hallucis longus and tibialis anterior (TA), without any sensory deficits in the peroneal nerve distributions. On the physical exam of the left knee, the Lachman maneuver was grade 2B (ACL injury with 5-10 mm translation without an endpoint), the varus stress test grade 3 (complete LCL tear with >10 mm opening of the lateral joint), and the valgus stress test grade 2 (MCL injury with 6-10 mm opening of the medial joint). The right lower extremity was also neurovascularly intact, and the right knee exam revealed a grade 2A Lachman maneuver (ACL injury with 5-10 mm translation and a firm endpoint), a grade 3 posterior drawer test (complete tear of PCL with >10 mm posterior tibial translation), and a grade 3 valgus stress test (MCL injury with 11-15 mm opening of the medial joint), with a presumptive positive dial maneuver on the right side at 30 and 90 degrees (consistent with PCL and posterolateral corner (PLC) injury). However, given that the patient had bilateral PLC injuries, this physical exam finding was somewhat subjective without a reference point on the contralateral side. Subtle gapping with varus stress was also documented. Multiligamentous reconstructions of both knees were recommended (Table 1). The left knee was addressed first in order to explore and decompress the common peroneal nerve. In regard to the right knee, preoperative physical therapy was performed to restore range of motion (ROM) before undergoing surgery. Intraoperative findings of the left knee included a positive lateral gutter drive-through sign indicative of a PLC injury. The LCL was avulsed off the fibula, and the anterior lateral ligament (ALL) was also avulsed off the tibia. A greater than 50% disruption of the ACL was observed. Exam under anesthesia demonstrated a grade 2A Lachman maneuver, a grade 2 pivot shift, grade 3 varus instability, and instability on external rotation. The procedure included ACL reconstruction with a hamstring autograft augmented with an allograft, PLC reconstruction utilizing a TA allograft, and repair of the native avulsed LCL and ALL with suture anchors (Figure 7). First, the hamstrings were harvested and augmented with an allograft, and the tunnels for the ACL reconstruction were drilled. The PLC was then reconstructed using the anatomic technique described by Malanga et al.. The native LCL was repaired using suture anchors with the overlying allograft reconstruction used to supplement it. The posterolateral capsule was then reefed into the LCL allograft reconstruction. Finally, the ACL graft was passed and fixed. Postoperatively, the patient was placed in a hinged brace locked in extension and was made toe-touch weight bearing. The decision was made to proceed with the right knee reconstruction one week later. Exam under anesthesia revealed a grade 2A Lachman maneuver, grade 3 posterior drawer test, a grade 3 varus stress test, and a grade 2 valgus stress test. Surgery included ACL reconstruction with a bone-tendon-bone (BTB) autograft, PCL reconstruction with an Achilles allograft, MCL primary repair with additional Achilles allograft reconstruction, PLC reconstruction with TA allograft, and repair of the posterior horn of the medial meniscus (Figure 8). The lateral exposure for the PLC reconstruction was performed first, and the blind-ended sockets and fibular tunnel were drilled. An open approach to the MCL was then performed, and the injured MCL was found and tagged for later repair. The BTB autograft was then harvested for the ACL reconstruction. At this point, the posterior horn of the medial meniscus was confirmed to be torn from its root so this was repaired using sutures passed through a tibial tunnel. Guide pins were then passed for the ACL and PCL tunnels to ensure there was no convergence. Both tunnels were then reamed and the grafts passed. The PCL was fixed first while the leg was flexed, and the ACL was then fixed with the leg in extension. The MCL repair and reconstruction with an allograft were completed using the surgical technique described by Sekiya et al., followed by the PLC reconstruction which was carried out utilizing the same method noted previously. Postoperative immobilization and weight bearing status were the same as those in the contralateral side. Range of motion and physical therapy rehabilitation began at 1 week postoperatively. Early exercises included isometric activities to strengthen the quadriceps and patella mobilization exercises. Both knees were kept in a brace locked in extension with minimal weight bearing the first six weeks following surgery. Six weeks after the initial reconstruction, the patient was instructed to begin weight bearing with crutch assistance, starting in extension and then unlocking the straight leg brace to 90 of flexion. At eight weeks post-op, the patient was transitioned out of knee braces and then given clearance to return to work ten weeks after surgery. At six months post-op, the patient completed physical therapy. On the physical exam, the patient's knees demonstrated full ROM bilaterally with a grade 1A Lachman maneuver in both knees. The right knee also had a grade 2A posterior drawer test without sag. At that time, clearance was given to begin straight running. At one year post-op, the patient had returned to jogging and playing basketball recreationally and was able to participate in strenuous work (Table 2, Figure 9).

PMC7493040_01

Female

A 38 years old lady, smoker, with no significant medical or surgical history presented to our emergency department for epigastric pain associated with postprandial nausea and vomiting occurring for ten days. The patient declares that she had started losing weight forty-five days prior to presentation (around 10 Kgs). This was associated with a decreased appetite. Review of system otherwise was negative. On physical examination, her vital signs were within the normal range. Abdominal examination was unremarkable, and no abnormal findings were noted except for a yellow-white tongue. An Esophagogastroduodenoscopy was done and showed a stenosing tumor of the antrum infiltrating the distal two-third of the stomach with a malignant appearance. Despite difficulty crossing the tumor, duodenal examination showed no abnormalities. Biopsies were taken and revealed helicobacter pylori gastritis with the absence of malignant cells. The patient was on started on antibiotics and proton pump inhibitors (PPIs) for helicobacter pylori. Still suspecting malignancy, an enhanced abdominal and pelvic CT scan was done and showed gastric parietal thickening. No parietal pneumatosis, no infiltration of peri-gastric fat, and no pneumoperitoneum and intraperitoneal fluids were seen (Fig. 1). Purified protein derivative (PPD) skin test was done to rule out primary gastric tuberculosis and was negative. An oral contrast barium study was then ordered and it showed a fixed and constant narrowing on several radiographs at the level of antrum-pylorus, associated with rigidity of the gastric wall extending over the distal half. These findings raised suspicion of gastric malignancy, specifically Linitis Plastica (Fig. 2). Supportive treatment was continued, with nasogastric tube decompression and parenteral feeding, however, the patient's condition failed to improve. Ten days after admission, and due to high suspicion of malignancy and absence of a definite diagnosis, surgical biopsy by laparotomy was planned. During surgery, the stenosis at the level of antrum was palpable and had circumferential rigidity infiltrating the lesser curvature upward till 3 cm distal to the cardia. No perigastric infiltrates, adhesions or invasion were noted. A biopsy was taken to rule out lymphoma and a feeding jejunostomy was created by the primary surgeon. The anatomopathological report was identical to the prior biopsies, showing chronic ulcerative changes associated with chronic gastritis lesions and no signs of malignancy. Post-operative supportive treatment continued without any improvement in obstructive symptoms. Follow up oral contrast studies on postoperative days six and thirteen showed the same findings without any improvement in the stenosis (Fig. 3). On the fourteenth postoperative day (24th day after admission), and due to failure of medical treatment and absence of a definite diagnosis, the final decision to perform distal gastrectomy was taken. Intraoperatively, an extemporaneous examination of the resection edges was exempt from malignant cells. Reestablishment of digestive continuity was done using a Billroth II anastomosis. The final pathology report was of a chronic antral peptic ulcer, associated with peri-ulcerous chronic gastritis. Foreign body granulomas were also seen in the specimen. Again no malignant cells were identified. The patient recovered quickly postoperatively and was discharged home a few days later without complications. The true etiology that caused her condition was never found during her hospital stay. One month later, we received a phone call from the patient's spouse informing us that his wife was severely anxious and threatened that she will repeat what failed to kill her the first time. She subsequently confessed that she had attempted suicide by ingesting bleach right before she developed GOO. She had decided to keep the incidence a secret throughout her stay, even when invasive surgery was planned. This was the true etiology behind the presentation.

acute gastric stenosis, case report, corrosive agents, gastritis, linitis plastica, suicide attempt

