text
stringlengths 699
822k
| summary
stringlengths 205
4.34k
|
|---|---|
You are an expert at summarizing long articles. Proceed to summarize the following text:
since recognizing platelets as an important part in coagulation some 125 years ago , the scientific community has evaluated platelets as a key player between inflammation and coagulation . thus , it is essential to learn more about the mutual influence between these two problems during intensive care therapy . in this context , sossdorf and colleagues evaluated the impact of hydroxyethyl starch ( he s ) on thrombelastography and platelet receptors . the authors investigated 10% he s 200/0.5 , 6% he s 130/0.4 , and saline in an in vitro experiment with blood of healthy volunteers . adverse effects of he s administration on hemostasis have spurred ongoing research into the pathological mechanisms since these effects are continually discussed as a serious limitation to the clinical use of he s . sossdorf and colleagues could reveal a decreased maximum clot firmness in fibtem ( rotation thromboelastometry [ rotem]-based measurement of the contribution of fibrinogen to the clot firmness ) with a 10% hemodilution by both tested he s solutions compared with saline . other parameters of rotemwere affected by he s 200/0.5 but not by he s 130/0.4 . accordingly , innerhofer and colleagues could demonstrate an inhibition of primary hemostasis by he s 200/0.5 and gelatine . sossdorf and colleagues further demonstrated that a clinical reasonable hemodilution of 10% does not affect the tested platelet receptors with both hess when compared with saline after activation with adenosine - diphosphate ( adp ) or thrombin receptor agonist peptide ( trap ) . without the addition of an agonist , the authors detected a significant 3% to 5% difference of plateletneutrophil conjugates after 10% hemodilution with 6% he s 130/0.4 . in contrast , 10% he s 200/0.5 may adhere to the platelet surface and decrease ligand binding to the fibrinogen receptor with a hemodilution of 10% or more . additionally , it was shown that the risk of bleeding is associated with synthetic colloids of higher molecular weight and higher degree of substitution . a decreased p - selectin expression after activation with adp in a 10% hemodilution with he s 130/0.4 is not necessarily in line with the proposed pro - inflammatory action of he s . yet the binding of p - selectin induces tissue factor expression on neutrophils , and in a positive feedback loop , neutrophils activate platelets as measured by p - selectin expression . moreover , platelets are able to act via a p - selectin - independent pathway to activate neutrophils and to contribute to the formation of neutrophil extracellular traps . it would be interesting to further investigate the tlr4 ( toll - like receptor 4 ) expression in patients with bacteremia and sepsis . the question therefore is whether there are important different effects between he s solutions on blood coagulation . he s solutions vary widely with respect to their physiochemical characteristics , hence the concentration , molecular weight , degree of substitution , and c2/c6 ratio account for differences in their pharmacokinetic and pharmacodynamic profile . with their in vitro data , sossdorf and colleagues further the discussion on effects of different are limited because of the absence of the endothelium and compensatory mechanisms like buffering and the control of ph and the lack of other electrolytes and metabolic degradation . furthermore , it was shown that 130/0.42 dissolved in a balanced solution containing calcium was associated with fewer negative effects on thrombelastrography than he s 130/0.4 dissolved in a solution without calcium . thus , more in vivo experiments seem to be important to increase the evidence of effects of various especially fast degradable he s preparations in patients undergoing surgery with major blood loss or in critically ill patients , especially those with sepsis . it seems of utmost importance to distinguish very clearly between different clinical settings in order to identify underlying mechanisms of he s solutions on coagulation . adp : adenosine - di - phosphate ; he s : hydroxyethyl starch ; rotem : rotation thromboelastometry . gm has done paid consultation and verbal presentations for b. braun melsungen ag ( melsungen , germany ) , has performed research projects in collaboration with b. braun melsungen ag and has thereby received other funding in the past , and has received presentation fees and research project funds from serumwerk bernburg ag ( bernburg , germany ) . | crystalloid and colloid solutions are used for resuscitation of the critically ill .
one set of options , widely used today , are different preparations of hydroxyethyl starch ( he s ) . however , the safety of he s regarding impairment of blood coagulation remains incompletely elucidated , a circumstance that limits its clinical use .
understanding mechanisms and potential differences between low - molecular and low - substituted he s and other he s solutions seems clinically relevant . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cyclooxygenase-2 ( cox-2 ) is a key enzyme that catalyzes the production of prostaglandins ( pgs ) and other inflammatory substances from arachidonic acid . cox-2 catalytic product pgs participate in many physiological and pathological processes , such as inflammation , pain , angiogenesis , blood pressure regulation , and immune response . cox-2 , as an inducible cyclooxygenase , is normally undetectable in most tissues and organs but can be rapidly induced by cytokines , growth factors , bacterial endotoxins , carcinogenic factor stimulation , and other stimuli [ 25 ] . the aberrant expression of cox-2 is associated with many aspects of physiological and pathological conditions such as cell malignant transformation , inflammation , cell growth and apoptosis , tumor angiogenesis , invasiveness , and metastasis [ 610 ] . prostaglandin e2 ( pge2 ) production has been reported to impair -cell function from studies in pancreatic -cells and isolated islets [ 1113 ] . moreover , inhibition of cox-2 activity was shown to protect -cell function in inflammatory factor stimulus and increased basal insulin secretion [ 12 , 13 ] . in view of the important role of cox-2 in the occurrence and development of diabetes mellitus , it is necessary to progress in - depth studies on the molecular mechanisms involved in the regulation of cox-2 gene expression . at present , the cox-2 promoter region contains a canonical tata element and a number of cis - activating consensus sequences , including camp responsive element ( cre ) , e - box , nf - il6 ( ccaat / enhancer - binding protein- ) , ap-2 , sp-1 , nf-b , and stat sites [ 1421 ] . the specific transcription factors involved in cox-2 activation are dependent on both cell type and stimulus . for example , ap2 , nf - il-6 , and cre elements are essential for il-1-induced activation of the cox-2 gene in human microvascular endothelial cell line , hmec-1 . moreover , nf-b transcription factor mediates the induction of cox-2 by interleukin-1 in rheumatoid synoviocytes . we previously demonstrated that transcription factor elk-1 significantly upregulated cox-2 gene promoter activity and identified several putative binding sites for elk-1 . the ets gene family conserves an 85-amino acid dna - binding ets domain that binds the consensus sequence 5-gga ( a / t)-3 in the promoter region of the target genes and has various biological functions , including control of cellular proliferation , differentiation , hematopoiesis , apoptosis , tissue remodeling , angiogenesis , and transformation [ 2428 ] . previous studies showed that most of the ets family members including elk-1 are important substrates of the mapks , the pi3 kinases , and ca2 + specific signaling pathways , which can be activated by growth factors or cellular stress . other studies confirmed that inducible cox-2 expression is related to the activation of the mapks signaling pathway [ 30 , 31 ] . thus , transcription factor elk-1 may be an important bridge between the external stimuli and the induction of cox-2 gene expression . the aim of this study was to investigate the relationships between elk-1 and cox-2 . to check the relevance of our hypothesis , we first investigated the effects of elk-1 on cox-2 transcriptional regulation and expression in the pancreatic -cell line ins-1 . we thus undertook to study the binding of elk-1 to its putative binding sites in the cox-2 promoter . we also analysed glucose - stimulated insulin secretion ( gsis ) in ins-1 cells that overexpressed elk-1 . ins-1 cells were grown in rpmi 1640 medium containing 11.1 mm glucose supplemented with 10% fetal bovine serum , 10 mm hepes , 2 mm l - glutamine , 1 mm sodium pyruvate , 50 m -mercaptoethanol , 100 iu / ml penicillin , and 100 g / ml streptomycin in a humidified atmosphere ( 5% co2 , 95% air ) at 37c . the elk-1 expression plasmid ( pcmv3.0b - elk-1 ) and luciferase reporter construct containing the rat cox-2 promoter ( 2026/+44 ) were constructed in our previous study . two mutant constructs containing the sequence 2026/+44 in which nucleotides 82 to 69 were deleted or mutated from cgaggcggaaagac to cgaggcaagaagac were made by using the quikchange ii site - directed mutagenesis kit ( stratagene ) according to the manufacturer 's instructions . the constructs were named pcox-2 ( 2026/+44 , del82/69 ) and pcox-2 ( 2026/+44 , m82/69 ) , respectively . all constructs were verified by dna sequencing . transfections were performed using lipofectamine 2000 ( invitrogen ) according to the manufacturer 's protocol . for luciferase assay each transfection was performed using 0.8 g luciferase reporter construct , 0.8 g elk-1 expression plasmid or pcmv3.0b empty vector as control , and 4 ng renilla luciferase reporter vector , prl - sv40 , as an internal control ( promega ) . 48 h after transfection , cells were washed with pbs and lysed using 1 passive lysis buffer . firefly and renilla luciferase activities were measured with a glomax-20/20 luminometer ( promega ) using the dual - luciferase reporter assay system ( promega ) . each experiment was performed in triplicate and independently repeated three times . to explore the effect of elk-1 on endogenous cox-2 expression and glucose - stimulated insulin secretion of ins-1 cells , cells were transiently transfected with elk-1 expression plasmid pcmv3.0b- elk-1 or empty vector pcmv3.0b as control . 48 h after transfection , the cells were harvested for quantitative real - time rt - pcr or western blot analysis , or proceed to glucose - stimulated insulin secretion ( gsis ) assay as follows . total rnas of ins-1 cells were prepared by trizol reagent ( invitrogen ) according to the manufacturer 's protocol . after spectrophotometry quantification , 1 g of total rna was used for reverse transcription ( rt ) in a 20 l final volume with iscript cdna synthesis kit ( bio - rad ) according to the manufacturer 's instructions . quantitative real - time pcr was performed using taqman gene expression assays ( applied biosystems ) in a steponeplus real - time pcr system ( applied biosystems ) . the reactions were performed in a volume of 10 l containing 1 l diluted cdna , 20 taqman gene expression assay mix , and 2 taqman universal pcr master mix . the thermal cycling conditions comprised an initial denaturation step at 95c for 10 min , 40 cycles at 95c for 15 s , and 60c for 1 min . the taqman gene expression assay mix used for elk-1 and cox-2 had the product number rn01756649_g1 and rn01483828_m1 . rat -actin ( product number rn00667869_m1 ) was used to calibrate the original concentration of mrna . the mrna concentration was defined as the ratio of target mrna copies relative to gapdh mrna copies . ins-1 cells were lysed in ice - cold lysis buffer containing the following reagents : 50 mm tris - hcl ph 7.4 ; 1% np-40 ; 150 mm nacl ; 1 mm edta ; 1 mm pmsf ; complete proteinase inhibitor mixture ( 1 tablet per 10 ml , roche ) . protein concentration in the cell lysate was quantified using the dc protein assay kit ( bio - rad ) . protein aliquots were electrophoresed by 12% sds - page and transferred to pvdf membrane ( millipore ) . nonspecific protein interactions were blocked by incubation in 5% nonfat dry milk in tbst buffer ( 20 mm tris - hcl , 150 mm nacl , and 0.1% tween 20 ( ph 7.6 ) ) at room temperature for 1 h and then washed with tbst . membranes were then incubated at 4c overnight with anti - elk-1 ( santa cruz ) , anti - cox-2 ( santa cruz ) , or anti--actin ( santa cruz ) antibodies in fresh blocking buffer . the blots were washed and then incubated with hrp - conjugated secondary antibodies ( amersham ) for 1 h at room temperature . the bands were visualized with immobilon western chemiluminescent hrp substrate ( millipore ) using x - ray film ( kodak ) . the densities of the bands on the western blot were analyzed with quantity one software ( bio - rad ) . elk-1 specific small interfering rna ( sirna ) and negative sirna were synthesized by genepharma . the sequences were as follows : elk-1 sirna-1 , 5-ggccagaaguuugucuacatt-3 ; sirna-2 , 5-aggccaagguggcuuagcatt-3 ; sirna-3 , 5-gccauccuaacagagaauatt-3 ; negative sirna , 5-uucuccgaacgugucacgutt-3. ins-1 cells were transiently transfected with sirna using neofx reagent ( ambion ) according to the manufacturer 's protocol . 