PMC6739741_01

Female

An intact female 8-week-old domestic shorthair cat was taken into a foster/rescue home and cohabited a house with approximately nine other cats. The facility had a periodic history of FIP cases, including two deaths in the previous 4 months. The cat was co-housed in a large open sunroom containing seven litterboxes, which were cleaned once daily. The diet consisted of commercially available dry and canned food, which was separately offered in individual dishes. The cat was not rabies vaccinated, but had obtained two feline viral rhinotracheitis, calicivirus and panleukopenia vaccinations. At 14 weeks of age, the cat was presented to a general practitioner for evaluation of poor weight gain, soft stool and upper respiratory tract infection. The cat was underconditioned and weighed 2.5 lb (1.1 kg), with a body condition score (BCS) of 2/5, despite being active, alert and having a good appetite. Conjunctivitis and a yellow mucopurulent discharge from the nares were noted, and the cat had a fever of 102.6 F (39.2 C). A fecal flotation was performed owing to the soft but formed stool, and no ova or parasites were detected. A complete blood count (CBC) and chemistry profile were performed (Tables 1 and 2). The chemistry profile showed marked elevations in alkaline phosphatase, alanine transferase and phosphorus levels. A decrease in creatinine and albumin was also noted (Table 1), along with mild anemia and monocytosis. Amoxicillin clavulanic acid (Clavamox drops; Zoetis) 62.5 mg/ml was dispensed and administered at 15.6 mg (12 mg/kg) PO q12h for 10 days. Blood parameters were re-evaluated at 20 weeks of age using a less defined panel and values were within the normal range (Table 1). At approximately 6 months of age, the cat returned to the general practitioner for evaluation of pelvic limb gait abnormalities that had progressed over the previous 2 weeks. Examination revealed symmetric pulses in both hindlimbs and the presence of a pain response; however, less of a response was noted on the right side. Paresis was observed in the right hindlimb. When the forelimbs were lifted, the cat was able to walk minimally on the hindlimbs. The cat had severe non-ambulatory paraparesis, with more severe deficits on the right side. No information about spinal reflexes was available. A CBC and chemistry panel were performed (Tables 1 and 2). The chemistry panel revealed hypoalbuminemia, a decrease in the albumin:globulin (A:G) ratio, low creatinine values and hyperphosphatemia. The CBC revealed a slight anemia, monocytosis and thrombocytopenia. Platelet clumping was noted upon microscopic evaluation. Meloxicam (Metacam oral suspension) was dispensed and a single 0.2 mg dose was administered orally. At 8 months of age, the cat was returned to the general practitioner due to progression of the paraparesis. The client noted further deterioration of the pelvic limb paresis, and now identified 'stiffness' in the thoracic limbs. There was no information about the pelvic limb reflexes; however, the cat had started to have occasional urinary and fecal incontinence. Appetite seemed normal; however, the cat remained thin. Physical examination revealed a temperature of 101.5 F (38.6 C), heart rate of 170 beats per min and respiratory rate of 30 breaths per min. BCS was 3/9; however, the weight was not noted. Abdominal palpation revealed a large, easily expressible urinary bladder. Neurologic examination findings revealed normal mentation with no involuntary movements such as tremors. The cat was still very ataxic and ambulatory but now tetraparetic, which was much worse in the pelvic limbs. There was no information about cranial nerve abnormalities, and the eyes and retinas were within normal limits. From a video provided by the owner (see supplementary material), tail paresis was identified. The lesion was considered to affect the CNS and was localized as multifocal. A fecal flotation and direct smear were evaluated, with no ova or parasites seen. Cryptococcus and Toxoplasma antibody titers were performed and were negative. The tetra-ataxia and paresis significantly worsened over the next few months. Additionally, the cat now had titubation, tail plegia (see video in the supplementary material) and consistent urinary and fecal incontinence. Owing to the grave prognosis, the client elected humane euthanasia, at which time the cat was 10 months (40 weeks) of age. A necropsy was performed at the Animal Health Diagnostic Center, Cornell University College of Veterinary Medicine, and this revealed no significant gross abnormalities outside of mild mesenteric lymphadenomegaly. Representative sections of all organs, including the entire brain and spinal cord, were fixed in 10% neutral buffered formalin from which sections were cut, stained with hematoxylin and eosin, and analyzed via light microscopy. Immunohistochemistry for FCoV was carried out using monoclonal antibody FIPV3-70 (1:1000), AP-Anti-Mouse IgG and Bond Polymer Refine Red Detection (Leica Microsystems). Histologic examination revealed lesions typical of FCoV infection within the CNS. In the spinal cord, the leptomeninges were diffusely expanded by moderate numbers of predominantly plasma cells, admixed with fewer lymphocytes and macrophages, and surrounded by a moderate amount of edema. The underlying white matter was multifocally vacuolated with numerous dilated myelin sheaths, digestion chambers and rare spheroids (Figure 1a). At the level of the lateral aperture, the choroid plexus was expanded by large numbers of plasma cells, lymphocytes and macrophages (Figure 1b). The ependyma lining the ventricular system was effaced by a similar inflammatory population, admixed with fibrin, edema and was also forming thick perivascular cuffs often disrupting the sub-ependymal parenchyma (Figure 1c). Immunohistochemistry revealed strong intracytoplasmic immunoreactivity within macrophages associated with the inflammation (Figure 1d). No FIP-associated lesions were present in other organs. Non-FCoV comorbid histologic findings were chronic enteritis with mid-mucosal fibrosis and mesenteric lymphoid hyperplasia. Molecular analysis of the viral spike protein was performed at several time points during the study. Fecal samples were collected at 5 months of age (feces #1) and at 8 months of age (feces #2). Following euthanasia (at 10 months of age) tissue samples were collected, along with a fecal sample (feces #3). A central 156 base pair region of the spike protein gene, including the critical S1/S2 activation site of the virus, was PCR amplified and sequenced as described in Licitra et al, with the following modifications: 25 mul reverse transcription PCRs were performed with qScript XLT 1-Step RT PCR kit (Quantbio). PCR conditions were 20 mins at 50 C, 3 mins at 95 C and 40 cycles of 10 s at 95 C, 20 s at 55 C, 40 s at 72 C, then 10 mins at 72 C. PCR products were purified using Diffinity RapidTips (Diffinity Genomics). PCR and sequencing showed the presence of a type I FCoV, based on a sequence alignment with reference genomes. The sequence information obtained from this cat is shown in Figure 2. The viral sequences from the CNS (brain and spinal cord) contained specific amino acid changes compared with other samples (feces, small intestine, mesenteric lymph node and kidney). The most notable change was an arginine to methionine (R-M) substitution at the critical P1 activation position, corresponding to residue 793. Other changes that correlated with viruses present in the CNS were present in two other positions: 770 alanine to valine (A-V); and 786 threonine to alanine (T-A).

feline infectious peritonitis, feline coronavirus, meningoencephalomyelitis, neurologic, spike protein

PMC9379344_01

Male

A 70-year-old man presented to our emergency hospital with dry cough and shortness of breath. He experienced gradual worsening of his symptoms for 10 days since their initiation. On physical examination, the patient's oxygen saturation was 95%. Computed tomography (CT) of the chest revealed bilateral and peripheral ground-glass opacities. The polymerase chain reaction (PCR) for SARS-CoV-2 sampling from his nasopharyngeal swab was positive. He was admitted to the intensive care unit for COVID-19 and was administered oxygen, methylprednisolone, remdesivir, and tocilizumab for 4 days, 5 days, 3 days, and 1 day, respectively, which improved his dyspnea and chest CT findings (Figure 1). His medical history included diabetes mellitus and hypertension. Approximately 1 month before admission, he had experienced paroxysmal chest pain. It was transient; therefore, he did not go to the hospital. On the day of admission, an electrocardiogram demonstrated an inverted T wave in V1-3 and non-specific ST-segment depression. Serum levels of troponin I and creatine kinase MB were elevated, suggesting acute coronary syndrome (ACS). These levels decreased in 1 day. Cardiac echocardiography revealed no wall motion abnormalities and a normal ejection fraction. Although the patient complained of no chest symptoms after admission, ACS was suspected. Therefore, the patient was administered nitrates with continuous treatment for his respiratory symptoms, waiting for further cardiac investigation. The PCR test result of his nasopharyngeal swab 9 days after admission was negative. He underwent coronary angiography 14 days after admission. Coronary angiogram demonstrated three-vessel disease of the left main trunk, which required coronary artery bypass grafting (CABG) (Figure 1). Coronary artery bypass grafting was scheduled using an off-pump procedure, 37 days after admission. The patient was confirmed to have a negative PCR test result with his nasopharyngeal swab 5 days before off-pump coronary artery bypass grafting (OPCAB). One hour before entering the operating room, intra-aortic balloon pump (IABP) was inserted through the femoral artery under local anesthesia. Residual blood at the time of IABP insertion was preserved for analysis. During the OPCAB procedure, the saphenous vein was harvested for grafting, and residual tissues after anastomosis were preserved for analysis. Surgery was performed uneventfully. He was transferred to the postoperative intensive care unit, intubated, and sedated. Suctioning from the endotracheal tube was performed to remove the secretions during intubation. The secretion was used for PCR testing for SARS-CoV-2. The result of the PCR test was positive. The patient was discharged on the 12th day following the surgery without any complications (Figure 1). At present, the patient is in good physical condition and did not present with cardiovascular complications as well as post-COVID-19 syndrome, 18 months after OPCAB. Total RNA was extracted from the saphenous vein using Isogen (Nippon Gene, Japan), according to the manufacturer's instructions. Reverse transcription of one microgram of RNA was performed using RiverTraAce (Toyobo, Japan) in the presence of random hexamers and oligo(dT). To investigate virus replication, quantitative PCR was performed using the Power SYBR Green RT-PCR master mix (Applied bioystems, United States) in the presence of a nucleocapsid phosphoprotein gene-specific primer set designed by the National Institute of Infectious Diseases, Japan. The primer sequences synthesized in the 5'-to-3' direction were CACATTGGCACCCGCAATC as the forward primer (N_Sarbeco_F1) and GAGGAACGAGAAGAGGCTTG as the reverse primer (N_Sarbeco_R1). The amplification plot is shown in Figure 2. Redundant tissue from the saphenous vein was fixed with 4% para-formaldehyde (pH 7.0). The fixed tissue was soaked in 30% sucrose (wt/vol) in Tris-buffered saline containing 0.1% tween-20 (TBS-T) and cryosectioned. Tissue sections were incubated with a primary antibody, a 1:100 diluted mouse anti-spike antibody (GeneTex, Irvine, CA, United States 6H3) or a 1:100 diluted mouse anti-nucleocapsid antibody (GeneTex, Irvine, CA, United States 1A9) at 4 C overnight. The sections were washed with TBS-T four times prior to being incubated with the secondary antibody, 1:200 diluted donkey Alexa Fluor 488 anti-mouse IgG (H + L) (Thermo Fisher Scientific, Waltham, MA, United States A21202), at room temperature for 30 min. After nuclear staining with DAPI (Thermo Fisher Scientific, Waltham, MA, United States) was performed, fluorescence signals were observed using fluorescence microscopy (Eclipse Ti2; NIKON, Tokyo, Japan). Immunohistochemistry revealed small clusters of antigen-positive speckles distinguished by autofluorescence (Figures 3A,B). The saphenous vein was fixed with the Karnovsky's formulation of 2% para-formaldehyde and 2.5% glutaraldehyde 1-mM CaCl2 in a 0.1-M HEPES buffer and then post-fixed with 1.0% osmium tetroxide in a 0.1-M HEPES buffer and 0.1-M sucrose. After additional buffer washes, the samples were dehydrated with a graded ethanol series and embedded in epoxy resin. Thin sections were cut using a Leica ultramicrotome, stained with 1% uranyl acetate for 30 min, and washed with distilled H2O. A Joel transmission electron microscope (JEM-1400A) was used for observation at 120 kV. Digital images were acquired using a Bioscan Camera Model 792 (Gatan, Inc., Japan) controlled by a digital micrograph 3.4 (Gatan, Inc.). Viral particles were observed in the saphenous vein (Figure 3C). An area devoid of viral particles was also observed (Supplementary Figure 1). HepG2 cells were cultured in a 12 well plate. Cells that reached 60% confluence were stimulated with patient serum and healthy control serum from a volunteer with no history of SARS-CoV-2 infection at 10% concentration for 18 h. We performed three independent experiments. Total RNA was recovered from each well by Isogen (Nippon Gene, Japan). Of the total RNA, 500 ng of RNA was reverse-transcribed using the Versa cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, United States). One microliter of cDNA was amplified with primers (human ISG15 Fw: CACCTGAAGCAGCAAGTGAGCGGGCTGGAG, human ISG15 Rv: CCGCAGGCGCAGATTCATGAACACGGTGCT, human MxAFw: GCCAGCAGCTTCAGAAGGCCATGCTGC AGC, human MxARv: GGGCAAGCCGGCGCCGAGCCTGCG TCAGCC, human 18S Fw: TCAACTTTCGATGGTAGTC GCCGT, human 18S Rv: TCCTTGGATGTGGTAGCCGTTTCT) using the Power Cyber Green master mix (Thermo Fisher Scientific, Waltham, MA, United States) and quantitative PCR system, Rotor gene 2 (QIAGEN, Netherlands). Serial dilutions of one of the samples were amplified using each primer pair for quantification. The quantified expression levels were normalized to the result of 18S ribosomal RNA that was used as the internal control. The data obtained from three independent wells are expressed as mean +- standard deviation. Statistical analyses were performed using the Microsoft Excel Student's T-test. Statistical significance was set at p < 0.05. As shown in Figure 4, type-I IFN stimulated genes, interferon-stimulated gene 15 (ISG 15) and myxovirus resistance A (MxA) expression levels were significantly higher in the HepG2 cells stimulated by the patient's serum.