48 h after transfection , the cells were harvested for real - time rt - pcr or western blot analysis as described above . nuclear extracts were isolated from ins-1 cells with ne - per nuclear and cytoplasmic extraction reagents ( pierce ) according to the manufacturer 's instructions . emsa was performed using dig gel shift kit ( roche ) according to the manufacture 's protocol . the sense probe sequences for emsa were as follows : wild - type probe 1 , 5-aaagccgaggcggaaagacacagt-3 , which corresponds to nucleotide 87 to 64 of rat cox-2 promoter ; wild - type probe 2 , 5-ttcggtagtttccgaagggctgtt-3 , which corresponds to nucleotide 1300 to 1277 of cox-2 promoter ; wild - type probe 3 , 5-accacccatttccgaccccccacc-3 , which corresponds to nucleotide 1824 to 1801 of cox-2 promoter ; mutant probe 1 , 5-aaagccgaggcaagaagacacagt-3. double - stranded probes were synthesized , and the 3-end of wild - type probe was labelled with digoxigenin-11-ddutp . nuclear extracts ( 5 g protein ) were incubated with 1 g poly[d ( i - c ) ] , the binding buffer attached to the kit , and dig - labelled wild - type probe for 15 min at room temperature . bound dna complexes were separated on a 5% nondenaturing polyacrylamide gel electrophoresis and transferred to a nylon membrane ( roche ) . the nylon membranes were cross - linked , and chemiluminescent detection was performed using cspd , and signals were recorded on x - ray film . in supershift analyses , elk-1 antibody ( 3 g ; santa cruz ) was added to nuclear extracts in gel shift buffer ( above ) for 1 h at 4c , followed by addition of probe , and the subsequent protocol was the same as above . one day before transfection , ins-1 cells ( 2 10 ) were seeded into 500 l rpmi 1640 medium with standard glucose concentration ( 11.1 mm ) in 24-well cell culture plates . the cells were transfected with elk-1 expression plasmid pcmv3.0b- elk-1 or empty vector pcmv3.0b as control for 48 h as described above . after incubation for 1 h in glucose - free krebs - ringer bicarbonate ( krb ) buffer ( 115 mm nacl , 4.7 mm kcl , 1.2 mm mgso47h2o , 1.2 mm kh2po4 , 20 mm nahco3 , 16 mm hepes , 2.56 mm cacl2 , and 0.2% bsa ) , the cells were treated for 1 h in krb buffer with low ( 3.3 mm ) and high ( 16.7 mm ) glucose . the supernatants were obtained for insulin concentration determination using a rat / mouse insulin elisa kit ( linco research ) . differences in the mean of two samples were analysed by student 's t - test with differences p < 0.05 considered significant . in the previous study , we demonstrated that transcription factor elk-1 significantly upregulated cox-2 gene promoter activity . to explore the effect of elk-1 on endogenous cox-2 gene expression ins-1 cells were transfected either with elk-1 sirnas ( including 3 sirnas ) or control sirna . we measured elk-1 protein levels to select the sirnas that can effectively silence elk-1 expression . as shown in figure 2(a ) , elk-1 sirna-1 effectively silenced elk-1 gene expression ; therefore , we used elk-1 sirna-1 in subsequent experiments . we silenced elk-1 expression in ins-1 cells and then measured cox-2 mrna and protein expression . cox-2 mrna and protein expression levels were significantly decreased with elk-1 rnai ( figures 2(b ) , 2(c ) , and 2(d ) ) . based on sequence analysis , rat cox-2 promoter region contains three predicted consensus binding sites for elk-1 , which correspond to promoter region of 82/69 , 1295/1282 , and 1819/1806 , respectively . to confirm whether elk-1 can bind to these three sites , we synthesized and labelled the oligonucleotides spanning the three regions and additional five nucleotides on each side ( i.e. , 87/64 , 1300/1277 , and 1824/1801 ) and used them as probes in emsa experiments . as shown in figure 3(a ) ( lane 2 ) , a slower - migrating complex appeared when ins-1 nuclear extracts were incubated with the digoxigenin-11-ddutp - labelled wild - type probe 1 ( 87/64 of cox-2 promoter ) , but not probe 2 and probe 3 ( 1300/1277 and 1824/1801 ) , indicating that 82/69 region is the binding site for elk-1 . the slower - migrating complex was significantly inhibited by a molar excess of unlabelled wild - type probe 1 ( figure 3(b ) , lanes 3 and 4 ) . in contrast , the unlabelled mutant probe 1 reduced the inhibitory effect ( figure 3(b ) , lanes 5 and 6 ) . to determine if elk-1 is responsible for the shift seen in emsa , elk-1 antibody was added to the emsa - binding reaction , and the complex can be supershifted by the addition of elk-1 antibody ( figure 3(b ) , lane 7 ) . by transient cotransfections , we showed that overexpression of elk-1 led to a significant increase in relative luciferase activity of cox-2 promoter ( figure 4 ) . the contribution of the elk-1 binding site was studied by site - directed mutagenesis in ins-1 cells . when the 82/69 elk-1 binding site on the 2026/+44 region was deleted or mutated , the enhanced effect of elk-1 was deeply reduced ( figure 4 ) . this suggested that the 82/69 elk-1 binding site is implicated in the enhancement of cox-2 promoter by elk-1 . to determine the effect of elk-1 on gsis function in pancreatic -cells , we performed experiments with elk-1 overexpressing ins-1 cells . as shown in figure 5 , control cells secreted 87.00 1.74 ng insulinhmg protein and demonstrated a 6.9-fold increase in insulin secretion with 16.7 mm glucose , whereas elk-1 overexpressing cells secreted 45.37 2.50 ng insulinhmg protein and demonstrated a 3.6-fold increase in insulin secretion ( p < 0.001 versus control ) . therefore , elk-1 overexpressing group demonstrated a decrease of gsis to 52% of the control value . upregulation of cox-2 expression is involved in various physiological and pathological conditions , including pancreatic -cell dysfunction . previous studies indicated that cox-2 activation might play a pathogenic role in diabetes [ 3234 ] , and cox-2 inhibition can protect rat islets from cytokine - induced inhibition of glucose - stimulated insulin secretion , implicating the important role of cox-2 in cytokine - mediated -cell dysfunction and diabetes development . thus , understanding the molecular mechanisms involved in the regulation of cox-2 gene expression in -cells will help to better understand and restrain the dysfunction of pancreatic -cell . cox-2 expression is regulated by the binding of specific transcription factors to cis - acting elements on the cox-2 promoter . several studies showed that some stimuli could upregulate cox-2 expression , and in these studies , the expression and activity of elk-1 were also increased [ 3638 ] , indicating the potential role of elk-1 in cox-2 regulation . in our previous study , we demonstrated that elk-1 significantly upregulated cox-2 promoter activity . but how elk-1 participates in the regulation of cox-2 expression has not been researched so far . in this study , we investigated the effects of elk-1 on cox-2 gene expression and gsis function in ins-1 rat insulinoma cells and explored whether elk-1 regulates cox-2 expression through its potential binding site in cox-2 promoter . overexpression study demonstrated that elk-1 overexpression significantly increased cox-2 mrna and protein expression . on the contrary , emsa and site - directed mutagenesis experiments indicated that the effect of elk-1 on cox-2 transcription involves one elk-1 cis - element of cox-2 promoter located between nucleotides 82 and 69 , but not the other two predicted consensus cis - elements ( 1295/1282 and 1819/1806 ) . these results suggested that elk-1 probably upregulates cox-2 gene expression at least partly through elk-1 directly binding to the 82/69 region of cox-2 promoter . this was the first report that characterized the elk-1 cis - element in cox-2 promoter . to further investigate the role of elk-1 on pancreatic -cells dysfunction , we assessed gsis function in ins-1 cells that overexpressed elk-1 . as expected , elk-1 overexpressing group demonstrated a decrease of gsis to 52% of the control value . because cox-2 plays an important role in -cell dysfunction and elk-1 can upregulate cox-2 gene expression , we presumed that elk-1 inhibits gsis in ins-1 cells at least partly through upregulating cox-2 gene expression . other unknown mechanisms of elk-1 's inhibitory role on gsis remain to be determined by further experiments such as chromatin immunoprecipitation ( chip ) sequencing , transcriptome sequencing , and gene array . in conclusion , our study demonstrated that transcription factor elk-1 efficiently upregulates the expression of cox-2 in ins-1 cells and that this may be a new explanation for the mechanism of -cell insulin secretion impairments by some stimuli . these findings will be helpful for better understanding the transcriptional regulation of cox-2 in pancreatic -cell . moreover , elk-1 , the transcriptional regulator of cox-2 expression , will be a potential target for the prevention of -cell dysfunction mediated by pge2 . | cyclooxygenase-2 ( cox-2 ) expression is associated with many aspects of physiological and pathological conditions , including pancreatic -cell dysfunction .
prostaglandin e2 ( pge2 ) production , as a consequence of cox-2 gene induction , has been reported to impair -cell function .
the molecular mechanisms involved in the regulation of cox-2 gene expression are not fully understood .
we previously demonstrated that transcription factor elk-1 significantly upregulated cox-2 gene promoter activity . in this report , we used pancreatic -cell line ( ins-1 ) to explore the relationships between elk-1 and cox-2 .
we first investigated the effects of elk-1 on cox-2 transcriptional regulation and expression in ins-1 cells .
we thus undertook to study the binding of elk-1 to its putative binding sites in the cox-2 promoter .
we also analysed glucose - stimulated insulin secretion ( gsis ) in ins-1 cells that overexpressed elk-1 .
our results demonstrate that elk-1 efficiently upregulates cox-2 expression at least partly through directly binding to the 82/69 region of cox-2 promoter .
overexpression of elk-1 inhibits gsis in ins-1 cells .
these findings will be helpful for better understanding the transcriptional regulation of cox-2 in pancreatic -cell .
moreover , elk-1 , the transcriptional regulator of cox-2 expression , will be a potential target for the prevention of -cell dysfunction mediated by pge2 . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cervical cancer is the second most common cancer in women worldwide , but it is the first in most developing countries , where 80% of cases occur and only 5% of the at - risk population are screened [ 2 , 3 ] . further , cervical cancer is the leading cancer - related cause of death in african women . certain human papillomavirus ( hpv ) genotypes , such as hpv 16 and 18 , have clearly been shown to be obligate causative agents in the development of cervical cancer . overall , hpv-16 and hpv-18 account for approximately 70% of all cervical cancer diagnosed worldwide each year [ 5 , 7 ] . hpv genotypes 6 and 11 are associated with genital warts ( condyloma aciminata ) and are not linked to cervical cancer or its precursor lesions . several hpv vaccines , including the now commercially available vaccine against hpv genotypes 6 , 11 , 16 , and 18 , have been shown to reduce the acquisition of infection and clinical disease caused by these hpv genotypes and likely will lead to reductions in cervical cancer and its precursor lesions [ 810 ] . . in sub - saharan africa , for instance , where two thirds of the world 's hiv - infected population live , hpv types vary by country and hiv status and differ significantly from hpv types seen in other regions of the world , possibly in part due to geographic and genetic variation in hla haplotypes [ 1115 ] . multiple prospective studies have demonstrated that women with hiv infection are much more likely than hiv - negative women to have persistent hpv , often with oncogenic subtypes [ 1618 ] . it has been estimated that a vaccine against hpv types 16 and 18 would theoretically prevent 71% of cervical cancers worldwide , but would preferentially favor asia and north america over africa and south america . to our knowledge , there are no data in cameroon on hpv prevalence or genotypes . this pilot study seeks to describe the prevalence of hpv genotypes in hiv - positive and hiv - negative fertile cameroonian women , to determine risk factors for hpv utilizing a culturally appropriate questionnaire and to assess the association of hpv types , squamous intraepithelial lesions ( sil ) , hiv , and other reproductive tract infections . this study was approved by both the institutional review board of meharry medical college and the cameroon baptist convention health board ( cbchb ) . between june 2005 and march 2006 sixty - five women age eighteen and over were enrolled from two cbchb clinical sites baptist hospital mutengene and etoug - ebe clinic in yaounde . women were recruited from both antenatal clinics and existing hiv positive women 's support groups . women were excluded if they had never been pregnant , had a hysterectomy , were in active labor , had abnormal bleeding , had placenta previa , or were unwilling to undergo hiv testing . the study was explained to patients either in english , french , or pidgin english . similarly , informed consent was obtained in english or french by clinic nurses or midwives . participants were then asked to complete a questionnaire designed to elicit demographic characteristics , obstetric , contraceptive and sexual history , and current genital tract symptoms . women , and their partners if necessary , were treated free of charge for reproductive tract infections ( rtis ) when clinically indicated in accordance with world health organization published guidelines . participants were counseled on low - risk sexual behavior and provided with contraceptive counseling , and/or condoms if needed . an ophthalmic sponge , zyomed treace ( orlando , fl ) , was placed directly into the cervical os . the spears were allowed to absorb cervical secretions for approximately 30 seconds after which time they were placed in an eppendorf tube and immediately placed on ice , before they were transported on dry ice to the university of south dakota for possible later cytokine analysis under the direction of dr . after introduction of a clean , nonlubricated speculum , the endocervical secretions were collected as previously described in with an ayres spatula and cervical brush ( or dacron swab , if the patient was in the last trimester of pregnancy ) and placed it in preservcyt ( cytyc corporation , marlborough , ma ) . thin prep smears were sent to the university of kansas medical center , where they were reviewed by a cytotechnologist under the direction of dr . thin prep abnormalities were classified according to the bethesda classification system . testing for neisseria gonorrhoeae ( ng ) and chlamydia trachomatis ( ct ) was performed off of the thin prep sample as previously described . next , a sample for hpv testing was collected with a cervical brush or dacron swab , placed in a specimen treatment medium ( stm ; digene corporation , silver spring , md ) , and sent to the south dakota health research foundation at the university of south dakota , where the hpv typing proceeded under the direction of dr . briefly , the sample was precipitated and centrifuged , and the pellet dried and resuspended . hpv detection and typing was carried out using a polymerase chain reaction- ( pcr- ) based reverse - line strip test for hpv types 6 , 11 , 16 , 18 , 26 , 31 , 33 , 35 , 39 , 40 , 42 , 45 , 5159 , 66 , 68 , 73 , 82 , 83 , and 84 . if the participants consented , any residual specimens were stored for possible additional testing related to reproductive tract infections . all transported specimens were frozen at 0 degrees celsius due to logistical problems and shipped at 20 c using dry ice according to international standards . only if a patient complained of , or had signs of an abnormal vaginal discharge or pelvic infection , did we collect a vaginal pool specimen and place it in a test tube containing saline and send it to the on site lab to test for ph , wet saline preparation for t. vaginalis and bacterial vaginosis , and potassium hydroxide ( koh ) prep for candida . ( epithelial cells completely covered with coccobacilli to the extent that the cell borders are obscured ) constituting more than 20% of vaginal epithelial cells per high power field , and a ph of > 4.5 . all participants without documentation of hiv or syphilis tests within 6 months underwent testing after pretest counseling . a serial testing protocol of up to 3 rapid hiv tests was used to determine hiv status as previously described in . our lab used the determine hiv-1/2 ( abbott laboratories , tokyo , japan ) and the determine syphilis test , both of which produce results in 15 minutes . patients with a negative determine hiv result were counseled as negative , were told about the window period , and advised to have a repeat hiv test in 36 months . the laboratory performed a sd bioline hiv 1/2 3.0 rapid hiv test ( standard diagnostics , inc . , kyonggi - do , korea ) on all patients with a positive determine test . if determine and bioline tests were both positive , the patient was posttest counseled as positive . if determine and bioline test results were discrepant , the laboratory performed a 3rd tie breaker test ( hexagon hiv , human gmbh , germany ) and the patient was counseled according to the result of that test . data were analyzed using spss 15.0 ( spss inc , chicago , il , usa ) . simple frequency analyses , fisher 's exact test , and chi - square tests were used . sixty - five women were enrolled in the study , 36 in the antenatal group and 29 in the support group . the median age was 27 years in the antenatal group and 29 in the support group , respectively . 8.3% of the antenatal participants tested positive for hiv while 100% of the support group participants tested hiv positive . the women did not differ with respect to education , marriage status , husband 's number of wives , age at sexual debut , or cell phone ownership which was used as a surrogate marker for income . however , over 50% of the antenatal participants reported never using condoms and over 80% reported never or only seldom using condoms during sex . similarly , only 35% of known hiv positive women participants from the support group reported using condoms often ( table 1 ) . overall , out of the 65 women who signed consent forms , 4 had no evidence of specimens in their transport media . the most common low risk types detected out of all analyzed specimens were : 62 ( 20.0% ) , 11 ( 18.5% ) , 6 ( 15.4% ) , 70 ( 12.3% ) , and 61 ( 10.8% ) . the most common high risk types encountered were : 45 ( 24.6% ) and 58 ( 21.5% ) . the data is presented by frequency of hpv type detected as a percentage of all women in the study ( hpv positive and negative ) as shown in figures 1 and 2 . thirty - five out of the 41 women ( 85.4% ) who tested positive for hpv had more than one hpv subtype identified , while 32 out of 41 ( 78% ) had at least one high risk subtype identified . twenty - eight out of 41 , or 68.3% , with hpv isolated had subtype 6 , 11 , 16 , or 18 which are currently carried in the commercially available hpv vaccine . those who tested positive for the high risk subtypes carried in the current vaccine ( subtypes 16 or 18 ) totaled 7 out of 41 , or 17.1% ( see table 2 ) . in comparing hiv - negative to hiv - positive participants , hiv positive women were more likely to have tested positive for any hpv , have more than one hpv subtype , and to test positive for the high risk hpv subtypes than their hiv - negative counterparts when analyzed using the chi - square statistic with a significant p - value defined as < .05 . they were also more likely to have one of the hpv subtypes covered in the current quadrivalent hpv vaccine , although not when including subtypes 16 and 18 only . atypical squamous cells of unknown significance ( ascus ) , low grade squamous intraepithelial lesions ( lgsils ) , and high grade intraepithelial lesions ( hgils ) represent increasing degrees of hpv - related cellular change and are precancerous lesions . women who were hiv positive with high risk hpv were more likely than hiv negative women with high - risk hpv to have abnormalities on thin prep evaluation , even after controlling for the effect of high risk hpv on thin prep abnormalities using chi - square analysis ( p - value for hiv positive .013 , for hiv negative .235 ) ( table 3 ) . surprisingly , we did not encounter any high - grade intraepithelial lesions in either group . our pilot study results add to a rich body of literature demonstrating that hpv types other than those included in the quadrivalent vaccine are being encountered in many african countries . in a recent international meta - analysis , including 5 african studies , clifford et al . found that the proportion of hpv prevalence attributable to hpv-16 was lower in hiv - positive women , including those with hgsil , than in the general population and that other high - risk types ( e.g. , hpv-18 , 31 , 33 , 51 , 52 , and 58 ) were also prevalent [ 26 , 27 ] . muoz et al . demonstrated from pooled analyses of data from an international survey of hpv types in cervical cancer and from a multicenter case - control study that a higher proportion than usual of hpv-45 was found in sub - saharan africa . similarly , sahasrabuddhe et al performed hpv typing on 145 nonpregnant hiv - positive zambian women and found that , among the high - risk types , hpv types 52 , 58 , and 53 were more common than hpv types 16 and 18 . as many others have recently demonstrated , hpv subtypes other than 16 and 18 are clearly playing a role in international hpv prevalence [ 2932 ] . we found that the known oncogenic subtypes 45 and 58 were significantly more prevalent than subtypes 16 and 18 . with increasing numbers of hiv - infected women in sub - saharan africa now accessing life - prolonging antiretroviral therapy , these women may now live long enough to be at higher risk for developing cervical cancer [ 33 , 34 ] . our finding has implications in the incipient application of the prophylactic hpv vaccine containing the high risk subtypes 16 and 18 in countries where cervical cancer prevalence continues to be much higher than it is here in the united states . there has been encouraging yet far from conclusive data to suggest that , because of closely related dna genomes between hpv types , there may be hpv type cross - protection afforded by the quadrivalent vaccine [ 36 , 37 ] . we noted a prevalence of hpv in our study of 67.2% with 85.4% having more than one hpv type and 78.0% having one of the high risk subtypes . this is at the higher end of previous comprehensive estimates in similar hiv - positive female populations [ 2932 , 38 , 39 ] which have reported 1279% of study participants with more than one hpv subtype . our high prevalence may be reflective of the immunosuppression caused by concomitant infection with hiv . unfortunately , our study did not include measurements of either cd4 counts or hiv viral rna to further investigate this possibility . most hiv - positive women in our study never had such testing and thus analyses between hpv and hiv progression were not feasible . although our study set out to determine possible interactions between hpv , hiv , and other reproductive tract infections , we were not able to accurately assess our participants for gonorrhea or chlamydia due to a delay in transferring the thin prep samples to appropriate testing media within 7 days , as is recommended by the manufacturer ( cobas amplicor ct / ng test , hoffmann - la roche inc , basel , switzerland ) . however , we did not detect a significant number of syphilis , trichomonas , bacterial vaginosis , or vaginal candidiasis infections ( data not shown ) . our study is further limited by the small number of participants enrolled as it was designed as a pilot study . we were still able to demonstrate , however , that hiv - positive women are more likely to test positive for hpv , have more than one hpv type , and to be infected with high risk hpv than their hiv - negative counterparts . this may be explained by the impact of hiv on the host 's immune system resulting in impaired hpv clearance , leading to chronic hpv infection . the higher number of hpv types encountered by the hiv - positive women in our study may be attributed to hiv - mediated upregulation and persistence of hpv [ 3941 ] or repeated hpv exposure in the setting of severe immunosuppresion . even after controlling for the effect of high risk hpv on thin prep findings we can not explain why no participants demonstrated hgsil , as previous studies from senegal ( 11% ) and burkina faso ( 3.8% ) did demonstrate a significant number of hiv positive women with hr - hpv to have hgsil [ 30 , 38 ] . fortunately , ascus or lgsil lesions are more likely to regress rather than progress towards cervical cancer . our study was not designed to conduct repeat testing for hpv which would allow us to further assess progression of cervical lesions or assess whether previously noted hpv types persisted or were cleared and whether new hpv types would be encountered . overall our pilot study includes cameroon in the growing list of african countries where hpv types differ from those currently included in the prophylactic vaccine . with increasing numbers of women living with hiv longer , cervical cancer has the potential to increase in incidence and prevalence in countries such as cameroon . further studies are needed to assess whether the current vaccine will be effective in cervical cancer prevention programs in this region . | background .
hpv types vary by country and hiv status .
there are no data on the prevalent hpv genotypes from cameroon . methods .
we conducted a cross - sectional , observational study on 65 cameroonian women .
samples were sent for hpv genotyping and thin prep analyses .
results .
41 out of 61 samples tested ( 67.2% ) had hpv subtypes detected .
the most common high risk types encountered were : 45 ( 24.6% ) and 58 ( 21.5% ) .
hiv - positive women were more likely to test positive for any hpv ( p = .014 ) , have more than one hpv subtype ( p = .003 ) , and to test positive for the high risk subtypes ( p = .007 ) .
of those with high risk hpv , hiv - positive women were more likely to have thin prep abnormalities than hiv - negative women ( p = .013 ) .
conclusions .
oncogenic hpv subtypes 45 and 58 were more prevalent than those subtypes carried in the quadrivalent vaccine .
further studies are needed to assess whether the current vaccine will be effective in this region . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the botulinum neurotoxin ( bont , mr . ~150 kda , types a to g ) , which is produced by various strains of the anaerobic spore - forming bacteria clostridium botulinum , c. butyricum , and c. baratii , is one of the most toxic proteins to humans . bont is the etiologic agent that causes botulism , a severe neurological disease characterized by flaccid paralysis . the most common mechanism of botulism poisoning is through oral ingestion of the toxin contaminated in food . the lethal dose of bont for humans is not known but has been estimated in primate studies ; the estimated lethal amount of crystalline type a toxin ( main ingredient is 19s toxin , see chapter ii-1 ) for a 70 kg human is approximately 0.090.15 ug intravenously or intramuscularly , and 70 ug orally ( reviewed in ) . bont binds specifically to neuronal cells , enters the cytoplasm , and then cleaves the core proteins involved in the vesicular fusion machinery by its metalloprotease activity , thereby blocking the release of neurotransmitters ( reviewed in ) . when produced by the bacterium , the bont is found in complexes ( bont complexes , progenitor toxins ) associated with nontoxic components ( reviewed in [ 37 ] , figures 1(a ) and 2 ) . to cause disease , orally ingested bont in the complexes must take a long journey to reach their targets , the peripheral nerves ( figure 1(b ) ) . the initial obstacle to orally ingested bont entering the body is the epithelial barrier of the digestive tract . although the molecular mechanism by which this large protein toxin crosses the epithelial barrier is not completely defined , recent studies have led to a progressive understanding of the interaction of bont and bont complexes with the epithelial barrier . here , we describe the structure - activity relationship of botulinum toxins ( bont and bont complexes ) and cover recent advances in our understanding of the transport pathway followed by these toxins from the gut lumen to the general circulation across the epithelial barrier . botulinum neurotoxin ( bont / ntx/7s toxin ) is classified into seven serotypes , bont / a through bont / g , on the basis of their immunological properties . in addition , the variation observed in bont protein sequences within the serotypes , at least in serotype a f , has resulted in designations of bont subtypes within a serotype [ 1115 ] . for example , five subtypes of bont / a ( termed a1a5 ) have been identified . subtypes are defined as differing by at least 2.6% at the amino acid level [ 11 , 12 ] . these subtypes bont are produced by the bacterium as complexes ( bont complexes / progenitor toxins ) associated with nontoxic components ( nontoxic neurotoxin - associated proteins , nap ) ( reviewed in [ 37 ] figures 1(a ) and 2 ) . three forms of bont complexes , 12s toxin ( m toxin / m - tc ) , 16s toxin ( l toxin / l - tc ) , and 19s toxin ( ll toxin / ll - tc ) , are the major forms in cultures of the bacteria . 12s toxin is composed of a bont and a nontoxic nonhemagglutinin ( non - toxic non - ha , ntnh , also called as ntnha ; 130 kda ) . 16s toxin is composed of a bont , an ntnh , and several hemagglutinin ( ha ) proteins . 19s toxin has the same components as 16s toxin and is presumed to be a dimer of two 16s toxins linked by one of the ha proteins . c. botulinum type a ( a1 ) strain produces 12s , 16s , and 19s toxins . type g strain produces only 16s toxin ( reviewed in [ 3 , 6 , 7 ] ) . toxin types a , b , e , and f cause botulism in both humans and animals , whereas types c and d cause botulism mainly in animals , but very rarely in humans . type g toxin producing organisms have been experimentally isolated from soil , but no naturally occurring outbreaks of botulism caused by type g toxin have been reported ( reviewed in [ 1 , 7 ] ) . in this review , when it is not suitable to use the precise terms , bont and bont complex ( i.e. , bont plus nap ) , we will use the term botulinum toxin which means either bont or bont complex . bont is synthesized as single - polypeptide chains of ~150 kda but must be posttranslationally modified by a bacterial or tissue protease for activation ( reviewed in ) . the active form of the toxin consists of a light chain ( l , 50 kda ) and a heavy chain ( h , 100 kda ) . the chains remain covalently and reversibly linked by a disulphide bond until exposed to reducing conditions , such as in the nerve cytosol . the l chain is a zinc endopeptidase , which cleaves the snare proteins vamp ( vesicle - associated membrane protein / synaptobrevin ; cleaved by bont / b , d , f , and g ) , which is located in sv ( synaptic vesicles ) , and snap-25 ( 25 kda synaptosome associated proteins ; cleaved by bont types a , c , and e ) and syntaxin ( cleaved by bont / c ) , which are expressed mainly in the plasma membrane . the h chain is composed of two domains and serves as the vehicle that delivers the l chain into the cytosol of neuronal cells . the carboxy - terminal part of the h chain ( hc ) is mainly responsible for neurospecific binding via its interaction with specific gangliosides and protein receptors ( dual - receptor model , reviewed in [ 2 , 10 ] ) . regarding protein receptors , synaptic vesicle protein 2 ( sv2 ) has been proposed to be a protein receptor for bont / a ( all three isoforms sv2a , b and c , sv2c ) , bont / e ( sv2a and b ) and bont / f ( sv2a , b and c ) , while synaptotagmin i and ii ( syt - i an -ii ) have been identified as protein receptors for both bont / b and bont / g [ 2127 ] ) . in contrast , bont / c and bont / d seem to only interact with gangliosides ( gd1b and gt1b ) and phosphatidylethanolamine , respectively . the aminoterminal part of the h chain ( hn ) is thought to mediate translocation of the l chain from the lumen of an acidic intracellular compartment into the cytosol [ 2931 ] . information from the crystallographic structures of bont [ 3237 ] , cocrystallographic structures of bont with their snare substrates [ 3840 ] , and cocrystallographic structures of bont with receptors [ 4144 ] have revealed the details of these interactions at the atomic level . the nontoxic components ( nap ) of 12s and 16s toxins are composed of an ntnh and an ntnh with several ha proteins , respectively . the bont dissociates from nap in slightly alkaline conditions ( higher than ph 7.2~8 ) ( reviewed in ) . ntnhs are produced by all types ( strains ) of c. botulinum and are the most conserved proteins in the botulinum neurotoxin complex ( their amino acid identity level is 76~83.5% ) ( reviewed in ) . the biological and structural roles of ntnh are not completely understood , although it is believed that they confer resistance to proteolysis in the gastrointestinal tract ( reviewed in , for type d ntnh ) . the ha component consists of three different proteins : ha1 ( also referred to as ha-33 in types c and d , ha-34 in type b , and ha-35 in type a , based on their molecular weight ) , ha2 ( also referred to as ha-15 in type a , ha-17 in types c and d , and ha-18 in type b ) , and ha3 ( also referred to as ha-70 , a precursor form of ha3a and ha3b ) ) . the 12s toxin is composed of a bont and an ntnh at a 1 : 1 ratio ( reviewed in [ 3 , 6 , 45 ] ) . 