covid-19, sars-cov-2, long-covid, post-covid syndrome, type-i interferons

PMC9972090_01

Female

A 48-year-old woman presented with intermittent cough and expectoration, which she had been experiencing since May 2018. In early October 2018, the aforementioned symptoms significantly progressed with dyspnea on exertion. A chest radiograph recorded at a local clinic showed increased and disordered lung markings and scattered small patchy shadows in bilateral lungs. She was diagnosed with bronchopneumonia and was administered antibiotics; however, there was no improvement in dyspnea. On 8 October 2018, her chest radiograph of regular occupational medical check-ups at the local occupational disease hospital showed diffuse punctate and nodular shadows in the bilateral lungs (Figure 1B), while the initial chest radiograph taken on June 2016 (before work) was normal (Figure 1A). Chest CT scans revealed diffuse ill-defined centrilobular nodules, as well as patchy ground-glass opacities (GGOs) in bilateral lungs, and no pleural effusion was present (Figures 2A, B). The patient quit work and was admitted to a local occupational hospital for further evaluation. On admission, arterial oxygen tension (PaO2) was 88 mmHg at rest in room air. Her routine hematological and biochemical blood tests were normal. Autoantibodies such as an antinuclear antibody, rheumatoid factor, anti-single stranded DNA antibody, anti-double stranded DNA antibody, anti-extractable nuclear antigen antibodies, and anti-neutrophil cytoplasmic antibodies were negative. At initial presentation, pulmonary function revealed a mild obstructive pattern, with forced vital capacity (FVC) of 3.02 L (101% predicted), total lung capacity (TLC) of 5.24 L (110% predicted), forced expiratory volume in 1 s (FEV1) of 2.28 L (89% predicted), FEV1/FVC ratio of 0.75, and a reduction of diffusing capacity of carbon monoxide (DLco) of 66% predicted (Figure 2). The histological findings of transbronchial lung biopsy (TBLB) revealed sarcoid-like granulomas with multinucleated giant cells, while birefringent particles were observed in the granulomas under a polarizing microscope.

aluminum dust, case report, granulomatosis, lung disease, sarcoidosis

PMC9972090_02

Female

The patient worked as an accountant in a restaurant when she was 19 years old for 8 years, as a bottler in a mineral water company for 4 years, and as a housewife for the next 4 years. Then she was engaged in attaching labels to fishing rods in a factory from 2007 to 2016. She had no occupational dust or fume exposure during these three early careers. From 6th July 2016 to 8th Oct 2018, the patient was engaged in polishing snowboards at a sporting products company. She worked 5-6 days per week and 8-12 h per day, using white corundum electric grinding wheels to polish the polyethylene baseplate of snowboards. It was a wet process with water-soluble cutting fluid spraying on the electric grinding wheels. The chief constituents of water-soluble cutting fluid were polyether, lauric acid, amine, and 1H-benzotriazole. She wore dust respirators during the operation. The workplace was ~2,000 m2 with 12 production assembly lines. There were four grinding machines with eight electric grinding wheels in every assembly line. The patient and four colleagues worked together on the same assembly line, using 30 grinding wheels each month, each weighing 10 kg. None of her 106 colleagues in the same workplace reported similar symptoms and their chest radiographs of regular occupational medical check-ups were all normal. The level of air dust in the workplace from 2016 to 2018 was detected. Exposure concentration of time-weighted average (CTWA) and short-term (CSTEL) of mixed dust in a different spot of the workplace was 1.05-8 times the occupational exposure limits (OELs) in 2016 and 2017, while the concentration of polyethylene dust was within the OELs. The maximum CTWA and CSTEL of mixed dust were 57.5 and 55.7 mg/m3, respectively, exceeding the permissible concentration-time weighted average (8 mg/m3) by seven times. Elemental analysis was performed on the grinding wheel powder in the workplace by an X-ray fluorescence spectrometric analyzer. The assay showed that 72.7% of Al2O3 and 22.8% of SiO2 were raw materials. The water-soluble cutting fluid was detected. Microorganism stains and cultures, such as bacteria, acid-fast bacilli, and fungi, were negative. The patient resigned from her job. She was diagnosed with pneumoconiosis at a local occupational hospital and received oral prednisone with a dosage of 0.5 mg/kg/day for 2 weeks. The dosage was gradually tapered to 5 mg/day for a total of 36 weeks (Figure 2). The discontinuation of occupational exposure and the first course of using corticosteroids resulted in an improvement of symptoms and a slight reduction of the multiple nodules in lung fields (Figures 2C, D). In November 2019, after the cessation of oral prednisone for 3 months, the symptoms worsened, her lung function value of DLco (Figure 2) was significantly reduced to 50%, and findings on the chest CT (Figures 2E, F) were more severe than before. She received oral prednisone again with an initial dosage of 15 mg/day from 23 April 2020. The dosage was gradually tapered to 5 mg/day (Figure 2). The respiratory symptoms were improved. She was then admitted to our hospital for further medical evaluation on 3 Nov 2020. The patient had no history of other diseases. She was a non-smoker and denied having tuberculosis, night sweats, fever, chills, or weight loss previously. Physical examination revealed chest roughness on auscultation. The remaining clinical examination was without particularity, and no extrathoracic signs or symptoms such as arthralgia, myalgia, dry eye, or dry mouth syndrome were found. The patient had no history of asthma, allergies, or any family history of respiratory disorders. Her lung function was almost improved to the initial level, with FVC of 3.15 L (110% predicted) and DLco of 62.3% predicted (Figure 2) after the second course of using prednisone in the local hospital. HRCT revealed multiple ill-defined centrilobular nodules and patchy GGOs gradually reduced with oral prednisone therapy (Figures 2G, H). Neither evidence of pleural fluid nor cardiac enlargement was noted. A video-assisted thoracoscopic surgery (VATS) biopsy of the right lower lobe was performed for further examination. The histological appearance under the microscope showed many well-formed non-necrotizing granulomas composed of epithelioid and multinucleated giant cells, mainly around the bronchi and vessels, with fibrous hyperplasia and lymphocytic inflammation (Figures 3A, B); a Schaumann body was also observed (arrows) (Figure 3C). Lightly pigmented dust macules within the interstitium were observed with adjacent focal emphysema. No classic silicotic nodules were detected. Microorganism stains and cultures, including acid-fast bacilli and fungi, were negative. In addition, 122.55 mug/g of aluminum and 455.23 mug/g of silicon were detected in the lung tissue by inductively coupled plasma mass spectrometry (ICP-MS) and inductively coupled plasma emission spectrometer (ICP-AES). No tungsten, cobalt, or beryllium was detected in both grinding wheel powder or biopsy samples. Based on occupational dust exposure combined with clinical, radiological, and histological findings of sarcoid-like granulomatosis, the patient was diagnosed with aluminum-associated sarcoid-like granulomatous lung disease by a multidisciplinary panel, rather than sarcoidosis. Upon admission to our hospital in November 2020, the respiratory symptoms, chest HRCT scans, and lung function of DLco improved; therefore, the second course of prednisone therapy lasted for a total of ~ 28 weeks. She was administered oral N-acetylcysteine and inhalational corticosteroids. After discharge from our hospital, she was followed up regularly in a local occupational hospital. During the 36-month follow-up observational period, her chest CT (Figures 2I, J) revealed that GGOs slightly increased, and fiber streak shadows were observed in the lower lobe of the right lung, as well as the value of DLco reduced to 54%; however, her respiratory symptoms were stable. A 48-month follow-up revealed that her symptoms of dyspnea on exertion gradually worsened, while GGOs (Figures 2K, L) gradually increased and DLco reduced to 46%. The patient gained weight significantly after oral glucocorticoid treatment. After stopping the glucocorticoid, the shortness of breath was not obvious in the resting state, so she resisted the use of glucocorticoid therapy again. This study was approved by the Medical Ethical Committee and the patient provided informed consent for the publication of the case.

aluminum dust, case report, granulomatosis, lung disease, sarcoidosis

PMC9553287_01

Male

A 57-year-old man who suffered from upper abdominal pain for over 1 year and worsening for 2 months was admitted to a local hospital initially. He had progressive xanthoderma and lost 4 kg of weight in 2 months. This patient had a previous history of recurrent duodenal ulcer and alcohol abuse for over 30 years. Physical examination suggested right-upper abdominal pain and jaundice. The laboratory results of the local hospital showed a significant increase in the serum levels of carbohydrate antigen 19-9 (CA19-9; 160.3 U/L), total bilirubin (TBIL; 103.9 mumol/L), gamma-glutamyl transpeptidase (gamma-GT; 1,341 U/L), alkaline phosphatase (ALP; 687 U/L), alanine aminotransferase (ALT; 184 U/L), and aspartate aminotransferase (AST; 69 U/L). A rough patch of mucosa was found in the descending duodenal region through gastroscopy, and the following biopsy suggested chronic inflammation. In order to relieve the symptoms of jaundice, the patient underwent endoscopic retrograde cholangiopancreatography (ERCP) with stent deployment in the common bile duct at a local hospital. He was transferred to our hospital for further evaluation and treatment. All the clinical indicators of laboratory results were better on his admission compared to the results before stent deployment (Figures 1A-C). A week later, the serum levels of TBIL, gamma-GT, ALP, ALT, and AST gradually decreased. In order to make a definite diagnosis, we performed further relevant tests. Abdominal computed tomography (CT) indicated a hyperdense mass in the common bile duct, which was the biliary stent. The pancreatic parenchyma is plump, and the adipose tissue around the pancreas is cloudy, which suggested the possibility of pancreatitis (Figures 1D, E). Magnetic resonance cholangiopancreatography (MRCP) also suggested pancreatitis and stenotic distal common bile duct, but periampullary cholangiocarcinoma was not excluded (Figure 1F). Positron emission tomography (PET)-CT did not show any signs of malignant lesions (Figures 1G, H). The remaining stent in the common bile duct and an inhomogeneous echo of pancreatic parenchyma were seen through endoscopic ultrasonography (EUS) (Figures 2A-D). However, the biopsy of the rough mucosa in the descending duodenal region still suggested inflammation (Figures 2E-H). Finally, we suspected the diagnosis to be groove pancreatitis based on the above clinical information (Table 1). The patient's symptoms and results of laboratory investigations almost returned to normal after conservative treatments. We suggested he receive reexamination and have the stent removed after 1 month before he was discharged from the hospital. One month later, he was admitted to our hospital again. All his laboratory results were normal except for the slight rise of carbohydrate antigen 19-9 (CA19-9). Unexpectedly, symptoms of upper abdominal pain recurred, and the results of laboratory investigations worsened after the stent was removed. Then he underwent the second EUS examination through which a lesion in the lower common bile duct was confirmed (Figures 3A-C). For further treatments, he underwent pancreatoduodenectomy and achieved favorable clinical results (Figure 3D). Based on the histopathological evaluation of resected specimen, the following diagnosis was confirmed as moderately differentiated adenocarcinoma of the common bile duct (Figures 3E, F).