16s toxin results from the assembly of a bont , an ntnh , and ha proteins ( ha1 , ha2 , and ha3 ) at a presumed 1 : 1 : 6 : 3 : 3 or 1 : 1 : 4 : 4 : 2 ratio [ 47 , 48 ] . the x - ray crystallographic structures of ha1 ( type c [ 49 , 50 ] , type a ) , ha1-ha2 complex ( type d ) , and ha3 ( type c ) have been determined . furthermore , recent transmission electron microscopy studies of type d 16s toxin suggest an ellipsoidal - shaped structure with 3 extended arms . other such studies will provide valuable information for understand the precise three- and four- dimensional structures of 12s and 16s toxin , although the crystallographic structures of these bont complexes have not yet been elucidated . botulinum toxin can not penetrate intact skin , but the toxin is absorbed from mucosal surfaces or a wound ( reviewed in ) . in food - borne botulism and in intestinal botulism ( infant and adult , botulinum toxins are produced from c. botulinum and other bont producing clostridia , which colonize the lumen of intestine ) , the toxins are absorbed from the digestive tract . during naturally occurring food - borne botulism , abdominal cramp , nausea , vomiting , or diarrhea these gastrointestinal symptoms are thought to be caused by other bacterial metabolites and may not occur if pure botulinum toxins are contaminated in foods ( reviewed in ) . experiments using ligated intestinal loops of animals and purified botulinum toxins showed that the upper small intestine was found to be the most important site for absorption of these toxins ( reviewed in [ 3 , 8 ] ) . further in vivo experiments using recent imaging technology under physiological conditions ( no ligation ) will provide a more detailed understanding of the sites of the absorption of botulinum toxin in the intestine . after passing through the intestinal epithelium , the toxins first appear in the lymph and then in the blood ( reviewed in [ 3 , 8 ] ) . botulinum toxin can also be absorbed from various mucous membranes , such as the mucous membranes of buccal cavity , stomach , and respiratory systems . the bont alone isolated from bont complexes was found to be only slightly toxic to mice when administrated orally . its oral toxicity increases with the incremental association of the bont with the nap ( for a review , see ) . among six toxin serotypes ( a to f ) , the type b ( strain lamanna ) shows the most marked tendency , 16s toxin is about 1000 times more potent than 12s toxin , and 12s toxin is about 20 times more potent than bont in mice experiments . although the overall mechanism leading to the higher efficacy of the bont complexes is not fully understood , sakaguchi 's group has documented that their greater efficacy is due to the protective effect toward bont of the nap from the low ph and proteases in the digestive tract . sakaguchi 's group also reported that bont complexes do not dissociate in the digestive tract , including the duodenum in spite of the ph being around 7.0 , and the whole toxin complexes seem to be absorbed from the intestine into the lymphatics in rat ligated duodenum loop assay ; then molecular dissociation occurs immediately after bont complexes are absorbed into the lymphatics ( reviewed in ) . it was also reported that nap plays a role in enhancing the neurotoxicity of bont , by a different mechanism from its protective effect against the external environment [ 5760 ] . in vitro experiments showed that bont / a and bont / b bind to polarized human intestinal epithelial cell lines ( caco-2 and t84 ) and undergo a transcytosis pathway from the apical to basolateral side [ 6165 ] . the h chain of the bont is involved in binding and transcytosis in the intestinal cells [ 62 , 64 , 66 ] , and gangliosides ( gd1b and gt1b series ) and sv2 ( or sv2 related protein ) on the intestinal cell surface are possibly involved in this process . it was also reported that an intestinal crypt like cell line derived from mouse ( m - icc12 ) , which expresses a higher amount of sv2c ( or sv2c related protein ) than caco-2 , showed a higher level of binding and passage of bont / a than caco-2 . although the bont transcytosis pathway has not yet been clearly defined , a recent study found that the bont / a c - terminal part of h chain ( hc ) enters preferentially via a cdc42-dependent and clathrin independent pathway in caco-2 and m - icc12 and reaches an early endosomal compartment . several experiments were conducted to investigate the interaction of bont complexes with the intestinal epithelium . experiments using ligated intestinal loops of guinea pigs and type c toxins ( bont , 12s toxin and 16s toxin ) showed that only 16s toxin has a potent and selective binding activity to the microvilli of the upper small intestine via sialic acid residues in cell surface glycoconjugates . this finding suggests the important role of the ha component in intestinal absorption of bont . subsequently , it was shown that type c 16 s toxin , but not 12s toxin or bont , binds and enters ht-29 cells ( a human intestinal epithelial cell line ) via the cell surface sialic acid containing o - liked glycoproteins . when internalized into ht-29 cells , the type c16s toxin appears to be separated to the bont and nap in endosome and the bont can further transferred to the golgi apparatus . in vivo , a substantial amount of ingested progenitor toxins seem to exist in their undissociated forms , at least until the bont complexes reach the luminal side of the intestine ( see section 3.2 ) . these data led us to speculate that the ha in bont complex may play a role in the enhancement of bont absorption from the luminal surface of the intestinal epithelium to the circulating fluids , probably via transcytosis . indeed , it was recently reported that ha1 of the type d 16s toxin may play a critical role in facilitating the passage of bont through caco-2 monolayers . however , it was shown that nap does not facilitate the transcytosis of bont in t84 , caco-2 , and calu-3 ( a human pulmonary cell line ) ( type a [ 55 , 62 , 64 ] type b ) . at present , both of these studies , which propose directly opposite ideas , were done using mainly in vitro cell lines and these systems are not always physiologically relevant . multilateral approaches using such in situ intestinal epithelium of the susceptible species will thus be necessary to role out the function of nap in the transcytosis of bont . since it was demonstrated that type c ha of the bont complex has a binding activity to the carbohydrates on the intestinal epithelial cell surfaces , additional studies have been carried out to characterize the binding property of other types of bont complexes . in type a , ha - positive bont complexes ( mixture of 16s toxin and 19s toxin ) but not 12s toxin show binding activity toward intestinal epithelial cells and erythrocytes , as in the case of type c bont complexes ; whereas , the type a 16s toxin recognizes galactose residues instead of sialic acid residues in the cell surface glycoconjugates of these cells . in agreement with this observation , in erythrocytes , the gal1 - 4glcnac moiety in the cell surface glycoconjugates has been determined as a major ligand for type a ha - positive bont complexes and ha1 ( native ha1 exists in the culture medium ) . in the human intestinal cell line , intestine-407 , the gal1 - 4glcnac ( n - acetyllactosamine ) moiety in the cell surface oligosaccarides has been determined as a major ligand for type a ha - positive bont complexes . studies using recombinant ha proteins showed that ha1 and ha3b have carbohydrate binding activities with different specificities [ 71 , 74 , 75 ] . in type c , the ha1 recognizes neuac2 - 3 gal1- and gal1 - 4 glcnac1- ; whereas , ha3b ( and its precursor form , ha3 ) recognizes neuac2 - 3 gal1- . type c ha1 has been shown to have two -trefoil domains and bears similarities with the plant lectin ricin b - chain in its amino acid sequence and crystal structure . it has been demonstrated that each of these two -trefoil domains ( site i and site ii ) possesses a carbohydrate binding activity by viewing their x - ray crystal structures in complex with their carbohydrate ligands and point mutation analysis . domain bounds wide variety of sugars , such as n - acetylneuraminic acid , n - acetylgalactosamine , and galactose , while site ii -trefoil domain , which is located on the c - terminal side of site i , bounds only galactose and the binding avidity seems to be lower than that of site i. regarding ha3 , a binding site for n - acetylneuraminic acid within type c ha3 has been determined by x - ray crystallography and point mutation analysis . what is the reason for the existence of multiple carbohydrate - binding sites with different specificities in the ha - positive bont complexes ? further studies are needed to clarify whether all of these three carbohydrate - binding sites are accessible in the complex form , whether , and how these carbohydrate - binding activities contribute to the passage of bont across the intestinal epithelial barrier . in 2008 , we found a novel effect of the ha component ; the type b ha disrupts the paracellular barrier of the intestinal epithelium and facilitates the transepithelial delivery of bont and other macromolecules both in vitro ( human intestinal cell lines ) and in vivo ( mouse intestinal loop assay ) . on the other hand , this finding seems not to be in harmony with those reported by sakaguchi who found that nap does not enhance the rate of absorption of bont ( in terms of antigenicity ) in their in vivo rat intestinal loop assay . the discrepancy may be due to species tropism in the action of ha ; type b ha disrupts the paracellular barrier of the mouse , but not rat epithelium in the intestinal loop assay ( manuscript in preparation ) . we also found that type a ha proteins have a similar disrupting activity with a greater potency than type b ha proteins in caco-2 , t84 , and mdck i ( canine kidney epithelial cell line ) . in contrast , type c ha proteins in the toxin complex ( up to 300 nm ) have no detectable effect on the paracellular barrier in these human cell lines . these results indicate the correlation of the species tropism of ha action with the epidemiology of food - borne botulism . therefore , ha action on the intestinal epithelial barrier may at least partially govern the susceptibility of different species to the toxicity of orally ingested bont complexes , and this may be an important factor in the pathogenesis of food - borne botulism . in addition , we found that type c ha has a barrier disrupting activity and potent cytotoxicity in nonhuman originated certain epithelial cell lines ( mdck i , acl-15 , and rcn-9 derived from rat colon carcinomas ) . these data raise the possibility that type c ha induces damage in the intestinal epithelium of susceptible animals , which could allow the toxin complex unrestricted influx into the systemic circulation . however , this evidence about the epithelial barrier disruption provoked by type c ha proteins is limited to in vitro cell lines . further in vivo studies using susceptible animals will provide a better understanding of the pathological roles of this cytotoxic activity . our studies indicated that the type a~c ha proteins present in the 16s toxin act on undefined host molecules , mainly on the basolateral surface , and these induce the loss of the epithelial paracellular barrier without causing cytotoxicity ( types a and b ha ) or the loss of general epithelial barrier function accompanied by cell damage ( types c ha ) , which facilitates the efficient transepithelial - absorption of luminal macromolecules including bont [ 65 , 77 ] . taking into account these findings and other group 's findings , we propose a possible three - step mechanism by which the toxin traverses the intestinal epithelial barrier ( figure 3 ) : step 1 , transport of a small amount of luminally located bont complexes or bont alone [ 6166 ] across the epithelium without disrupting the epithelial barrier via transcytosis ; step 2 , disruption of the epithelial barrier by the ha moiety of the 16s toxin that has translocated to the basolateral surface [ 65 , 77 ] ; and step 3 , accumulation of a large amount of bont complexes ( and bont ) in the serosal side by passing through the damaged epithelial barrier . as previously mentioned , the in vivo relevance of these steps is at present obscure and necessary to be confirmed experimentally . in these few years , significant progress has been made in our understanding of the interaction of botulinum toxin with the intestinal epithelial barrier . it has become clear that the type a , b , and c ha proteins in bont complexes possess a potent ability to disrupts epithelial barrier function and have distinct features in their modes of action . these findings provide an awareness of botulinum ha proteins as pathogenic factors that breach the host defense by direct interaction with the host epithelium , which is presumably linked to the intestinal transepithelial delivery of bont in food - borne botulism of susceptible species . however , the molecular mechanisms by which each type of a~c ha proteins disrupt intestinal epithelial barriers remain unclear . similarly , it is unclear whether the lectin activities of ha 3 and ha1 are involved in these epithelial barrier disrupting activities . overall , there are at least three possible routes taken by botulinum toxin to penetrate the gut epithelium ; route i , ha - mediated transcytosis ( step 1 described in chapter iii-6 , chapter iii-4 ) , route ii , h chain - mediated transcytosis of bont alone ( step 1 described in chapter iii-6 , chapter iii-3 ) [ 6166 ] , and route iii , the route passing from the damaged epithelial barrier caused by ha actions ( step 3 described in chapter iii-6 , chapter iii-5 ) . which route(s ) are taken and to what extent are they involved in the absorption of the toxin in food - borne botulism ? to answer these questions , further studies to elucidate the molecular interactions that occur between the botulinum toxin ( complex ) and the intestinal epithelial barrier and in vivo validation these studies not only will provide an important insight into the molecular mechanisms behind the development of food - borne botulism but also may lead to unique and powerful opportunities to understand the complicated mechanisms for the maintenance and regulation of the epithelial barrier system . moreover , the mechanisms by which botulinum toxin traverses the intestinal epithelial barrier could be exploited to allow delivery of drugs across the epithelium . | botulinum neurotoxin ( bont ) is a protein toxin ( ~150 kda ) , which possesses a metalloprotease activity .
food - borne botulism is manifested when bont is absorbed from the digestive tract to the blood stream and enters the peripheral nerves , where the toxin cleaves core proteins of the neuroexocytosis apparatus and elicits the inhibition of neurotransmitter release . the initial obstacle
to orally ingested bont entering the body is the epithelial barrier of the digestive tract .
recent cell biology and molecular biology studies are beginning to elucidate the mechanism by which this large protein toxin crosses the epithelial barrier . in this review
, we provide an overview of the structural features of botulinum toxins ( bont and bont complex ) and the interaction of these toxins with the epithelial barrier . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
although several techniques have been proposed to achieve consistent and predictable root coverage , by some estimates , the average percentage of covered root surfaces resulting from different procedures performed under varying clinical conditions varies from 56% to 97.8%.[36 ] thus , treatment of buccal recession remains a major challenge to clinicians . many different surgical procedures have been used to achieve root coverage which include pedicle grafts ( lateral sliding or double papillae ) with or without connective tissue grafts , epithelialized autogenous grafts ( free gingival ) , connective tissue grafts , coronally positioned flaps ( cpf ) alone , cpf preceded by a free gingival graft , and cpf with a simultaneous connective tissue graft . each of these techniques results in varying degrees of success and offers a variety of treatments for such defects . the use of subepithelial connective tissue graft ( sctg ) covered by a cpf has shown good predictability . however , it involves a certain degree of discomfort for the patient because of two surgical sites ( palatal donor and recepient sites ) . a study evaluated the treatment of localized gingival recession by cpf ( test ) with or without an sctg ( control ) . the mean root coverage was 98.9% in the test group and 97.1% in the control group . recently , an acellular dermal matrix allograft ( adma ) has been used as a substitute for the keratinized tissue ( kt ) around teeth for the treatment of alveolar ridge deformities and for the root coverage procedures . in vitro and clinical studies suggested that adma is an acellular , non - immunogenic scaffold that heals by repopulation and revascularization , rather than through a granulation process . previous studies compared the results obtained with adma and the sctg for the treatment of gingival recessions . however , a study has shown that the sctg produced a greater mean probing reduction and mean keratinized tissue increase than the adma . hence , the aim of the present study was to clinically evaluate the treatment of gingival recessions ( miller class ii ) by coronally positioned flap ( cpf ) with or without acellular dermal matrix allograft ( adma ) . the patients for the clinical trial were selected from department of periodontics , college of dental sciences , davangere , karnataka . informed consent was taken from all the patients after explaining the procedure and the ethical clearance was obtained from the ethical committee of college of dental sciences , davangere , karnataka , india . ten patients with 20 recession defects ( buccal / labial ) , five males and six females , ranging from 20 to 55 years of age ( mean age 37 years ) with a comparable bilateral class ii gingival recession in maxillary anteriors and premolars in each patient were included in this study . the control group consisted of sites treated with cpf alone and the test group consisted of sites treated with adma and cpf . the patients were consecutively selected from the out - patient department ( opd ) of periodontics , college of dental sciences , who visited the department with the complaint of gingival recession at the sites selected for the study . there was soft tissue coronal to the cementoenamel junction ( cej ) in the interproximal regions . all the teeth were vital because none had been treated endodontically and all were asymptomatic and the sites to be treated had no caries or restoration , smokers were excluded from the study . initial therapy included oral hygiene instructions and scaling and root planning . every effort was made to modify habits that may have contributed to the recession defects . no occlusal therapy was performed in any case as occlusal analysis was within normal limits in all cases included in the study . the measurements included recession height ( rh)---measured from cementoenamel junction ( cej ) to free gingival margin ; recession width ( rw)---measured mesiodistally at the cej level ; probing depth ( pd)---measured from gingival margin to the base of the defect ; clinical attachment level ( cal)---calculated as rh + probing depth ; height of the keratinized tissue ( hkt)---measured from the distance between the most apical point of the gingival margin ( gm ) and the mucogingival junction ( mgj ) ; thickness of keratinized tissue ( tkt ) is measured at midpoint location between gingival margin and mucogingival junction , using periodontal probe after anesthetizing , the straight probe was pierced perpendicularly to the mucosal surface , through the soft tissue until a hard surface was felt . later the straight probe was replaced by graduated periodontal probe ( williams probe ) until hard surface was felt and recordings were made and rounded off to the nearest millimeters . the surgical procedure used was the same for the both groups , except that the control group was treated with cpf and the test group was treated with cpf and adma . after obtaining anesthesia , the exposed root surface was planed to eliminate soft tooth structure , undercuts , ridges , plaque , and calculus . the root biomodification was done with a tetracycline solution ( 125 mg tetracycline / ml of saline ) . the incisions were extended mesially and distally as far as necessary to permit coronally positioning a pedicle graft over the defects . two oblique vertical incisions were extended beyond the mgj and a trapezoidal mucoperiosteal flap was raised up to mgj . after this point , a spit thickness flap was extended apically , to release the tension and favor the coronal positioning of the flap . the epithelium on the mesial and distal papillae was scraped to create a bleeding surface for a recipient bed [ figures 14 ] . preoperative view of maxillary left first premolars reflection of partial thickness flap root biomodification is done and recipient bed is prepared in the test group , an acellular dermal matrix allograft was adapted after being aseptically rehydrated in sterile saline , according to manufacturer 's instruction . a template is prepared and the graft was trimmed to a shape and size of template designed to cover the root surface and the adjacent surrounding bone . the basement membrane side was placed adjacent to bone and tooth and connective tissue side was placed facing the flap . the coronal lateral borders of adm were sutured with sling sutures using resorbable sutures ( ethicon 4 - 0 ) [ figures 5 and 6 ] . the flap was coronally positioned and sutured to completely cover the allograft and protected with a non - eugenol dressing . in the control group , the surgical procedures were similar except for the placement of graft . alloderm is sutured over the defect flap is sutured completely covering alloderm routine post - operative instructions were given to both groups . all patients were seen 2 , 4 , 8 , 12 and 24 weeks post - operative . at 2 weeks post - operative , flossing was not restarted in area until 8 - 12 weeks post - operative . at that point , patients were returned to normal brushing . at 24 weeks post - operative , changes in the vertical and horizontal dimensions in both experimental and control groups were analyzed by intragroup comparisons by the paired the results were also ascertained by nonparametric methods like wilcoxon 's test and mann - whitney test whenever measurements were found to be non - normal . the results were presented as mean standard deviation ( sd ) for all the parameters . pre- and post - operative changes and comparison between test and control groups are summarized in [ table 1 ] . pre- and post - operative changes and comparison between test and control groups there was statistical significant reduction in pd , rh , rw and an increase in cal gain , hkt , and tkt for the test group . for the control group statistically significant reduction was seen only in relation to pd , rh and an increase in cal gain where as rw , hkt , tkt were statistically not significant . however , on comparison between the test and control group , only tkt parameter showed statistically significant result , indicating that acellular dermal matrix has significantly contributed to the thickness in the test group . the test group has mean root coverage of 82.2% and the control group has 53% and the difference was found to be statistically significant . the predictability of root coverage in both test and control groups was 80% and 50% , respectively [ table 2 ] . comparison of percentage root coverage ( % ) and predictability in both experimental and control groups it has been accepted that complete root coverage can be achieved in class ii gingival recessions . this type of defect could be treated with many variations of three basic approaches ; ( 1 ) pedicle soft tissue grafts ; ( 2 ) free soft tissue grafts ; and ( 3 ) combinations of the two . among the pedicle grafts , it has many advantages over other surgical procedures used to treat the gingival recessions : it does not require a separate surgical site to obtain a graft , the tissue of the pedicle provides a perfect color / contour match with the surrounding tissue , the procedure is simple to perform , and does not require extended surgical or recovery time . the association of autogenous connective tissue graft with the cpf is also considered predictable ; however , the second surgical site necessary to harvest the autogenous palatal donor tissue is a serious disadvantage due to increased risk of pain and post - operative hemorrhage . therefore , an adma has been used as an alternative source of donor tissue . the material provides an unlimited supply of graft material that could be particularly helpful when treating multiple recession sites . the present study compared treatment of class ii gingival recessions by coronally positioned flap ( cpf ) with or without acellular dermal matrix allograft ( adma ) . the experimental design included two treatment groups that differed only by the presence of allograft allowing the evaluation of the influence of the graft in the clinical results . the graft was oriented with the basement membrane toward the root surface based in previous reports showing that the orientation of the material did not affect the treatment outcome . in both the groups statistically significant results was obtained with pd , cal , and rh parameters ; however , between the groups statistical significance was not seen . these results are in correlation with the studies done by various authors.[21315 ] these clinical changes probably represent a combination of new connective tissue attachment in the apical half of the defect and the presence of a long junctional epithelium attachment in the coronal half . however , these changes are probably not large enough to be detected or considered important in most clinical situations . it seems more important that in all cases the final results were esthetically pleasing , functionally adequate , and had a healthy sulcus . the rw and hkt were statistically significant only in test and results between the groups for these parameters were not statistically significant . the possible effect of adm in increasing the amount of keratinized gingiva is not clear . however , it is not known why an increase in the amount of keratinized tissue would occur in defects treated with the acellular dermal matrix . the tkt is measured using transgingival probing , as this method was found to be more reliable , cost effective , and compatible at chair side . the increase in the tkt was statistically significant only in the test group and comparison between groups was also statistically significant . the increase in the thickness might be due to integration of the adma graft membrane with the overlying flap . the role of collagen membranes can not be underestimated or overlooked because collagen membranes can increase tissue thickness via membrane integration . a histologic study of adma - treated areas showed the presence of elastin fibers which implies that the adma was incorporated into the tissue , rather than being exfoliated or absorbed . elastin fibers are found in skin and in an adma , but not in gingival and oral mucosa . . a statistically significant root coverage ( 82.2% ) and predictability ( 80% ) associated with the adm group might be due to the presence of collagen , which forms a major portion of the adm graft extracellular matrix . it was found that collagen stimulates platelet attachment , enhances fibrin linkage , and is chemotactic for fibroblasts . it also inhibits the apical migration of epithelium , allowing undifferentiated mesenchymal cells to repopulate the space and promote regeneration resulting in a stable attachment of the covering flap to the previously denuded root surface , thus preventing subsidence of epithelium . during healing period , the adm graft might have acted as a shock absorber , deflecting the undue forces that otherwise would be transmitted to the fragile maturing fibrin clot on the root surface . adm allograft was found to be a biocompatible , non - allergenic , and did not produce any inflammatory response . from the clinician 's point of view , the adm graft eliminates donor site morbidity , offers unlimited tissue availability , and reduces multiple surgeries . clinically , the handling , trimming , adapting , and suturing of the graft is simple and convenient , and it is significantly superior in effectiveness and efficiency in the treatment of gingival recession compared to cpf alone . it may also provide as a useful substitute for connective tissue graft procedures for root coverage . | the aim of the randomized controlled single blind study is to evaluate the treatment of miller 's class ii gingival recessions by coronally positioned flap ( cpf ) with or without acellular dermal matrix allograft ( adma ) .
ten patients with 20 sites with maxillary bilateral miller 's class ii facial recession defects were selected randomly into two groups of test ( adma+cpf ) and control ( cpf alone ) group with each group having 10 recession defects to be treated .
the clinical parameters included plaque index ( pi ) , gingival index ( gi ) , probing pocket depth ( ppd ) , clinical attachment level ( cal ) , recession height ( rh ) , recession width ( rw ) , height of the keratinized tissue ( hkt ) , and thickness of the keratinized tissue ( tkt ) .
these measurements were recorded at baseline and after 6 months post - surgery .
statistical analysis was made by the paired
t
test for intragroup and intergroup comparison was done by the unpaired
t test .
the percentage of root coverage for both the experimental and control groups were 82.2% and 50% , respectively .
the changes from baseline to 6 months were significant in both the groups for pd , cal , and rh ; however , for parameters such as rw , hkt , and tkt significance was seen only in the experimental group .
on comparison between two groups , only tkt showed statistically significance .
it can be concluded that the amount of root coverage obtained with adma + cpf was superior compared to cpf alone . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
receptor tyrosine kinases ( rtks ) constitute a large family of single - spanning membrane proteins found only in metazoans ( robinson et al , 2000 ) . their primary role is to mediate intercellular communication by recognizing extracellular ligands and translating that information into an appropriate cellular response ( schlessinger , 2000 ) . the intracellular region of an rtk contains a tyrosine kinase domain as well as several tyrosine residues that are phosphorylated upon receptor activation . these phosphotyrosines act as relays for information transmission , and the sequences surrounding these sites define signal specificity . intracellular signaling proteins bind to these sites of tyrosine phosphorylation through src homology 2 ( sh2 ) or phosphotyrosine - binding ( ptb ) domains , initiating a variety of signaling cascades within the cell . rtks can elicit diverse and even opposing phenotypic responses , ranging from adhesion to migration , differentiation to proliferation , and survival to apoptosis ( schlessinger , 2000 ; yarden and sliwkowski , 2001 ) . although no two receptors feature identical sequences surrounding their ptyr sites , there is considerable qualitative overlap in the pathways they activate ( fambrough et al , 1999 ; simon , 2000 ) . the ability of rtks to signal through common pathways , yet to induce diverse phenotypic responses , has largely been attributed to differences in cellular context , as signaling proteins are differentially expressed in different cell types ( jordan et al , 2000 ; simon , 2000 ) . for example , fibroblast growth factor receptor 1 ( fgfr1 ) induces differentiation in neuronal cells , but induces proliferation in fibroblasts ( marshall , 1995 ; lin et al , 1996 ) . when expressed in the same cellular background , however , different rtks have also been shown to elicit different phenotypic responses . for example , activation of epidermal growth factor receptor ( egfr ) induces proliferation in pc12 neuronal cells , whereas activation of fgfr1 induces differentiation ( pollock et al , 1990 ; lin et al , 1996 ) . how , then , are intrinsic differences between rtks manifested within the same cell type ? how is that information processed ? to address these questions , we expressed six diverse rtks in the same cellular background and monitored their signaling properties by quantitative immunoblotting . we found that although they activated many of the same signaling proteins , they did so to different degrees . we then used protein microarrays to define a quantitative interaction map for each receptor by measuring the affinity of almost every human sh2 and ptb domain for phosphopeptides representing ptyr sites on the receptors . using partial least - squares regression ( plsr ) , we found that the relative phosphorylation levels of upstream signaling proteins could be accurately predicted using linear combinations of receptor - docking affinities , and that much of the predictive information resides in the docking sites for two central signaling proteins : phosphoinositide 3-kinase ( pi3k ) and shc1 . we also found that the relative phosphorylation levels of downstream proteins could not be predicted using linear models , suggesting that rtk signaling can be segmented into discrete upstream and downstream layers . to determine at a quantitative level how different rtks behave when placed in the same cellular background , we selected six well - studied and phylogenetically diverse rtks : egfr , fgfr1 , insulin - like growth factor 1 receptor ( igf1r ) , hepatocyte growth factor receptor ( met ) , neurotrophic tyrosine kinase receptor type 2 ( ntrk2 ) , and platelet - derived growth factor receptor ( pdgfr ) . six stable cell lines were generated by transfecting the full - length coding region for each receptor into human embryonic kidney flp - in-293 cells , which do not normally express these receptors at appreciable levels ( figure 1a ) . the resulting cell lines grew normally and , in each case , the receptor was produced at 10 copies per cell and activated by its cognate ligand in a dose - dependent manner ( supplementary figure s1 ) . to obtain a broad and quantitative view of how each receptor activates intracellular signaling proteins , the six cell lines were serum - starved for 24 h and stimulated for 5 min with saturating levels of the appropriate ligand . this early time point was chosen because many signaling proteins peak in their phosphorylation levels within the first 10 min of stimulation and because we wanted to capture immediate , receptor - dependent signaling events without additional complications arising from feedback loops and other forms of network regulation . quantitative immunoblotting was then used to measure the relative phosphorylation levels of a wide range of proteins that have previously been implicated in rtk signaling ( figure 1b and c ) . in total , we queried 65 sites of phosphorylation on 57 proteins and observed growth factor - induced phosphorylation of 24 sites on 23 proteins ( supplementary table si ) . to compare the phosphorylation levels of a given protein across the six cell lines , lysate concentrations were normalized , basal phosphorylation was subtracted , and each level was calculated relative to the maximum observed level for that site ( figure 1b ; supplementary figure s2 ; supplementary information ) . some proteins , such as shp-2 and cbl , were phosphorylated in as few as two of the cell lines , while others , such as crkl and p90rsk , were phosphorylated in all six ( figure 1b ) . for every site of phosphorylation , quantitative differences were observed across the six cell lines and the rank order varied depending on the site . thus , although these six receptors have previously been shown to activate many of the same pathways , they do so to different degrees when placed in the same cellular context . what , then , accounts for these differences ? as rtks initiate signaling by recruiting proteins to sites of tyrosine phosphorylation ( schlessinger , 2000 ) , we asked whether there was information in the recruitment properties of the ptyr sites on these receptors that could explain the observed differences . sites of tyrosine phosphorylation are recognized by either sh2 ( sadowski et al , 1986 ) or ptb domains ( kavanaugh and williams , 1994 ) . to obtain a genome - wide , unbiased , and quantitative measure of the recruitment potential of each receptor , we prepared protein microarrays comprising nearly every sh2 and ptb domain encoded in the human genome ( figure 1d ; supplementary table sii ) ( jones et al , 2006 ) . we then probed these arrays with fluorescently labeled , 18-residue phosphopeptides with sequences derived from every known site of tyrosine phosphorylation on each of the six receptors ( supplementary table siii ) . equilibrium dissociation constants ( kd values ) were obtained by probing the arrays with eight concentrations of each peptide and fitting the resulting fluorescence data ( supplementary information ) to an equation that describes saturation binding ( figure 1d ) ( jones et al , 2006 ) . in total , we queried 96 sh2 domains and 37 ptb domains with 47 phosphopeptides and observed 652 interactions with kd2 m ( supplementary table siv ) . when we repeated this process , duplicate kd measurements were in close agreement ( r=0.85 ; supplementary figure s3b ) and the mean kd was used for subsequent analyses . of the 131 domains , 112 domains representing 74 different proteins bound at least one phosphopeptide . as anticipated , there was considerable