ercp, eus, cholangiocarcinoma, groove pancreatitis, obstructive jaundice

PMC5838497_01

Male

A 66-year-old man with a 50-pack-year smoking history and severe chronic obstructive pulmonary disease (COPD) presented to our clinic with a new right upper lobe (RUL) pulmonary nodule and a chronic left lower lobe (LLL) consolidation on screening computed tomography (CT). His pulmonary function tests (PFTs) showed airflow obstruction with an FEV1 of 2.58 L (81% predicted). The LLL consolidation was evident on a chest radiograph 6 months before his current presentation, and the lesion had been biopsied by his local pulmonologist via conventional bronchoscopy with no evidence of malignancy. The patient reported a 45-pound weight loss over the course of three months, as well as a recent hospitalization for severe hyponatremia (109 mEq/L). Upon physical examination, the patient was noted to be cachectic, with bilateral decreased air entry. CT of the chest showed a stable LLL consolidation along with a 9 x 21 mm subsolid lesion in the RUL. Navigational bronchoscopy and biopsy of the RUL lesion revealed squamous NSCLC with positive CK5, p63, and TTF-1 markers (Figures 1(a)-1(c)). The LLL consolidation was not sampled during this procedure, as it was located on the contralateral lung, was noted to be stable for 6 months based on a prior chest radiograph, and had been analyzed after a previous bronchoscopy with cytology and transbronchial lung biopsies without evidence of malignancy. A staging positron emission tomogram (PET) done after the navigational bronchoscopy once a malignant diagnosis was confirmed showed FDG avidity in the RUL lesion (SUV 2), along with an FDG-avid left infrahilar mass (SUV 11) within the LLL consolidation (Figure 1(d)). The absence of enlarged or FDG-avid mediastinal adenopathy made the diagnosis of a second primary cancer very likely. Endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) of the left infrahilar mass revealed a cluster of cells with minimal cytoplasm and small nuclei with nuclear cytoplasmic molding (Figures 1(d)-1(f)). Immunohistochemical markers were consistent with an undifferentiated SCLC that was positive for CAM 5.2, TTF-1, CD56, and synaptophysin and negative for p63 and CK5 (Figure 1). The final diagnosis was a right-sided Stage I NSCLC (squamous) and a left-sided limited SCLC. Chemotherapy was initiated with etoposide and cisplatin, along with concurrent radiation for the left-sided SCLC. Given the overall poor survival associated with small cell carcinoma, surgery including segmentectomy was not a therapeutic option for the Stage I right-sided squamous cell carcinoma. Stereotactic body radiation therapy (SBRT) was then initiated for the squamous cell cancer. Despite lower rates of recurrence after segmentectomy compared to SBRT, the likelihood of recurrent SCC driving survival in this patient with concurrent SCLC was low. The patient's hyponatremia has since resolved, and his surveillance PET scan showed him to be recurrence-free at 1 year.

PMC6660454_01

Female

A 29-year-old female presented with new onset generalized tonic-clonic seizure. She described a three year history of intermittent bilateral temporal headaches. Past medical history was remarkable only for prior injection drug use, from which she had been abstinent for three years. Her only medication was daily buprenorphine-naloxone. She was born and raised in rural Vermont, and had never travelled outside the state. She worked in a manufacturing facility where she often shared lunch prepared by co-workers, many of whom had recently emigrated from South Asia. She was a 15 pack-year smoker and drank minimal alcohol. She had one cat who was treated for an intestinal worm infection two years prior. The family history was notable for breast cancer in her maternal aunt at age 40. Upon presentation for care after the seizure, the patient was afebrile with normal vital signs. Aside from an initial post-ictal state, physical and neurologic examinations were unremarkable. Initial laboratory results showed a white blood cell count of 7.2 x 103 cells/muL, hemoglobin of 13.3 g/dL, platelets of 270 x 103/muL, and serum creatinine of 0.6 mg/dL. A computed tomography (CT) scan of the brain was notable for numerous cystic lesions. A subsequent magnetic resonance imaging (MRI) study of the brain with gadolinium contrast showed approximately 35 smoothly circumscribed cystic structures throughout the supra- and infra-tentorial brain parenchyma (Fig. 1). The cystic lesions ranged in size from 2 to 33 mm, the largest located in the left temporal lobe. Notably, mass effect, perilesional edema, and restricted diffusion were absent on MRI. A lumbar puncture was performed and cerebrospinal fluid (CSF) analysis demonstrated no white blood cells, normal glucose and protein, and negative bacterial, fungal, and mycobacterial stains and cultures. Chest X-ray was normal. The initial working diagnosis was neurocysticercosis, with consideration given to tuberculosis, toxoplasmosis, cryptococcus, histoplasmosis, blastomycosis, echinococcus, nocardia, and malignancy. Negative results included cysticercosis serum and CSF IgG enzyme-linked immunosorbent assay (ELISA), interferon gamma release assay for tuberculosis, toxoplasma CSF polymerase chain reaction and serum IgG serology, CSF cryptococcal antigen, urine histoplasma and blastomyces antigens, serum echinococcus serology, and fourth generation human immunodeficiency virus assay. No empiric antimicrobial agent was given. Repeat MRI four weeks later showed a slight increase in the size of the cystic lesions, up to 35 mm. Six weeks after initial presentation, a brain biopsy of the left posterotemporal cystic lesion was performed, with pathology demonstrating metastatic neuroendocrine tumor (Fig. 2). A CT chest then showed a 3 cm irregular mass in the lower lobe of the left lung, not seen on the prior chest X-ray. A positron emission tomography scan showed fluoro-deoxy-glucose uptake in the lung lesion, the cystic brain lesions, and the T8 vertebral body. She was diagnosed with lung neuroendocrine tumor with cystic brain metastases, and treated with carboplatin, pemetrexed, and pembrolizumab. Subsequent imaging has shown a decrease in lesion size and no further metastases.

cystic brain lesion, cysticercosis, neurocysticercosis

PMC8060098_01

Male

A 26-year-old male was admitted to the hospital with a 2-week history of cough with expectoration and high-grade fever. He had a history of loss of appetite for ten days. On admission, his blood pressure was 116/76 mm Hg and his body temperature was 37.8 C. Rest of the physical examination was unremarkable, and urine analysis did not show any abnormal findings. The patient's laboratory profile was as follows: hemoglobin: 10.6 g/dL; total leukocyte count: 4,100/mm3; platelet count: 2.6 x 105/mm3; erythrocyte sedimentation rate (ESR): 58 mm/hr; serum creatinine: 0.86 mg/dL; sodium: 138 mEq/L; potassium: 3.7 mEq/L; and serum albumin: 4.2 g/dL. The chest X-ray showed dense homogenous opacity in right upper zone area of lung. PPD (purified protein derivative of tuberculin) skin test showed a positive reaction, and sputum smear for acid-fast bacilli was found to be positive. On the basis of clinical symptoms, high ESR, positive PPD skin test, positive sputum smear for acid-fast bacilli, and chest X-ray findings, the diagnosis of pulmonary tuberculosis was made. The antituberculosis treatment was started with rifampicin 450 mg/day, isoniazid 300 mg/day, ethambutol hydrochloride 800 mg/day, and pyrazinamide 1000 mg/day. After one month of daily treatment, the patient became sputum smear negative for acid-fast bacilli, but he developed sudden onset swelling whole over the body. The patient's laboratory profile at that time was as follows: hemoglobin: 12.9 g/dL; total leukocyte count: 9,700/mm3; platelet count: 2.6 x 105/mm3; urinary protein: 3+; urinary sugar: 0; urine microscopy:white blood cell count: 2-3/high-power field; red blood cell count: 0-1/high-power field; urinary pH: 6.2; urinary albumin: 3+; serum albumin: 2.7 g/dL; serum sodium: 136.4 mEq/L; serum potassium: 4.4 mEq/L; blood urea: 36 mg/dL; serum creatinine: 0.82 mg/dL; serum cholesterol: 296 mg/dl; serum glutamic oxaloacetic transaminase (SGOT): 32 U/L; serum glutamic pyruvic transaminase (SGPT): 36 U/L; serum bilirubin total: 0.9 mg/dL; C3: 106.0 mg/dL (normal range: 90-180); C4: 18 mg/dL (normal range: 10-40); serum antinuclear antibody: negative; serum antistreptolysin O titer (ASO titer): <110 IU/mL; cytoplasmic antineutrophil cytoplasmic antibody: negative; perinuclear antineutrophil cytoplasmic antibody: negative; HIV I and II: negative; HBsAg: negative; and anti-HCV: negative. A 24-hour urinary protein value was 10.8 grams/day. Ultrasonography abdomen showed bilateral normal size kidneys with normal echogenicity. A renal biopsy showed nonproliferative glomerulopathy (22 glomeruli) (Figure 1). Tubular atrophy involved less than 10% of the sampled cortex. Tubules showed focally prominent cytoplasmic vacuolar changes, and the arteries sampled appeared unremarkable. Direct immunofluorescence did not show significant glomerular immune deposits. Renal electron microscopy showed diffuse effacement of visceral epithelial cell foot processes (Figure 2). Rifampicin-induced secondary minimal change disease was suspected, and the culprit drug rifampicin was stopped immediately. The other antitubercular drugs were continued with the addition of levofloxacin 500 mg/day. The proteinuria started to decline, and 24-hour urinary protein was 1.2 grams/day after two weeks of stopping of rifampicin. After 30 days of cessation of rifampicin, proteinuria was undetectable in 24-hour urinary samples, and serum albumin and serum cholesterol were found to be normal. The pulmonary tuberculosis was well managed by isoniazid, ethambutol hydrochloride, and levofloxacin, and there was no recurrence of proteinuria.