qualitative overlap between the six receptors : 50 of these proteins recognized peptides from at least three receptors and 21 of them recognized peptides from at least five receptors ( supplementary figure s4 ) . in general , the domains that recognized the most receptors are those found in well - studied signaling proteins , including the lipid - modifying enzyme pi3k ; the transcription factors stat1 and stat2 ; the non - receptor tyrosine kinases src and abl1 ; the guanine nucleotide exchange factor vav2 ; the adaptor proteins crk , crkl , and nck ; and the scaffold proteins shc1 and grb7 . thus , if viewed in strictly binary terms , these phylogenetically diverse receptors differ very little in their recruitment properties with respect to these core signaling proteins . at the quantitative level , however , they differ substantially . for example , although five of the six receptors feature docking sites for the regulatory subunit of pi3k , there is only one low - affinity site ( kd=590 nm ) on igf1r , but there are five sites , including one high - affinity site ( kd=10 nm ) , on pdgfr. quantitative differences in both the number of docking sites and the binding affinities at these sites may therefore explain the observed differences in signaling elicited by each receptor . to test this hypothesis , we represented each phosphopeptide as a row vector of association constants , ka , with each element in the vector corresponding to a different sh2 or ptb domain - containing protein ( figure 1e ) . for proteins that contained two domains that bound the same peptide , the larger ka was used . in addition , the three isoforms of the regulatory subunit of pi3k were treated as a single protein as their sh2 domains behaved similarly . the binding vector for a given receptor was then defined as the sum of its phosphopeptide vectors to take into account the number of docking sites , as well as the affinities at each site . the implicit assumption in adding the phosphopeptide vectors is that multiple docking sites for the same protein within a given receptor act independently of each other . while this is probably not always true , it is the simplest way to combine the data and is a reasonable approximation . in addition , the phosphopeptide vectors were all weighted equally as the relative stoichiometry of phosphorylation at each ptyr site was not known . thus , the intrinsic signaling capabilities of the six receptors was captured in the matrix x , which comprises six rows , one for each receptor , and 74 columns , one for each sh2 or ptb domain - containing protein ( figure 1f ) . in a similar manner , the cellular activity of the rtks was captured in the matrix y , which comprises six rows , one for each receptor , and 24 columns ( y1 y24 ) , one for each phosphorylation site that was monitored by immunoblotting ( figure 1c ) . the simplest connection between the in vitro binding data and the cellular phosphorylation data is a one - to - one relationship in which the degree to which an sh2/ptb - containing protein is phosphorylated correlates linearly with its docking affinities . of the eight proteins for which both microarray and immunoblotting data were obtained , significant correlations were observed for two : shc1 ( r=0.82 , p=0.045 ) and pi3k ( r=0.94 , p=0.0059 ) ( figure 2 ) . these correlations depend heavily on the number of shc1- and pi3k - docking sites on each receptor . if the number of docking sites is taken into account but the affinities are ignored , the correlation actually improves for shc1 ( r=0.99 , p=0.0001 ) , but gets slightly worse for pi3k ( r=0.91 , p=0.013 ) ( figure 2 ) . if the quantitative information is ignored and the interactions are treated as binary , correlations become meaningless as each protein recognized five of the six receptors . these results are consistent with a model in which shc1 and pi3k interact directly with the activated receptors and are not influenced substantially by other docking proteins . the same is not true , however , for the other sh2/ptb - containing proteins that were monitored by immunoblotting ; significant correlations were not observed ( figure 2 ) . for these proteins , the reductionist assumption that they bind directly to the receptor and act independently is too simplistic . some proteins that contain sh2 or ptb domains have been shown to compete with each other for the same ptyr sites ( zhang et al , 2003 ) , and many have been shown to interact with each other and with components of the cell membrane ( schlessinger and lemmon , 2003 ) . are their relationships complex and nonlinear , or can they be approximated using relatively simple models that depend on combinations of docking affinities , rather than on single affinities alone ? the simplest multivariate model is one in which the phosphorylation levels of a given protein , yi , can be predicted using a linear combination of docking affinities . as the number of variables ( docking affinities ) exceeds the number of observations ( rtks ) , we used plsr to regress each yi against x. plsr reduces the dimensionality of x by decomposing it into a small number of orthogonal components that capture most of the covariance between x and yi . each component is a linear combination of docking affinities , weighted by how much they contribute to predicting each immunoblot ( yi ) . we found that four components were sufficient to capture 90% of the covariance with each yi . to guard against overfitting and to assess the predictive value of the docking affinities , we built our models using leave - one - out cross - validation : each model was trained using data from five receptors and then used to predict the immunoblotting data for the sixth receptor based on its docking affinities . this procedure was performed in all six combinations and the cross - validated residual between these predictions and the observed data , q , was calculated . to assess the significance of these predictions , we repeated our calculations 2000 times for each phosphorylation site using randomized x matrices and then calculated p - values for each model . models were built using all of the microarray data , as well as subsets of the data that included only the sh2/ptb - containing proteins that bound at least two receptors , at least three receptors , at least four receptors , or at least five receptors . similar results were obtained in every case , but the significance of the results increased as the number of variables was reduced ( supplementary figure s5 ) . most of the information content in x resides in the 21 sh2/ptb - containing proteins that recognize at least five receptors and hence the results presented below are based on these data alone . of the 24 phosphorylation sites that we monitored by immunoblotting , nine were accurately predicted using linear combinations of docking affinities ( q0.9 ; figure 3a and b ; supplementary figure s6 ) . of these , six passed significance testing ( p0.05 and false discovery rate 0.1 ) . interestingly , all nine of these sites are found on proteins that contain sh2 or ptb domains and therefore represent upstream signaling events ( figure 3b ; supplementary figure s6 ) . moreover , only two phosphorylation sites that occur on sh2/ptb - containing proteins had a q value less than 0.9 : ptyr239/240 of shc1 and pser727 of stat3 . as noted earlier , the relative phosphorylation levels of shc1 can be explained using only the number of shc1-docking sites on each receptor ( figure 2 ) ; combinations of docking affinities are not required . this serine residue is phosphorylated in a protein kinase c - dependent fashion and so represents a downstream signaling event ( aziz et al , 2007 ) . in contrast , tyr705 of stat3 can be phosphorylated by the rtk itself and so represents an upstream event ( hwang et al , 2003 ) ; its phosphorylation is accurately predicted ( q=0.99 ; p=0.03 ; figure 3a ) . similar to pser727 of stat3 , the other 13 downstream signaling events could not be predicted using linear models ( figure 3b ; supplementary figure s6 ) . thus , the phosphorylation sites that we monitored by immunoblotting naturally segregate into two groups : upstream phosphorylation events that are accurately predicted and downstream phosphorylation events that are not . from this , we submit that information processing by rtk signaling networks can be segmented into an upstream layer comprising proteins that are activated in an approximately linear manner through combinations of receptor - docking affinities and a downstream layer comprising proteins that are activated in a nonlinear manner . we note , however , that this result does not prove that the upstream step is linear mechanistically , but rather that this step can be approximated using relatively simple linear models . both the number of docking sites and the docking affinities are important for predicting upstream signaling events . if only the number of docking sites is taken into account , the models perform less well and the results are less significant ( figure 3c ) . if only binary information is used ( proteins are described either to interact or not interact with a receptor ) , all predictions fail as , at this level , the receptors are very similar ( x is close to singular ) . to determine where most of the predictive information resides , we assessed the contribution of each sh2/ptb - containing protein to each plsr model by calculating their variable importance in the projection ( vip ; see materials and methods ) . for all of the upstream signaling events , reduced models that included only the four most important variables performed almost as well as the full plsr models ( figure 3c ) . on average , the two most important variables were pi3k and shc1 ( figure 4a ) . in other words , much of the information needed to predict the relative phosphorylation levels of upstream signaling proteins resides in the number and affinity of pi3k- and shc1-docking sites on the rtk . as these models are statistical in nature , this observation does not necessarily mean that pi3k and shc1 have a causative function in determining the strength of signaling through other upstream proteins . pi3k- and shc1-binding sites may have co - evolved with some other feature of rtks that determines their ability to activate upstream proteins , such as kinase specificity or localization of the receptors to different membrane microdomains . nevertheless , it is possible that these proteins do have a causative function in determining the extent to which other signaling proteins are activated . this hypothesis can not be tested by altering the abundance of pi3k or shc1 , as altering the composition of the cell would change the parameter values in the models . it is possible , however , to alter the catalytic activity of pi3k without altering its abundance using the small molecule inhibitor ly294002 . if pi3k activity has a causative function in determining the degree to which upstream proteins are phosphorylated , we would expect ly294002 treatment to have the largest effect on proteins that have high plsr coefficients for pi3k ( figure 4b ) , and on receptors with the strongest recruitment potential for pi3k ( figure 4c ) . we therefore stimulated all six cell lines in the presence or absence of ly294002 and assessed the relative phosphorylation levels of the upstream signaling proteins by immunoblotting ( figure 4d and e ; supplementary figure s7 ; supplementary information ) . interestingly , the relative phosphorylation levels of src , which has a low coefficient for pi3k ( figure 4b ) , were minimally affected by ly294002 treatment ( figure 4d ) , whereas the relative phosphorylation levels of stat3 , which has a high positive coefficient for pi3k ( figure 4b ) , were affected in a manner consistent with the number and affinity of pi3k - docking sites on the six rtks ( figure 4e ) . this result suggests that , at least for stat3 , the contribution of pi3k in the plsr model is , in part , dependent on its kinase activity . the same result was not observed , however , for all of the upstream signaling proteins ( supplementary figure s7 ) . the stat3 result is not easily explained based on our current rtk wiring diagrams and a mechanistic understanding of this observation will require further investigation . the overall importance of pi3k and shc1 in rtk signaling was recently highlighted in a comprehensive map of the erbb network , which revealed that a large fraction of information converges on a small number of signaling molecules , all of which can be modulated by pi3k and shc1 ( oda et al , 2005 ) . interestingly , when we examined the sequences surrounding all known sites of tyrosine phosphorylation on human rtks as reported in the phospho . elm database ( diella et al , 2008 ) , we observed a distinct and significant ( p<0.05 ) bias for sites that feature the consensus binding sequences for the ptb domain of shc1 ( npxpy ) ( songyang et al , 1995 ) and the sh2 domains of pi3k ( pyxxm ) ( songyang et al , 1993 ; yaffe et al , 2001 ) ( figure 5a and b ) . this bias is not observed in known sites of tyrosine phosphorylation derived from all other human proteins ( figure 5c and d ) . thus , we find that , despite activating many of the same proteins , intrinsic differences between rtks are manifested in the degree to which they activate upstream signaling proteins and that much of this information resides in the number and affinity of docking sites for pi3k and shc1 . as these proteins lie upstream of the akt and map kinase signaling pathways , and as these two pathways have been found repeatedly to have a central function in rtk biology , it is likely that our observations are not specific to hek flp - in-293 cells , but extend to more physiological settings as well . recently , miller - jensen et al ( 2007 ) showed that the phenotypic response of cells to external stimuli can be predicted using models that rely on linear combinations of a common set of downstream signaling proteins . coupled with our results , this suggests that different rtks may be able to elicit different phenotypic responses in the same cell type by activating a common set of signaling proteins , but to different quantitative degrees . in addition , our study , coupled with that of miller - jensen et al , supports a model in which information processing by rtk signaling networks can be segmented into three discrete layers : an upstream layer comprising proteins that are activated in a linear manner through combinations of receptor - docking affinities ; an intermediate layer in which these signals are processed in a nonlinear manner ; and a downstream layer in which integrators of signaling combine in a linear manner to determine cellular outcome . we submit that the difficult task of constructing mathematical models of rtk signaling can be parsed into discrete problems and that our greatest challenge lies in dissecting the middle layer . stable cell lines were generated by co - transfecting flp - in-293 cells ( invitrogen , carlsbad , ca ) with the plasmid pef5/frt / v5-dest bearing the open reading frame for each rtk and the accessory plasmid pog44 according to the manufacturer 's directions ( invitrogen ) . cells were maintained in dulbecco 's modified eagle 's medium supplemented with 10% ( v / v ) fetal bovine serum , 2 mm glutamine , 100 iu / ml penicillin , 100 g / ml streptomycin , and 150 g / ml hygromycin b. all cell culture and immunoblotting experiments were performed using standard procedures . rabbit - derived primary antibodies were from cell signaling technologies ( beverly , ma ; supplementary table si ) . for quantitative immunoblots , bands were detected with irdye 680-labeled goat anti - rabbit igg ( li - cor biosciences , lincoln , ne ) and imaged using an odyssey infrared imaging system ( li - cor biosciences ) . expression levels of the rtks were determined using elisa kits from invitrogen for egfr and met , and from r&d systems ( minneapolis , mn ) for ntrk2 and pdgfr. all protein microarray experiments were performed as described earlier ( jones et al , 2006 ; kaushansky et al , 2008 ) . to define the receptor - docking affinity matrix , x , the matrix of kd values ( supplementary table siv ) was converted to a matrix of ka values ( ka=1/kd ) . if a protein contained two domains that bound the same peptide , the higher ka value was used . each phosphopeptide was then expressed as a row vector of ka values : and each receptor was defined as the sum of its constituent phosphopeptide vectors : the raw receptor - docking affinity matrix , xraw , was then assembled from the six receptor vectors : the raw matrix was adjusted such that every sh2/ptb - containing protein ( i.e. every column ) was mean - centred and weighted according to its average affinity . this yielded the final receptor - docking affinity matrix , x. for the models presented in figure 3 , proteins that bound fewer than five receptors were removed from the matrix . models obtained using all of the data or increasingly smaller subsets are shown in supplementary figure s5 . relative phosphorylation levels of signaling proteins , as measured by immunoblotting , were calculated by first subtracting the level observed in the mock - treated , parental flp - in-293 cell line and then dividing each value by the maximum observed value for that site across the six cell lines . each phosphorylation site was treated as a separate vector , y , and each y was mean - centred and variance - normalized . a plsr ( geladi and kowalski , 1986 ) was then performed separately on each y. for cross - validation , each receptor ( row i ' ) was removed once from both x and y , the regression was performed , and the resulting model was used to predict the value of yi . the residual , q , of this prediction was then compared with residuals generated from randomly shuffling x 2000 times . the distribution of these residuals was used to calculate the p - value of the observed q. the weighted sum of squares ( also known as the vip ) for each variable , k , was calculated according to equation ( 5 ) : where kt is the total number of variables , a is the principal component , and ssa is the sum of squares for that component . experimentally determined sites of tyrosine phosphorylation in human proteins were acquired from the phospho.elm database ( diella et al , 2008 ) . of the 1397 identified sites , the amino - acid frequencies at positions upstream and downstream of ptyr sites were calculated and then normalized to the expected frequency of each amino acid in all human proteins ( echols et al , 2002 ) . the resulting histograms of observed / expected frequencies were fit to a log - normal distribution from which p - values were calculated . stable cell lines were generated by co - transfecting flp - in-293 cells ( invitrogen , carlsbad , ca ) with the plasmid pef5/frt / v5-dest bearing the open reading frame for each rtk and the accessory plasmid pog44 according to the manufacturer 's directions ( invitrogen ) . cells were maintained in dulbecco 's modified eagle 's medium supplemented with 10% ( v / v ) fetal bovine serum , 2 mm glutamine , 100 iu / ml penicillin , 100 g / ml streptomycin , and 150 g / ml hygromycin b. all cell culture and immunoblotting experiments were performed using standard procedures . rabbit - derived primary antibodies were from cell signaling technologies ( beverly , ma ; supplementary table si ) . for quantitative immunoblots , bands were detected with irdye 680-labeled goat anti - rabbit igg ( li - cor biosciences , lincoln , ne ) and imaged using an odyssey infrared imaging system ( li - cor biosciences ) . expression levels of the rtks were determined using elisa kits from invitrogen for egfr and met , and from r&d systems ( minneapolis , mn ) for ntrk2 and pdgfr. all protein microarray experiments were performed as described earlier ( jones et al , 2006 ; kaushansky et al , 2008 ) . to define the receptor - docking affinity matrix , x , the matrix of kd values ( supplementary table siv ) was converted to a matrix of ka values ( ka=1/kd ) . if a protein contained two domains that bound the same peptide , the higher ka value was used . each phosphopeptide was then expressed as a row vector of ka values : and each receptor was defined as the sum of its constituent phosphopeptide vectors : the raw receptor - docking affinity matrix , xraw , was then assembled from the six receptor vectors : the raw matrix was adjusted such that every sh2/ptb - containing protein ( i.e. every column ) was mean - centred and weighted according to its average affinity . this yielded the final receptor - docking affinity matrix , x. for the models presented in figure 3 , proteins that bound fewer than five receptors were removed from the matrix . models obtained using all of the data or increasingly smaller subsets are shown in supplementary figure s5 . relative phosphorylation levels of signaling proteins , as measured by immunoblotting , were calculated by first subtracting the level observed in the mock - treated , parental flp - in-293 cell line and then dividing each value by the maximum observed value for that site across the six cell lines . each phosphorylation site was treated as a separate vector , y , and each y was mean - centred and variance - normalized . a plsr ( geladi and kowalski , 1986 ) was then performed separately on each y. for cross - validation , each receptor ( row i ' ) was removed once from both x and y , the regression was performed , and the resulting model was used to predict the value of yi . the residual , q , of this prediction was then compared with residuals generated from randomly shuffling x 2000 times . the distribution of these residuals was used to calculate the p - value of the observed q. the weighted sum of squares ( also known as the vip ) for each variable , k , was calculated according to equation ( 5 ) : where kt is the total number of variables , a is the principal component , and ssa is the sum of squares for that component . experimentally determined sites of tyrosine phosphorylation in human proteins were acquired from the phospho.elm database ( diella et al , 2008 ) . of the 1397 identified sites , the amino - acid frequencies at positions upstream and downstream of ptyr sites were calculated and then normalized to the expected frequency of each amino acid in all human proteins ( echols et al , 2002 ) . the resulting histograms of observed / expected frequencies were fit to a log - normal distribution from which p - values were calculated . supplementary information : this supplementary file includes : supplementary methods ; supplementary references ; supplementary figures 6 , 7 , 8 , 9 , 10 , 11 , 12 ; supplementary tables 1 , 2 , 3 supplementary table 4 : equilibrium dissociation constants for the binding of phosphopeptides to human sh2 or ptb domains . | receptor tyrosine kinases ( rtks ) process extracellular cues by activating a broad array of signaling proteins .