PMC4296266_01

Male

A 45-year-old male presented with a history of several months of right lateral knee pain. He also complained of a creak and a movable mass at the lateral joint area during ambulation. He was a member of an amateur soccer team. An MRI was performed using a Magnetom Vision 1.5-T MR imaging unit (Siemens Medical Systems, Erlangen, Germany). The MRI showed a thickened ITB and poorly defined high signal intensity abnormalities in a compartment-like space bounded laterally by the ITB on coronal fat suppressed proton density weighted images (repetition time [TR] 1700 ms, echo time [TE] 10 ms) (Fig. 1A). The T1-weighted image (TR 400 ms, TE 20 ms) showed a decreased signal intensity lesion compared to adjacent fat, deep to the ITB (Fig. 1B). A well-demarcated, ovoid nodular lesion was also observed in the compartment-like space. The nodule showed iso-signal intensity compared to the knee muscle on a T1-weighted image, high signal intensity on T2-weighted images (TR 3200 ms, TE 100 ms), and a slightly higher signal intensity with thin rim on fat suppressed proton density weighted images (Fig. 1A-C). The initial diagnosis based on the MRI findings, clinical history, and physical examination was ITB friction syndrome. We suspected the nodular lesion was a ganglion, focal synovial thickening, focal villonodular synovitis, or focal degenerative change of invaginated extraaritcular fatty tissue. Unfortunately, we did not consider the possibility of a FTS. During an arthroscopic examination, the surgeon found an inflamed lateral synovial recess, which is typically observed in ITB friction syndrome (Fig. 1D). After a sequential arthroscopic inflamed synovial recess resection with synovial shaver, a whitish intraarticular polypoid nodule was observed, attached to the lateral joint capsule (Fig. 1E). The nodule was successfully resected and was submitted to the Department of Pathology for histologic analysis. In the resected nodule, abundant collagen fibers and scattered fibroblasts were detected. The nodule did not contain necrosis, mitotic activity, or cellular atypia (Fig. 1F, G). The nodule was diagnosed as a FTS based on the histological findings. Arthroscopic debridement of the adjacent tissues near the surface between ITB and lateral femoral condyle was also performed to relieve the symptoms of ITB friction syndrome. The resected tissues showed fibrosis, marked hemorrhage, prominent capillary proliferation, and mild chronic inflammation that was consistent with ITB friction syndrome (Fig. 1H).

fibroma of tendon sheath, iliotibial band friction syndrome, knee, magnetic resonance imaging

PMC5349614_01

Male

A 55 year old Chinese male presented to the respiratory clinic for chronic cough for 3 weeks duration associated with haemoptysis. Prior to presentation, he was treated in the community with oral antibiotics without improvement. He had no known past medical history and but he had a significant 20 pack year smoking history. There were no relevant contact exposure or other symptoms to suggest pulmonary tuberculosis. A chest radiograph showed a large right lower zone mass, concerning for malignancy. A computed tomography (CT) thorax confirmed a right middle lobe mass with multiple necrotic mediastinal lymph nodes and liver metastasis (Fig. 1a). Sputum acid fast bacilli (AFB) smears and tuberculosis polymerase chain reaction (TB PCR) were negative. A bronchoscopy and endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) of the mediastinal lymph nodes was arranged. Initial pre-procedural examination was unremarkable and he was afebrile with normal vital signs and oxygen saturation of 99% on room air. The patient did not have any pre-procedure risk factors for apnoea such as obstructive sleep apnoea (OSA) or short neck. His BMI was 18.9. Topical xylocaine spray 10% was given intra-orally and intra-nasally. Initial 1 mg of intravenous (IV) midazolam and 25 mug of IV fentanyl was given for moderate sedation with cardiac and pulse oximeter monitoring. A flexible bronchoscope was first introduced for airway inspection. Vocal cords was normal in appearance. Except for submucosal infiltration seen in the right middle lobe, there were no other endobronchial lesions seen (Fig. 1b). During inspection, a further 2 mg of IV midazolam was given to maintain adequate sedation. Bronchoalveolar lavage was performed to the right middle lobe with good returns. The flexible bronchoscope was removed and endobronchial ultrasound bronchoscope was introduced. Surveillance endobronchial ultrasound screen showed enlarged sub-carinal and right para-tracheal lymph nodes. Because the patient became agitated, a further IV midazolam 2 mg and IV fentanyl 25 mug was given, closely titrated to maintain moderate sedation. Successful EBUS-TBNA to sub-carinal lymph node was performed. We then proceeded to biopsy the right para-tracheal lymph node but abandoned because patient turned restless again and required a further IV fentanyl 50 mug. 2 minutes later, patient became unconscious and apnoeic. He was rigid and his chest wall movement ceased During the apnoea phase, he had desaturated leading to sinus bradycardia on the cardiac monitor. Bronchoscope was immediately removed and bag-valve-mask ventilation was attempted but ineffective due to chest wall rigidity. 100 mg IV suxamethonium was given for muscle paralysis to allow for endotracheal intubation and ventilation, followed by naloxone and flumazenil to reverse the effects of fentanyl and midazolam respectively. The time interval between the onset of apnoea and successful endotracheal intubation was 2 min. Airway inspection through the endotracheal tube showed no evidence of airway bleeding. Patient was extubated in the endoscopy room after 10 minutes of observation and wearing off of the effect of neuromuscular blockade (suxamethonium). He was closely observed in the recovery room for the next 6 hours during which he was successfully weaned off oxygen and discharged home on the same day.

bronchoscopy, lung cancer, sedation

PMC3198252_01

Female

A 29-year-old pregnant woman with parity 0-0-0-0 visited the hospital at 14 weeks after spontaneous pregnancy. Abdominal 2D ultrasound (Voluson E8, GE Healthcare, USA) revealed that the first twin was within the normal ranges for the gestational age but the second twin showed anencephaly. There was one placenta and no amniotic membrane separated the two fetuses, and both were male. Umbilical cord entanglement was observed by using 3D ultrasound (Voluson E8, GE Healthcare, USA) (Fig. 1). The parents received counseling regarding monoamniotic twin pregnancy, anencephaly of a fetus and complications of umbilical cord entanglement. The patient underwent weekly prenatal medical examinations at the outpatient clinic. A fetal ultrasound conducted at 22 weeks did not show any abnormal finding except for one fetal anencephaly (Fig. 2). Starting from 26 weeks, a Doppler study of the umbilical cord and a non-stress test were performed every week and their results were within normal ranges. Also, amniotic fluid index (AFI) was checked every week, polyhydramnios (AFI = 25) was detected at 26 weeks and persisted until delivery (AFI: 20 ~ 28). The polyhydramnios was asymptomatic and was not treated. Although hospitalization for intensive observation was recommended at 30 weeks of pregnancy, the patient refused such treatment. While she was examined as an outpatient, preterm labor occurred at 33+5 weeks and she was subsequently hospitalized. A single course of steroids for lung maturation were given immediately after hospitalization. The heartbeat of the 2 fetuses were 140 beats/min and 130 beats/min, respectively and showed normal variability, and 20~30 mmHg uterine contractions were observed every 3 minutes. At 34 weeks a Cesarean section was performed under general anesthesia. The first male infant had a weight of 2,210 g, and his Apgar scores at 1 and 5 minutes were 6 and 8, respectively. No gross abnormalities were observed. The second infant weighted 1,380 g and his Apgar scores at 1 and 5 minutes were 1 and 0, respectively. Other than anencephaly, no gross abnormalities were observed in the second twin. The first twin was moved to the neonatal intensive care unit immediately after Cesarean section and was cared for without intratracheal intubation or use of a ventilator. He was discharged without any complications on the fifth day after birth and the mother was also discharged without any unusual findings on the same day. The gross findings for the umbilical cord were very similar to that of umbilical cord entanglement observed through 3D ultrasound at 14 weeks (Fig. 3).

3d, anencephaly, cord entanglement, monoamniotc twin

PMC6369329_01

Female

A 29-year-old woman presented to the emergency department following a motor vehicle collision in which she was the seatbelt-restrained driver. Airbags deployed when her vehicle hit a roadside tree at a high speed. Emergency medical services arrived at the scene and recommended transport to a Trauma Center, but she chose to go home against their recommendation. Over the course of the next few hours, she developed severe lower abdominal pain, gross hematuria, and called for ambulance transport. Upon arrival as a Trauma Alert, she was in severe abdominal and flank pain. She appeared lethargic and confused, but had not experienced head trauma during the collision. She was afebrile but tachycardic, with normal blood pressure. Her abdomen was distended and guarded with rebound tenderness. There was frank blood at the urethral orifice and introduction of a bladder catheter yielded no urine. Plain radiographs of the pelvis revealed no evidence of fracture. Laboratory data were significant for a hemoglobin of 12.0 mg/dL, leukocytosis of 15.1 x 103 WBC/muL, and elevated serum creatinine of 1.57 mg/dL. Non-contrast CT abdomen and pelvis showed no evidence of acute trauma, but revealed a moderate amount of simple fluid density ascites within the abdomen and pelvis of unknown etiology (Fig. 1). At this time, diagnoses included blunt abdominal injury with free intraperitoneal fluid, peritonitis, acute kidney injury, metabolic acidosis, and dehydration. Trauma surgery then performed an emergent exploratory laparotomy and found a full-thickness rupture across the bladder dome (Fig. 2). Approximately one liter of clear urine was drained from the abdomen. The bladder was repaired in two layers with absorbable sutures and a bladder catheter was left in place. The bladder repair was then tested intraoperatively by filling the bladder with fluid via the bladder catheter until the bladder distended and no leak was observed. On postoperative day one, she was transferred from the ICU to the medical/surgical unit in stable condition. Laboratory data showed her leukocytosis normalized as did her serum creatinine. She continued to recover well, advancing to a regular diet on postoperative day two with her pain well controlled. By postoperative day three, hematuria resolved, and cystography showed no leakage (Fig. 3). She was discharged that day with instructions to keep the bladder catheter in place for seven more days. Follow up in the outpatient trauma clinic the following week, showed she was without complications; and the indwelling catheter was removed without incident.

ct cystography, catheter-associated urinary tract infections, plain film cystography, urinary bladder rupture