paradoxically , they often use the same proteins to elicit diverse and even opposing phenotypic responses .
binary , on off ' wiring diagrams are therefore inadequate to explain their differences . here , we show that when six diverse rtks are placed in the same cellular background , they activate many of the same proteins , but to different quantitative degrees . additionally , we find that the relative phosphorylation levels of upstream signaling proteins can be accurately predicted using linear models that rely on combinations of receptor - docking affinities and that the docking sites for phosphoinositide 3-kinase ( pi3k ) and shc1 provide much of the predictive information .
in contrast , we find that the phosphorylation levels of downstream proteins can not be predicted using linear models . taken together , these results show that information processing by rtks can be segmented into discrete upstream and downstream steps , suggesting that the challenging task of constructing mathematical models of rtk signaling can be parsed into separate and more manageable layers . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
parkinson disease ( pd ) is a progressive , neurodegenerative disorder , greatly affecting the quality of life of patients , and bringing heavy burden for caregivers . besides the major 4 motor symptoms ( ms ) including resting tremor , bradykinesia , rigidity , and postural and gait instability , pd is usually accompanied by numerous nonmotor symptoms ( nms ) , such as neuropsychiatric symptoms , sleep disorders , autonomic dysfunctions , and sensory disturbances . at present , there is a lack of clinical epidemiological study on sporadic pd in large population over a thousand evaluating ms and nms by comprehensive - related scales . therefore , we conducted assessments of ms and nms by using 13 scales in over a thousand pd patients , in order to provide an important evidence for understanding the features of clinical symptoms , particularly nms of pd , and find out what affects their occurrence and sequence with ms . this study was approved by beijing tiantan hospital review board . written informed consents were obtained from all participants in this study . we recruited 1119 pd patients consecutively from the department of geriatrics and neurology , beijing tiantan hospital , capital medical university , from january 2011 to august 2015 . patients were diagnosed with pd according to uk parkinson 's disease society brain bank criteria . scales for evaluating of ms , motor complications , nms , activity of daily living , and quality of life see table 1 . in order to keep the results of scales accurate and correct , all staff participating in the evaluation epidemiology , medication , and the incidence of nms , ms of pd patients were statistically analyzed ; and 2 major nms in pd patients , that olfactory dysfunction and rbd were further analyzed . according to accompanied with or without above 2 nms , pd patients were divided into 2 groups and compared ; for patients with those above 2 nms , were further subdivided into 2 groups according the order of nms and ms and then compared . continuous variables were presented as means standard deviations and compared by 2-tailed t test if they were normally distributed , and presented as median ( quartile ) and compared by nonparametric test if they were not normally distributed . ( 1)demographic and clinical characteristics of pd patients are shown in table 2 . according to nms quest , the incidences of nms see table 3.(2)clinical features of 2 pre - ms nms demographic and clinical characteristics of pd patients are shown in table 2 . according to nms quest , clinical features of 2 pre - ms nms demographic characteristics of 1119 parkinson disease patients . the incidences of nms in parkinson disease patients . according to the 2nd item of nms quest , pd patients were classified as pd without and with olfactory dysfunction , and the latter were then classified as olfactory dysfunction occurring before or after ms . according to the 25th item of nms screening scale , pd patients were classified as pd without rbd and pd with rbd , and the latter were further classified as rbd occurring before ms or after ms . according to the 2nd item of nms quest , pd patients were classified as pd without and with olfactory dysfunction , and the latter were then classified as olfactory dysfunction occurring before or after ms . according to the 25th item of nms screening scale , pd patients were classified as pd without rbd and pd with rbd , and the latter were further classified as rbd occurring before ms or after ms . our study showed that the incidence of pd was slightly higher in male than in female , the ratio was close to 1:1 , the average age of pd patients was about 60 years , which was consistent with the domestic and international reports . education level of patients with pd was paralleled with that of age - matched ( 4070 years old ) citizens in our country , suggesting that it was not an associated factor for pd . by investigating into the clinical manifestations , we found that the majority pd patients were initiated from unilateral side , for which , the right side was slightly more than the left . the most common type of onset was the mixed type ( which meant rigidity and resting tremor often occurred simultaneously ) ; static tremor predominant type was less but still seen common , while the akinetic - rigidity type was rare . this implied that most pd patients presented comprehensive ms in the early stage , which was consistent with the domestic and international reports . there are still no curable anti - parkinson medicines thus far , although our knowledge about the pathogenesis and symptom - improving drugs of pd has increased . in the past decades , several agents targeting different pathways have been explored as treatments to slow down disease progression , but promising successes are limited . in this investigation , the most widely used drug was dopamine standard tablets ; the 2nd was dopamine receptor agonist , which meets pd treatment guideline . because the average disease duration of our patients was approximately only 4 years , nearly half of patients could get satisfactory therapeutic effects when taking 3 kinds of anti - parkinson drugs . however , there were still 25.5% of patients who did not receive standard treatment when first diagnosed pd , indicating insufficient understanding of diagnosis and treatment of pd in basic hospitals in our country . for the assessment of ms , the average h - y staging of our patients was 2.0 , which meant bilateral limbs were involved , but the postural balance was not affected , and the average score of unified parkinson disease rating scale iii was 25.8 13.8 . screening of nms suggested that the decline of smell or taste ranked top of nms , followed by the nervous system symptoms ( such as memory loss , depression , apathy , and anxiety ) and autonomic symptoms ( including salivation , dysphagia , constipation , nocturia , urgency to urinate , excessive sweating , and sexual dysfunction ) . sleep disorders ( such as insomnia , rbd , and daytime sleepiness ) were also common seen , and psychiatric symptoms ( such as hallucinations , delusions ) ranked the last . so more attention should be paid to the decline of memory , emotion disorders , autonomic disorders , and their treatment options in pd patients . braak classified the pathological degree of pd into 6 stages , according to the sequential presence of lewy bodies . the presence of lewy bodies at apophysis mamillaris and anterior olfactory nucleus , nuclei originis dorsalis , reticular formation , dorsal raphe nucleus and locus coerule , nuclei pontis , hypothalamic , neocortex , and limbic system may be connected to nmss , as olfactory sensation , sleep , autonomic nerve , mental and behavioral disorders , respectively . in addition , the effects of anti - parkinson drugs on dopamine and non - dopamine pathways may , directly or indirectly , result in nms . cognitive disorder is one of the cardinal features of nms that influences the life quality of pd patients . detailed assessments displayed that more than half patients with pd were diagnosed mild cognitive impairment , but only 12% of patients reached the degree of dementia , which was consistent with the domestic and international reports . executive dysfunction of pd is thought to be link to da pathway abnormalities in the frontal striatum . progressive degeneration and subsequential loss of cholinergic neurons in nucleus basalis of meynert , and the reduction of hippocampal volume , results in dementia in pd patients . among the emotion disturbances , we found that the detection rate of depression using hamilton depression scale was higher than nms screening scale , this might due to depression in pd was usually accompanied by numerous somatic symptoms . thus , the hamilton depression scale exhibited superiority in recognizing depression because its more complicated questionnaire design paying attention to somatic symptoms . pd patients may present depression early in the braak stage ii , when lewy bodies deposit in dorsal raphe nucleus and locus ceruleus . the probable biochemical mechanisms are related to serotonin system , also mixed with norepinephrine and dopaminergic abnormalities in limbic lobe . anxiety is another common affective disturbance in patients with pd , the reported incidence of anxiety varies from 5% to 69% . currently , anxiety is believed not only an emotional response to ms but also a manifestation of pd itself . a case control study showed that anxiety features had existed for several years prior to the emergence of ms . according to npi scale , the incidence of mental and behavioral disorders in pd patients was generally low except depression ( 41.5% ) , apathy ( 40.9% ) , and anxiety ( 39.4% ) , changes in sleep and eating condition were most common ( such as nocturnal behavior disorders , appetite loss , and eating disorders ) , personality changes ranked the 2nd place ( such as irritability , disinhibition ) , while illusion appeared far less . the pathogenesis of apathy is associated with the functional dysregulation of the facies orbitalis frontal lobe - ventral striatum circuit . a previous study observed that , pd related apathy was more prone to occur at off stage , suggesting it may be correlated with the da level of brain . somnipathy is a common nms for pd patients , it could be the result of the disease itself , or secondary to other nms , the side effect of medicine , and it may emerge over different phases of pd . it was reported that the most common somnipathy was sleep disruption , referring to interfered or disrupted sleep caused by other nocturnal nms . our data showed 24.1% of pd patients experienced excessive daytime sleepiness , indicating this might be a symbolic subclinical symptom of pd . the damages of nuclei pontis , locus ceruleus , and corpora rubrum may be the pathological basis of rbd . occurrence of rbd could provide a significant clue for screening in high risk population and early diagnosis of pd . almost 90% of the pd patients are concomitant with hyposmia to different degrees ; it is considered a marked warning of pd before ms . we discovered a significant smell decline in pd patients , which was due to the early involvement of olfactory related brain regions by -synuclein according to braak staging and has a good clinical predictive value for pd . clinical and functional mri studies link the possibility to da metabolism in central nervous system . numerous studies held that restless leg syndrome was more common in patients with pd than healthy people , but the reported prevalence in pd patients were inconsistent , ranging from 7.90% to 20.80% . the prevalence of restless leg syndrome in pd patients in this investigation was about 21.6% , similar to the foreign and domestic reports . autonomic disorders include the deregulations of sweat gland , body temperature , cardiovascular , gastrointestinal , and genitourinary systems , mainly relevant to appearance of lewy bodies in sympathetic or parasympathetic cholinergic ganglion , and sympathetic adrenergic nerve ganglion . our data suggested that the major problems were constipation , frequent urination at night , orthostatic hypotension , polyhidrosis , and sexual dysfunction . fatigue is one of important nms of pd ; the affliction it brings along for patients is no less than ms does . according to the foreign study , 42% of patients with pd feel fatigue and one third of them deem fatigue as the most disabling factor . the significance of fatigue for pd patients has not been fully realized and only14% of the pd patients with fatigue is diagnosed . the mechanism of the fatigue is as yet undetermined and its risk factors are still disputed . fatigue is a quite common complaint of pd patients , which exerts great influences on the activity and life quality of the patients . there may be other factors that contributes to the occurrence of fatigue in pd , such as depression and daytime somnolence , which needs to be further explored . we observed that the pd patients with olfactory dysfunction group were older , exhibited lower argentina hyposmia rating scale scores , more severe depression , sleep and autonomic nerve disturbances , and worse quality of life . these potential connections could be explained because these mentioned nms are all likely to occur before onset of ms , and are all pathologically involved in similar locations according to braak staging , such as peripheral nerves , medulla oblongata , and brainstem . besides , we discovered that the patients who already had olfactory problems before ms , displayed older age of onset , more common onset from right side , and more severe olfactory symptoms , meanwhile , the patients who developed olfactory problems after ms presented earlier age of onset , longer disease duration , and more common left - side onset , demonstrating that pathological progression is heterogeneous in individual patient . it is consistent with the typical braak stage that the patients with right onset are more likely involved in olfactory bulb and olfactory tract at early stage have more serious smell dysfunction but develop ms much later . however , in left - onset patients , substantia nigra is involved earlier and accordingly ms appears earlier , dysosmia is milder due to later involvement of olfactory bulb and olfactory tract . compared to the patients without rbd , the patients accompanied by rbd showed more male , more right - side onset , older age , longer course of disease , and older age of onset , displayed higher h - y staging , more prominent in cognitive impairment , depression , sleep disorders , autonomic nerve dysfunction , fatigue , and worse quality of life . compared to the patients who develop rbd after ms , the patients who presented rbd before ms featured older onset age , more serious anxiety , and daytime sleepiness , suggesting heterogeneity in pathological progression among individual patient . the patients who have rbd earlier often develop ms later ( older age of onset ) , consistent with the typical braak staging , while the patients who have rbd later often develop ms earlier ( younger onset age ) , which means younger patients are more likely to present ms rather than nms . in summary , we collected the clinical information of 1119 cases of primary pd patients , conducted up to 19 scales , covering all of the ms and nms of pd patients . the patients recruited at beijing tiantan hospital are from all parts of the country , therefore this sample has a good representative . it found that pd patients in our hospital present quite a number of nms ( including cognitive impairment , emotion disorder , mental and behavioral disorders , sleep disorders , autonomic dysfunctions , fatigue , and sensory abnormalities ) ; nms may occur before ms , pd pathology may be heterogeneous , ms always appear earlier than nms in young patients and nms always appear earlier than ms in older patients , and the latter is more conform to the classic braak pathological stage . | abstractparkinson disease ( pd ) is usually accompanied by numerous nonmotor symptoms ( nms ) , such as neuropsychiatric symptoms , sleep disorders , autonomic dysfunctions , and sensory disturbances .