PMC8022651_01

Female

I started very young with martial arts. At the age of seven. I approached martial arts because I was, in between brackets, a little bit bullied, at school, in the courtyard and so I was looking for self-confidence, I was trying to win my fears, my shyness. So, my grandpa suggested me martial arts, and from there, in short, all my path. Martial arts became an integral part of my existence, and then I met yoga when I was twelve, thirteen years old. And so, two great loves that I cultivated until they merged one with the other. So martial arts elements with the traditional poses of yoga, and then the meeting with Francesca, that comes, in short, from the world of fitness. Francesca is the co-founder of Odaka Yoga. As Roberto, she is one of the 14th Yoga Alliance International Australia Master Yoga Platinum, the highest recognition issued by the yoga industry7. Moreover, Francesca has recently become the chief editor of "the world's largest and most influential yoga brand"8 the Yoga Alliance International online Journal (see text footnote 7, respectively). As she summons up: I take a slightly different route. I am the generation of Jane Fonda. I did not have any intention whatsoever to do yoga. I love movement, I come from aerobics and suits, you know those eighties style, in lurex and when I was studying at university I also started to teach aerobics and then there was this gym in Rome where they were doing some yoga courses, and my sister who was studying psychology told me: "Look, let's go, I want you to have this experience," [she said it] once, twice, three times, and in the end I said: "Ok, let's go." It has been really like a revelation for me. From there on I have never abandoned the yoga mat. This incredible contact with the body, that was not only a tool for movement but that really talked to you, it was really like, oh yeah, I found my way, so to say. I found what I wanted to do in the world. And with Roberto we have, I love anatomy, all that more structured part that concerns movement that married very well with Roby's [an affectionate term for Roberto] creativity and this fusion with martial arts and yoga. And so slowly, slowly everything gained structure. As Francesca approached the practice of yoga she was struggling with anorexia. Luckily, thanks to her dedication to the practice and "the physical realization of certain things," as she says in our interview, she managed "to overcome it." Simplifying, Odaka Yoga is then the expression of Roberto's and Francesca's respective experience and proficiency with martial arts and fitness. More precisely, it is the outcome of the merging and complementing of their different expertise in the development of an innovative style of postural yoga characterized by a simultaneous reliance on Asian and Western systems of knowledge. However, when Roberto and Francesca met and began their lifelong journey together, Odaka Yoga, as we know and practice it today, was not yet formalized. It was only in 1993 that the word "Odaka," as much as Odaka Yoga's teachings, were subjected to copyright. However, "Odaka" was already used as an acronym of the martial art and yoga studio founded in Rome and run by Roberto since 1984 (later also in partnership with Francesca) which was called Oriental Disciplines Arashi Kyo Academy (O.D.A.K.A). As Francesca further explains: Arashi Kyo is the name of Sensei, of Roby, when he was European champion of Karate. I mean [we taught] many styles but the acronym adopted was Odaka, and so everyone [said]: "I am going to Odaka," "I am going to Odaka," "Odaka," "Odaka." O.D.A.K.A functioned as a hub, a place for practical experimentation and philosophical discussion over the meaning and purpose of martial arts. Its main goal was the diffusion of specific disciplines as means of inner knowledge and spiritual search to favor the perfect mind and body harmony development of each individual9 Most Notably, Roberto was teaching two martial arts systems he had created: Shin Jitsu Ryu and Wi Yoga Wakan. These martial systems emerged at the intersection of Roberto's experience and experimentation with Karate Shotokan, Ju Jitsu, zen, Hatha and Raja yoga and offered already the philosophical and practical bases for what later on would develop and evolve as Odaka Yoga. Of course, Francesca was also instrumental to the development of Odaka Yoga through her extensive experience in the world of fitness and yoga and her martial arts apprenticeship under Roberto's guidance. Today, Roberto and Francesca travel the world to share their hybrid style of yoga and are considered among the most influential contemporary teachers. For instance, Roberto has also been featured in 'Om Yoga Magazine UK' as one of the three world leaders in new, contemporary forms of yoga10. Their style has evolved into a transnational organization with centers across four different continents and a hectic calendar of events such as festivals, workshops, and teacher trainings that take place continuously all over the world and whose online diffusion has been further fostered by the current Covid-19 pandemic. Summarizing, Odaka Yoga is constituted by two different but parallel pillars: one is the discursive and practical reference to Asian systems of knowledge such as yoga, zen, and martial arts, whose main influence comes from Roberto's experience, experimentations and creativity; the other, is a focus on Western science and medicine, and more specifically on anatomy and biomechanics, primarily inspired by Francesca's background in the fitness world. Odaka Yoga further developed internationally because of a serendipitous happening, or more specifically an epiphany, that brought Roberto and Francesca to drastically re-imagine their life. After their martial academy shook due to internal conflicts, its key members took different routes, and Roberto and Francesca moved to Australia where they were planning to open a new studio and continue their work of dissemination and martial explorations. As discussed by Francesca, watching the 'The Last Samurai' (2003)11. at the cinema represented a turning point in their life: Everything started because 1 day we were living in Australia, in a beautiful place where we practiced with joy, and "The Last Samurai" came out in the cinema, and we went to watch it...we were in Melbourne and we had just rented a beautiful place for a new yoga studio. We left [the cinema] and Roby did not talk for a couple of days. I said to him "What's happening? How are you feeling?" He replied, "Look, I touched the soul, deeply, and I feel I need to go to Japan." And in that moment, I thought "Give him a couple of days and he will be over it." But it did not happen. Instead we terminated the contract [of the yoga studio] and we sold everything we had in Australia [where] we were only a step away from the permanent visa. There was our best friend that was saying "I mean, you don't speak a word in Japanese, you know nobody, but where do you want to go?" But instead his soul had launched this message, such an intense message that we moved there. The first year, the first few months in Japan were rather difficult, but then the local community begun to open up. Roberto and Francesca have a background as practitioners in one or more martial art(s). More precisely Roberto practiced Karate Shotokan and Ju Jitsu (in both of which he hold a Fourth Dan Black Belt) next to zen, Hatha and Raja yoga; while Francesca practiced Karate (earning a First Dan Black Belt under Roberto's tutelage) next to a lifelong practice with different styles of yoga and fitness. Both Roberto and Francesca reached a level of competence, confidence, and charisma that did not only allow them to gather a following, but also to transform a local martial arts academy into a transnational organization praised for its innovative character by some of the most influential voices of the contemporary yoga industry (e.g., Yoga Alliance). Roberto and Francesca were not the official gatekeepers or lineage holders of their original system (e.g., Karate Shotokan, Ju Jitsu, Hatha or Raja Yoga). However, Roberto was the founder of two different martial arts (e.g., Shin Jitsu Ryu and Wi Yoga Wakan) that in due time, and with the contribution of Francesca, morphed into Odaka Yoga. Roberto and Francesca started to practice martial arts and yoga as an answer to a personal crisis that aggravated them. More specifically, when still a child Roberto was bullied and attempted to exorcize his fears through the martial arts, as suggested by his grandfather; while Francesca, already familiar with the fitness world as she was teaching aerobics as a side job to her study in business administration, found in yoga an effective tool to cope with and resolve her anorexia. A Further moment of crisis was represented by the disruption of their Oriental Disciplines Academy in Rome, which brought the two teachers to Australia where they continued their martial explorations. Finally, Roberto's conversion following the vision of "The Last Samurai" functioned as an epiphany that proved instrumental in the further internationalization and popularization of Odaka Yoga. Roberto and Francesca, each of them through their own expertise, devised a solution for their personal problems through a revised martial and human development system, in this case Odaka Yoga. More specifically, through the formulation of their "new concept," "Live Centered, Liquefy Your Limits, Embrace The Power" and its "principles of transformation, adaptability and interior strength," Roberto and Francesca provided an existential answer to the fears and health challenges encountered in their youth while also offering a seductive path cable to equip its practitioners to face the flexibility demands, performative requests, and uncertainties of contemporary neoliberal societies. Although Roberto and Francesca are still alive and well, there are preliminary elements to postulate that their death will eventually create added chaos, thus fuelling the cycle of creativity among future generations of practitioners and possible lineage holders, a fascinating topic in itself that here cannot be competently explored. Watching 'The Last Samurai' prompted Roberto to silently question his current life and ongoing projects, further challenging his long-standing, and ever evolving "martial habitus" (Brown and Jennings,) which, in all fairness, was already shaken by and re-adapting to the recent disruption of his academy. Because of these crises Roberto and Francesca re-located to Japan, where they creatively managed to further innovate their martial style and finally obtained international recognition. Recalling Jennings' (:69) six stages of his theory of martial creation in the light of the biographical remarks here discussed it is possible to provide the following analysis of the birth and development of Odaka Yoga: As Jennings' (:66, emphasis in original) comments, these six stages can be summarized in the following declaration: "A martial art is founded by a disciplined, habitual martial artist who creatively transcends personal and social crises." Here, Roberto and Francesca learned from their teachers (of whom unfortunately I know very little if not nothing), practiced extensively and creatively, achieved a status within their respective fields and finally were able "to create something new and create a new method of achieving it" (Jennings,:66). As testified by the biographical sketches here provided "[t]he overall process of creativity is a potentially lifelong process, but it also comes with fleeting and intensive moments of (sometimes epiphanous) creation" (ibidem). Enriching Jennings' theory of martial creation with a closer look at Roberto's and Francesca's habitus and positions within the martial arts, yoga, and fitness fields, may further help focusing on important elements in the birth and development of Odaka Yoga. First, Roberto and Francesca managed to adapt and transform their respective "martial" (Brown and Jennings,) and "fitness" habitus (Sassatelli,) into a specific declination of "yogic habitus" (Di Placido,) hybridized with martial arts and fitness elements. This signifies that their old-habitus and its schemes of dispositions, developed at the intersection of the martial arts, fitness, and yoga fields, progressively changed as they moved away from the center of the martial arts and fitness fields, and toward the center of the yoga field. In other words, we may say that Roberto and Francesca successfully managed to exploit and convert certain types of capitals that granted them their previous positioning in the martial arts and fitness fields, into useful resources to acquire an ever more central positioning within the yoga field. For instance, next to their previous teaching expertise and pedagogical know-how:including in the martial arts founded by Roberto, yoga, and aerobics:they exploited the "bodily" (Wacquant,) or "physical capital" (Shilling,) developed, acquired, and secured through their lifelong involvement with different martial activities and fitness practices, to build an image of successful, competent, and innovative teachers. In so doing, as they skillfully converted their proficiency in the martial arts and fitness worlds to create an innovative hybrid style of yoga, they also contributed to the reproduction of the relationship of homology between the broader field of power, and the martial arts and fitness field. Simplifying, via their capitals (e.g., economic, cultural, physical, and so on), Francesca and Roberto secured a dominant position within the martial arts and fitness fields, while also managing to remain in a dominant position in their successive and progressive involvement within the yoga field. Finally, I would like to conclude this section with a short analysis of the manners in which Roberto's and Francesca's biographical remarks could be effectively accounted for through the lenses of Foucault's "epimeleia heautou." First, Odaka Yoga functions as a moral framework that guides practitioners' conduct and teleological orientation in the world, more specifically through its concerns for practitioners' health and processes of self-transformation as filtered through the concept of "Live Centered, Liquefy Your Limits, Embrace The Power"; second, it offers the possibility to convert one's attention from the outside world toward one's own interiority, thus promoting a specific ethic of self-care, self-actualization, and self-transformation that is already well-established in Western renditions and interpretations of Asian religious and spiritual resources; and third, it offers an array of practices, or technologies of the self, through which practitioners are invited to cultivate, interiorize, and master the specific worldview advocated by the school and deepening further their self-transformative experiences of conversion in the light of the discourses and practices advocated by the founders. Interestingly enough, it is also as a consequence of a dedicated engagement with martial activities as care of the self, that Roberto and Francesca managed to successfully adapt and change their martial and fitness habitus, and progressively translate their capitals, skills, and expertise from the martial arts and fitness fields into the yoga field. The next section is entirely dedicated to a discussion of Odaka Yoga's conception of health through an analysis of its understanding of the body as framed at the intersection of Asian and Western systems of knowledge. Odaka Yoga presents an understanding of the human body framed at the intersection of Asian and Western systems of knowledge. In other words, the Odaka Yoga body is built on a hybrid conception of health, simultaneously inspired by biomedical/anatomical and esoteric/spiritual principles. In the following I provide two extracts that testify to this hybrid conception of health. The first field note was written right after a teacher training weekend held in Milan in the Winter of 2018. Here, Francesca warns me against hyper-flexing the legs and instructs me about the physical cues to notice in order to know if a movement is more damaging than benefiting: We are going through a short sequence that involves the stretching of the leg, calf, tight, and quadricep. Each one practices individually, Francesca walks around, looking and giving suggestions. One knee on the floor and the other leg stretched in front, heel, and big toe on the floor. When I try to place the sole of the foot on the mat I feel a burning unease around the knee and on the back of it. I almost lose balance and my back stiffens up too. A perfect yogi! I then do the pose stretching the leg but touching the mat only with my heel and it goes better. As Francesca passes by, I tell her what I felt when I tried to bring the sole to the mat. She then looks at me and says: "You should never hyper-stretch anything. Especially if you feel the stretch behind the knee or at the end of the calf and of the tight, closer to the knee. If the warmth, the stretch is not at the center of the muscle then bend the knee. It means you are working beyond the capacity of your muscle and you are forcing it" (16/12/2018). In the second field note, taken during a weekly class at JustB, the Milanese headquarter of Odaka Yoga where I undertook the greatest part of my research, Beatrice, Odaka Yoga teacher and studio owner, evokes the energetic constitution of practitioners' bodies: After this intense, central part of the practice we move in a standing position. The transition is done from the dog bringing one leg in between the arms and then the other following it. Beatrice says: "Slowly unwind your back, vertebra after vertebra, the arms opening, as large as you can. The palms meet over the head and come down slowly with the elbow open and the finger well-spread. Open again. The hands meet and come down, this time the wrists rotate and the arms are again open, with the elbow at ninety degrees and the palms open." We repeat this and similar movements a few times [this movement is known as ki flow by Odaka Yoga practitioners] and then we move on to the performance of a warrior sequence. At the end of this sequence while we are again standing at the beginning of the mat, Beatrice says: "Now place your hands a few fingers below your belly button. Here is the tanden, the center. All our own energy comes from this energy center, all movement comes from here. It is known in all Oriental traditions as the most important energy center (31/05/2018). The first fragment depicts Francesca's attention for the technical aspects of the practice and more specifically for a practice oriented toward anatomical details and injuries prevention. The body that emerges from this type of attention is substantially a biomechanical and medicalized body. The Odaka Yoga's website seems to further reproduce this vision: Odaka Yoga re-educates the body to move in its entirety by reawakening the intelligence of our bodies. Specific sequences are created for different areas of the body while working on postural alignment in order to prevent muscle, skeletal, and tissue injury. During an Odaka Yoga session, muscles are activated with balanced and functional movement that simultaneously strengthen and elongate12. Biomechanics, as advocated by Odaka Yoga, is the study of the structure and functioning of the human body in motion. Its two main aims are to enhance performances and prevent injuries. Biomechanics implies a specific idea of the body: an object to be closely scrutinized for the discovery of its most functional (read natural and effective) movement patterns. The result of this reification is that the body, seen through the lenses of biomechanics, becomes a "medicalized body" (Robbins,), understood as that specific body amenable to scientific scrutiny and thus exposed to a certain "medical gaze" (Foucault,). As Foucault has poignantly shown, between the end of the eighteenth century and then throughout the nineteenth century, the body was substantially re-casted as an object of knowledge at the intersection of science and medicine. From this perspective, biomechanics can then simply be considered as a later development of the epistemic transformation traced by Foucault in his genealogical study of the emergence of modern medicine. The medicalized body is then dissected by the medical gaze which penetrates its secrets, uncovers the mysteries of its functioning and translates them into a visible system of representation where bones, muscles, tendons, and organs are simultaneously: (a) seen as self-standing objects; (b) seen as the parts that form the medicalized body. The pedagogical consequences of this understanding of the body as much as its influences in shaping a specific conception of health based on anatomy and Western medicine, are among the most obvious implications of the Odaka Yoga body as a medicalized body. In fact, the primary consequence of this displayable body is that through the lenses of disciplines such as biomechanics, the body is potentially detached from its experiential dimension to acquire instead a more visual, object-like, anatomical identity (Foucault,; Robbins,). This is precisely what grants the suspension of the body as the locus of personal experience, and promotes the legitimization of different areas of expertise to emerge, where doctors, scientists, couches, and yoga teachers become the qualified holders of the hidden truths of the body. Here, next to "re-education," "alignment" and "protection from injuries," Odaka Yoga wants to cultivate, this time through the "activation," "balancing," "strengthening" and "elongation" of the muscular band, a very specific declination of the medicalized body13. On the contrary, in the second field note proposed at the beginning of this section, Beatrice depicts a portrait of practitioners' bodies as primarily grounded in their energetic constitution. Here, the "liquid style approach" of Odaka Yoga, obtained by merging the martial arts flow of inner energy, and the zen spirit of quieting the mind with yoga postures, produces a practice akin to "an unremitting motion, a wave-like movement, a process where no interruption occurs between one pose and another." This type of fluid movement "aims to dissolve physical, mental and emotional tensions, while soothing the mind with immediate action"14. More specifically: Once the restraint is transformed, our habitual pattern of movement and thought is dissolved and each position creates space for a dialogue between our deepest fears and the possibility of overcoming them. The Odaka flow allows for us to go deep within ourselves and become "liquid." Odaka Yoga allows you to embrace adaptability while keeping an inner peace. It becomes a complete fluid and transformative body-mind experience....and one you will not forget15. At the heart of this conception of the body there is the "subtle body" model, that specific understanding of the body where its energetic structure interacts with and affects the anatomical or physical body of the practitioner (Johnston and Barcan,). This model, first popularized in the West in the nineteenth century by the esoteric writings of the Theosophical Society, has its origins in the 'Upanishads', a collection of Sanskrit sacred texts, more specifically the 'Brhadaranyaka Upanishad' (IX-VI B.C.E), the 'Katha Upanishad' (V B.C.E) and the 'Taittiriya Upanishad' (V-VI B.C.E) (Samuel and Johnston,; Mallinson and Singleton,). The 'Taittiriya Upanishad' describes a subtle body model composed of five sheaths (koshas). These koshas are, in the context of yoga soteriology, a series of interconnected layers that range from gross energy (matter) to progressively more refined subtle qualities, the subtlest of which are the states of dreamless sleep and liberation (samadhi). They are, from the grossest to the finest: anna-maya-kosha (physical body), prana-maya-kosha (energy body), mano-maya-kosha (mind body), vijnana-maya-kosha (consciousness body), and finally ananda-maya-kosha (bliss body) (Samuel and Johnston,:33). The subtle body model presented in the Upanishads, and later re-elaborated by the yogic, tantric and other Asian traditions, is constituted by a series of focal points (chakras) connected by specific conduits or channels (nadis) through which the subtle breath (prana) moves. According to this subtle body model, the flow of prana-within and across these sheaths-determines not only the physical and mental state of individuals, that is, their health, but also the plausible acquisition of supernatural powers, immortality or liberation (White,). In other words, according to this theory, when yoga practitioners perform physical postures (asana) or breathing exercises (pranayama), among other practices, they are not merely engaging or manipulating the physical body, but also the (ephemeral) energetic substrate of their being. As Johnston and Barcan (:30) rightly underline: [i]ntervention in one [sheaths] of necessity means intervention in others. The dominant belief is that changes in this energy (in this subtle body) at any level:mentally, physically, emotionally, spiritually:will bring about changes to all other aspects of the individual. This is exactly the theory behind Odaka Yoga's reliance on the subtle body model as an integral part of its hybrid conception of health. From this it follows that Odaka Yoga's transformative potentials are entirely based on the healing power of prana as it freely circulates across the different layers of practitioners' subtle bodies, "a union that aims to dissolve physical, mental and emotional tensions" through the "flow of inner energy." At this point, it is important to note that the subtle body of Odaka Yoga is not purely derived from the yoga tradition just discussed. On the contrary, it presents two main, although interconnected, differences: first, it downplays the importance of the breath as a conduit for prana emphasizing instead the importance of fluid movements; second, it ascribes specific importance to the energetic reservoir known in many Asian martial arts as tanden (or dantian). In relation to the former, Odaka Yoga subdues yoga's traditional emphasis on the breath to the importance of fluid movements. Here, the "liquid style approach" is obtained by merging (a) martial arts elements, (b) a focus on the inner flow of energies, and (c) the emulation of the yielding nature of the Ocean waves with yoga postures. In fact, it is through this liquid style and its fluid movements that the energy circulates across the different koshas, allowing practitioners to transform their physical, energetic, mental, emotional, and even spiritual makeup. In relation to the latter, Odaka Yoga reframes yoga's traditional subtle body model focused on chakras through the idiom of Asian martial arts. Here, the tanden, or more specifically the lower tanden16 (hereafter simply tanden), becomes the most prominent energy center of the practitioner's body. The tanden corresponds to the first two chakras of yoga' subtle anatomy (muladhara and svadhistana). According to Asian martial arts it indicates the reservoir of one's own vital energy, what in the yoga tradition is usually known as kundalini, a dormant snake coiled in the muladhara chakra whose stimulation, awakening and vertical rising across the other six main chakras is seen as bearer of supernatural powers, longevity and/or enlightenment (Eliade,). Partly following this model, the tanden is simultaneously understood as an energetic and spiritual center: it is not only the main source of ki (the Japanese equivalent of prana) but the center of gravity of the body itself, the center from which all movements spring from as previously evoked by Beatrice during her class. Nonetheless, to return to my main argument, the most important aspect of this model, whether we see it as belonging to the traditional model introduced in the 'Upanishads', or a later re-interpretation imported from Chinese medicine or the martial arts, is that it displays a model of the body that is substantially antithetical to the anatomical and biomechanical conception of the medicalized body previously discussed. This signifies that if the medicalized body:as a whole or in its parts:responds to a meta-narrative where scientific and medical discourses are woven together making the body an object to be closely scrutinized by a plethora of experts; the subtle body is instead regulated by the flows and functioning of energy, which is itself comprised:according to yogic philosophy:by the constant interplay between the grosser and the finest koshas. This specific understanding of the body, then, gives rise to a very particular conception "...of embodied subjectivity in which matter and consciousness are not understood as ontologically distinct but as varieties of 'energy' resonating at different densities" (Johnston and Barcan,:25). Here, the medical gaze described by Foucault loses all its representational and explanatory power and the truth of the body returns to become a mystery which science and modern medicine cannot competently understand just yet. Moreover, where the medical gaze fails to bring into light the invisible, practitioners' direct experiences of this invisible flow of energy, as the following field note demonstrates, become the primary epistemological ground on which the subtle body model can be understood and made sense of. Here, I discuss the sensuous and emotional dimensions of being able to perceive one's own inner flow of energy at the end of an Odaka Yoga practice: The emotions and the energetic sensations that the practice and the final relaxation induced in me are exhilarating. I feel like walking to Beatrice to tell her that every single lesson I do with her I feel like crying. But I stay put, sitting on my mat, while everybody else is slowly getting up, and going to the changing room. When the traffic is somehow slowing down, I also stand up and go to take the spray and the tissues to clean up my mat. As I walk toward the corner where the cleaning supplies are, literally a few meters away from my mat, I feel my body is light, relaxed, open. I feel happy. I really feel a great amount of vibrations in my belly area, especially in the upper belly part, and flows of relaxed energy all over my limbs (31/05/2018). At a practical-discursive level the body proposed by Odaka Yoga is simultaneously: (a) a medicalized body understood through the lenses of anatomy and biomechanics; (b) and a subtle body, framed according to traditional yogic and martial arts subtle anatomy. This tension is well-exemplified in the following fragment extracted from an interview with Beatrice: With this practice modality that is fluid but not too fast we work exactly on prana, on the energetic quality. It is an energetic quality where you are not exhausted, it is tiresome, but never extremely tiresome. You sweat but not too much. The body is always thermoregulated and is never over heated. Also, when you sweat a lot, you actually sweat a lot because outside is really hot, so you are self-regulating. [This style] creates a sort of energetic charge. In this way we work a lot on the connective tissue. And [to work] on the connective tissue means working on the emotions, because it is in the connective tissue that the strongest emotions pass through. Beatrice's narrative underlines how, according to the subtle body model, the "liquid style approach" of Odaka Yoga and its primary focus on energy work, is inextricably connected with a manipulation of the connective tissue of practitioners' bodies, that in turn is linked to practitioners' emotions. We can then clearly see how this model, thanks to the constant interplay across sheaths, offers the right philosophical and discursive foundations to frame a practice where energy work, physical work, and emotional work, are not only manifestly overlapping on an epistemological level, but are also experientially accessible to the practitioners. Yet, what is perhaps of greater interest is that this interconnectivity among sheaths is here reframed through the language of modern medicine, and science, with terms such as "thermoregulates," "self-regulating," and "connective tissue," making it almost impossible to disjoint these two registers. The medicalized and the subtle body are no longer recognizable as separate bodies. Discourses belonging to these two different registers are then simultaneously mobilized to reciprocally legitimize one another, and strengthen their respective therapeutic, self-actualizing and self-transformative framings of the body. In the next section I provide a brief discussion of how Odaka Yoga' conception of the body is epitomized, reproduced, and embodied by its ideal-typical practitioner, the Odaka Yoga Warrior. The Odaka Yoga Warrior is the ideal-typical practitioner capable "to live centered in the middle of chaos17." This signifies that the Odaka Yoga Warrior maintains her "center" and a "calm mind"; it seeks to "transform" herself cultivating "new balance" and "inner strength" while embracing the adversities of life and its "challenges." For the Odaka Yoga Warrior: Challenges should be thought of as opportunities, because that is exactly what they are. Without challenges, we cannot attain inner power. This makes challenges essential to growth. When we give into challenges without any fight, we embrace the empowerment (emphasis in original)18. This ideal-typical practitioner emerges at the intersection of the practical-discursive logics of Western medicine (with its anatomical and biomechanical principles) and Asian systems of knowledge (and their fluid movement and inner flow of energy) next to their respective models of the body and conceptions of health. Moreover, the Odaka Yoga Warrior is simultaneously a product and a "solution" to the uncertainties, flexibility demands, and challenges of contemporary Western societies. Having extensively inquired into Odaka Yoga's conception of health in the previous pages I devote the remaining of this section to a discussion of the affinity between the Odaka Yoga Warrior and a neoliberal mode of thought. As the Odaka Yoga's website argues: To become an Odaka Yoga warrior means to become adaptable, flexible, and fully integrated: a complete fluid and transformative body-mind entity. When moving in the Odaka flow, muscles are invited to engage in a new way which strengthens them and, in turn, creates movement in the mind. If the connective tissue is tense, muscles are no longer able to move freely because the entire body tenses and tightens, and so does our mind19. I would like to underline how the Odaka Yoga Warrior is not merely the outcome of the meeting between the practical-discursive universes of Western medicine and Asian systems of knowledge but is also the expression of the particular ethos of contemporary neoliberal societies. In fact, "[t]o become an Odaka Yoga warrior means to become adaptable, flexible and fully integrated," or in other words, "a complete fluid and transformative body-mind entity." This depiction of the Odaka Yoga Warrior:as much as its elective affinities with challenges, growth and empowerment:I argue, substantially adheres to the normative biopolitical injunction of self-care, flexibility and self-responsibility that characterizes contemporary neoliberal societies across social domains, such as higher education, sport and the labor market (e.g., Andrews and Silk,; Belanger and Edwards,; Gonzalez-Calvo and Arias-Carballa,; John and McDonald,). Understood in this light, the Odaka Yoga Warrior is:thanks to her self-control, self-mastery, and constant work of self-cultivation:able to fruitfully merge the central tenets of the medicalized and subtle body models within a unified therapeutic framework of fluid self-care and self-actualization. If this analysis is correct, then the Odaka Yoga Warrior is a particular declination of the "neoliberal yogi" discussed by Godrej, that is, a yoga practitioner whose conduct is substantially in alignment with the dominant paradigms of self-care, self-conduct and self-responsibility of contemporary neoliberal societies. Here, Foucault concept of "biopolitics," defined as the control of the welfare, wealth, longevity, and health of the population through the pervasive government of individuals' conduct, becomes a useful heuristic tool to theorize about the interconnections between Odaka Yoga's discursive focus on heath and self-transformation; its practical repertoire oriented to the problematization of practitioners' health, its maintenance and cultivation; and the type of power:or in Foucault's terminology governmentality:that dominates our everyday conduct as much as the ethos of our contemporary societies. These reflections point to the fact that, as much as it is pivotal to understand martial artists' positioning within the broader field of power in order to fully understand the martial systems that they create, it is also important to understand the broader ethos of a field, of a social group or even of an entire culture, to fully account for its conceptions of health and the manners in which they may be discursively framed, reinforced, or in certain cases also disqualified.

odaka yoga, health, martial arts, subtle body, yoga

PMC3615969_01

Female

A 23-year-old Hispanic female presented to the gastrointestinal clinic with multiple episodes of right-sided abdominal pain, fever, emesis, night sweats, and a 30-pound weight loss over the previous seven months. The patient denied diarrhea, melena or hematochezia. Hematologic studies revealed a leukocytosis and iron-deficiency anemia. Blood cultures were negative, including those for acid-fast bacilli. The patient reported a history of positive purified protein derivative (PPD) previously. CT scan of the abdomen revealed cholelithiasis as well as thickening and inflammation of the wall of the ascending colon to the mid transverse colon with moderate right-sided mesenteric adenopathy. Superior mesenteric venous thrombosis was also observed and subsequently treated with low-molecular weight heparin. Esophagogastroduodenoscopy (EGD) and colonoscopy were performed to further evaluate the patient's CT findings. The EGD appeared normal while the colonoscopy revealed a large, circumferential, fungating mass near the hepatic flexure. Biopsy with histology of the mass was interpreted to be most consistent with tubulovillous adenoma with low-grade dysplasia. A second pathologic evaluation was obtained and the biopsy was thought to be most consistent with CD due to the presence of submucosal granulomas and histiocyte aggregates. Acid-fast bacilli stains of the biopsy specimens were negative, as were other immunohistochemistries. Repeat colonoscopy with random biopsies was performed to clarify the etiology of the mass and evaluate the extent of the patient's colitis. Colonic involvement was observed to be isolated to the hepatic flexure. Biopsy specimens at this time were considered to be consistent with CD. Acid-fast bacilli staining of the biopsied specimens were again negative. Abdominal CT enterography was performed to evaluate for small bowel involvement. Significant wall thickening from the terminal ileum to the transverse colon with adjacent lymphadenopathy was found. The patient was advised to undergo an elective right hemicolectomy with primary anastomosis. The patient declined the surgery, returning to Mexico to receive herbal therapies. The patient returned with a 20 pound weight loss and symptoms and imaging consistent with compete bowel obstruction. CT of the chest was unremarkable and did not show evidence of active or latent TB. The patient underwent urgent right hemicolectomy with diverting loop ileostomy (which was subsequently closed). Histological analysis of the resected bowel segment revealed chronic inflammation with abundant caseating granulomas and fibrosis. Acid-fast bacilli staining of the lymph nodes was positive, consistent with isolated tuberculous colitis. The patient was referred to infectious disease for postoperative antitubercular chemotherapy.

crohn’s disease, extra-pulmonary, intestinal, mimicking, tuberculosis