however , it is not clear that the factors influencing the occurrence of nms and its sequence with motor symptoms ( ms).we conducted comprehensive assessments of nms by using 13 scales in 1119 pd patients.a total of 70.8% pd patients present nms .
olfactory dysfunction tends to occur in pd patients with older age , more severe depression , sleep problems , and autonomic dysfunctions .
older patients are more likely to have olfactory dysfunction before ms than younger patients .
rapid eye movement behavior disorder is more prone to happen in patients with older age , older onset age , more severe depression , sleep problems , and autonomic dysfunctions .
patients with rapid eye movement behavior disorder before ms are older in onset age than after group.olfactory dysfunction , constipation , rapid eye movement behavior disorder , and depression , as early warning nmss of pd , connected to each other .
there is a clinical heterogeneity that older patients are more likely to have nms before ms , while younger patients are opposite . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dihydrocodeine is a semisynthetic alkaloid that has preventive effects of shortness of breath and cough , as well as used extensively in killing postoperative pain . importance of dihydrocodeine is increasing day by day as second step of the analgesic ladder proposed for the treatment of cancer pain [ 24 ] . by extending the duration of action of the drug , since dihydrocodeine became available as a slow - release preparation , in this regard , it has begun to replace codeine . dihydrocodeine is also an important intermediate used in synthesis of other alkaloids such as hydrocodone . a number of methods have been reported to prepare dihydrocodeine . grew and coworkers have prepared dihydrocodeine by hydrogenation of hydrocodone [ 7 , 8 ] . however , when compared with the hydrogenation process from codeine , additional steps are incorporated into the process and this ultimately increases the cost for obtaining dihydrocodeine . for hydrogenation of codeine palladium supported on carbon , catalysts are generally studied [ 6 , 9 ] . in these methods , generally there is a need for excessive amounts of organic solvent for hydrogenation these processes bear risks in terms of health as well as causing environmental pollution . therefore , rapoport and lithotworik used water as a solvent in the hydrogenation process of codeine [ 10 , 11 ] . disadvantages of some of these methods are a number of side reactions difficult to control , undesirable side products , long reaction times , and necessity of using a deactivating agent which is connected to the surface of catalytic metal that can minimize isomerisation side reactions of codeine . microwave - assisted organic synthesis is an invaluable technology for drug synthesis because it often reduces reaction times , typically from days or hours to minutes or even seconds [ 1214 ] . on the other hand , the use of microwave irradiation to accelerate catalytic reactions can be used to obtain good results from low - yielding reactions [ 15 , 16 ] . with the employment of microwaves in metal , we describe the microwave - assisted synthesis of dihydrocodeine , which achieved reductions in reaction times , higher yields , and cleaner reactions than for the previously reported synthetic processes . dihydrocodeine was obtained in purity suitable for use in pharmacopy ( 99.80% ) in high efficiency ( 98% ) without using any deactivating agent and using metal catalyst in lower rate . synthesis of the dihydrocodeine which is a semi - synthetic opioid was achieved under microwave irradiation out of codeine as outlined in scheme 1 . in this study , an extremely simple , inexpensive , and highly efficient and noncomplex method has been reported . in addition , white crystalline dihydrocodeine in pharmacopical purity is easily obtained alkalinizing the solution environment . catalyst ratio used is very low when compared with values reported so far ; any deactivating agent required to minimize side reactions in reaction environment was not used in these study . catalyst amount used in selected reaction conditions was determined optimally , the highest efficiency ( 98% ) reported so far in this reaction conditions was obtained , as well as formation of side reactions was significantly eliminated and product in pharmacopy standards was obtained . in order to determine optimized conditions for the hydrogenation under microwave irradiation , the effect of temperature , reaction time , and microwave power on hydrogenation yield was studied and the initial hydrogen pressure and catalyst ratio fixed as 5 psi and 1% ( pt / c ) , respectively , in the following experiments . fixing reaction temperature and time to 20c and 5 min , respectively , the effect of microwave power on yield of dihydrocodeine was studied . dihydrocodeine conversion increased from 60 to 98% as microwave power increased from 250 to 450 w , as exhibited in table 1 . keeping reaction temperature and microwave power to 20c and 450 w , respectively , the effect of reaction time on the yield of dihydrocodeine was determined . table 1 indicated that the yield of dihydrocodeine slightly decreased as the irridation time was increased from 5 to 10 min . on the other hand , when the microwave power was set as 350 w , the yield of dihydrocodeine increased as the reaction time the microwave power and reaction time were set as 450 w and 5 min , respectively . when the temperature was increased from 20 to 40c , this result was attributed to the fact that side reactions were such as isomerisation of codeine to hydrocodone and cleavage of 4 , 5-epoxymorphinane ring of codeine to form dihydrothebainone overly induced at high temperature . consequently , 20c , 450 w , and 5 min reaction time are determined as the best conditions in this process . when the temperature and reaction time increased , product yield decreased due to more induced side - reactions . nevertheless , the reaction efficiency was highly microwave oven power dependent . potentiometric assay showed that dihydrocodeine product conforms to the stated limit as required by the bp . measurements were repeated five times and the percent purity of dihydrocodeine was calculated as 100.3 on average . hplc of the product revealed the presence of a single peak with a rt of 13.666 min . finally , it was potentiometrically and chromatographically determined that dihydrocodeine product obtained in the study is in pharmacopy standards . microwave - assisted preparation procedure stated in this study for dihydrocodeine synthesis offers reduction in the reaction time , operation simplicity , cleaner reaction , easy work - up , and improved yields . all spectroscopic analysis confirmed the proposed structure of this compound . all chemicals and platin catalyst ( on activated charcoal 1% ) used in the present study are of analytical grade purchased from merck . the infrared spectra were recorded as potassium bromide disks using a perkinelmer spectrum one ft - ir spectrometer . the h and c - nmr spectra of the dihydrocodeine were recorded using the bruker 500 nmr spectrometer . mass spectra by ei ( electron impact ) techniques of dihydrocodeine were determined by an agilent 6890 model gc - ms . the percentage compositions of the elements ( chno ) for the compound were determined using a thermofinnigan flash 1112 series ea instrument . hplc analysis is conducted using agilent 1200 which is equipped with uv / vis detector . separation was accomplished on a 25 cm eurospher-100 ( waters ) c18 column ( 4.6 mm i.d . the uv detector was set at 284 nm and the flow rate was 1.0 ml / min . the potentiometric measurements were made at 25 1c , using a mettler toledo dl53 titrator . 0.35 g dihydrocodeine product was dissolved in 60 ml of glacial acetic acid . these measurements were repeated five times . 2.5 g codeine was suspended in water ( 30 ml ) and acetic acid was added until codeine dissolved ( 1 ml ) . 0.20 g pt on activated charcoal catalyst ( 1% pt / c ) was added to solution . this solution was put into a cem discover microwave reactor ( cem corporation , matthews , nc ) . the upper part of the reactor was filled with inert nitrogen gas by passing nitrogen gas and the addition of h2 to the system is started . the reaction mixture was filtered ( 0.45 m of pore size ) . active pt catalyst ( on carbon ) dihydrocodeine was precipitated between 9.80 and 9.90 ph by adding the 30% naoh solution . the resulting white solid corresponded to a yield of 98% and purity ( by hplc ) of 99.80% . h nmr ( 500 mhz , d6-dmso ) : = 0.90 ( q , j = 12.2 hz , 1h ) , 1.17 ( q , j = 13.5 hz , 1h ) , 1.35 ( m , 1h ) , 1.37 ( m , 1h ) , 1.44 ( d , j = 11.8 hz , 1h ) , 1.821.76 ( m , 1h ) , 2.05 ( d , j = 12.0 hz , 1h ) , 2.11 ( m , 1h ) , 2.25 ( s , 3h ) , 2.29 ( d , j = 5.5 hz , 1h ) , 2.34 ( d , j = 7.6 hz , 1h ) , 2.86 ( bd , j = 18.3 hz , 1h ) , 2.93 ( bs , 1h ) , 3.42 ( s , 1h ) , 3.76 ( s , 3h ) , 4.47 ( dd , j = 18.84.4 hz , 1h ) 6.53 ( d , j = 8.0 hz , 1h , 6.68 ( d , j = 8.0 hz , 1h ) ; c nmr ( 500 mhz , d6-dmso ) : = 19.32 ( ch2 ) , 19.58 ( ch2 ) , 25.75 ( ch2 ) , 37.12 ( ch2 ) , 38.29 ( ch ) , 41.80 ( q ) , 42.68 ( ch3 ) , 45.96 ( ch2 ) , 56.16 ( och3 ) , 58.81 ( ch ) , 65.89 ( ch ) , 90.31 ( ch ) , 113.87 ( ch ) , 117.95 ( ch ) , 127.11 ( q ) , 130.31 ( q ) , 140.78 ( q ) , 146.96 ( q ) . anal calcd . for c18h23no3 : c , 71.64 ; h , 7.62 ; n , 4.64 ; found : c , 71.62 ; h , 7.64 ; n , 4.40 . | an efficient one - pot microwave - assisted hydrogenation of codeine was achieved in aqueous solution .
this technique is simple , fast , environmentally friendly , and highly efficient .
structure of produced dihydrocodeine was approved by using ft - ir , 1h nmr , 13c nmr , eims , and elemental analysis technique .
its purity analysis was performed by using hplc and assay analysis was performed by using potentiometric titration methods . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the increasing number of road traffic accidents in our country has made it extremely difficult to analyze the exact reported incidence of mortality and morbidity due to airway and facial trauma . the incidence of maxillofacial trauma and airway involvement as a result of roadside accidents is quite varied and an approximate incidence of 22% is reported from developed countries . in india alone , accidents account for the highest fatality rate reaching to almost peak of 1520 times than that of developed nations . the roadside accidents have acquired an epidemic proportion and are putting an extra burden on our health resources . the primary management of the injuries , specifically to the airway and facial structures , is of prime importance to the attending anesthesiologist and the intensivist . maxillofacial trauma is invariably associated with head injuries and injuries to the other vital organs can further increase the mortality and morbidity statistics . though there is heterogeneity in the actual reported incidences of such trauma but the common denominator in majority of these accidents is the involvement of young males . however , the primary concerns remain about the initial resuscitation and further management of such injuries . while attending to such patients , numerous challenges have to be faced by the attending anesthesiologist and intensivist besides clinical difficulties . medico - legal and ethical aspects are also few of the major concerns in the present day scenario of increased awareness among general public when such patients are attended to in various hospital settings . equally important is the availability of back - up services like intensive care unit ( icu ) and trauma team so that the necessary interventions are carried out at the earliest . there are only a few isolated reports in indian set - up which have reported concomitant maxillofacial trauma with associated head injuries and as such larger studies are required to evaluate and manage such challenging injury patterns . however , the most important aspect during initial assessment include the difficulties of appropriate evaluation of neurological status as majority of these patients are either under the influence of alcohol or suffer serious associated head injuries . the present study was carried out to analyze retrospectively the demographic profile of the patients , nature of injuries , types of interventions needed , factors responsible for such trauma , management of these injuries and the outcome in these patients , medico - legal and ethical aspects and a genuine attempt for the identification of preventable factors in such injuries . after obtaining the permission from the concerned hospital authorities , the records of 129 patients were reviewed retrospectively who had sustained maxillofacial trauma and concomitant head injury and were admitted in our institute during the period of july 2008 to august 2011 . the inclusion criteria consisted of only those patients who had sustained combined cranio - facial trauma and/or associated injuries to neck , chest and peripheral tissues . patients with fractures of long bones , pelvic fractures , and blunt abdominal injuries were excluded from the study . the study specifically stresses upon the facts related to demographic profile of the patients , nature and type of injuries , factors responsible for infliction of such injuries , need for airway management / intubation and possible mechanical ventilation , need for tracheostomy and the outcome in such patients due to availability of multiple support facilities . the institute is located on national highway and caters to 4.55 lakh of rural population of the adjoining areas . patients had received initial resuscitative measures by trauma team in the emergency department after admission . airway assessment and securing blood samples , computed tomography scan , ultrasound and x - rays were the main diagnostic intervention which had been undertaken during initial primary resuscitation . some of the patients had undergone emergency operative interventions . rests of the patients had been shifted to icu for observation and management and after the surgical procedures ; operated patients had also been shifted to the icu . majority of the patients were mechanically ventilated and in few of them tracheostomy had also been performed for various indications . delayed surgical interventions had also been carried out after initial conservative management especially for the maxillofacial trauma . during their stay in icu , routine monitoring had been carried out which included heart rate , blood pressure , pulse oximetry , ecg , end tidal carbon dioxide etc . day to day only those patients were discharged who had regained consciousness and had a good recovery . at the end of study , all the data was arranged and compiled systematically and was subjected to statistical analysis using mann - whitney and chi - square tests using spss version 15.0 for windows . value of p < 0.05 was considered significant and p < 0.001 as highly significant . at the end of study , all the data was arranged and compiled systematically and was subjected to statistical analysis using mann - whitney and chi - square tests using spss version 15.0 for windows . value of p < 0.05 was considered significant and p < 0.001 as highly significant . a total of 129 patients were admitted to the emergency ward of our institute from july 2008 to august , 2011 with injuries to facial structures and cranium alone , and/or associated injuries to other organs in few of the patients . majority of these cases were of roadside accidents that were brought either by relatives and friends or by the passersby and police personals . in all these patients , initial baseline parameters were observed and duly recorded into their respective records . the demographic profile of these patients is as shown in table 1 . demographic profile of craniofacial trauma victims the nature of injuries sustained by these patients was diverse and majority of them had multiple patterns of injuries as shown in table 2 . showing the nature of injuries sustained by the patients the presenting clinical picture of these patients also exhibited a huge diversity [ table 3 ] . ear , nose and throat bleeding was present in a significant percentage of patient population ( 70.54% ) . the loss of consciousness ( 33.33% ) , restlessness and agitation ( 25.58% ) , dyspnea and chest pain ( 19.38% ) and vomiting ( 11.62% ) on admission were the other presenting symptoms and signs . majority of these patients ( 91.47% ) presented with associated superficial bruises , abrasions , lacerations and external soft tissue injury . clinical presentation of signs and symptoms on admission majority of these patients were managed by immediate airway securing and intubation ( 59.69% ) and immediate operative intervention ( 41% ) . mechanical ventilation , blood transfusion , tracheostomy and ionotropic support was instituted wherever deemed necessary [ table 4 ] . the inclusion of combined maxillofacial trauma and head injury patients alone in the present study was deliberate as the basic concept revolved around the airway and intensive care management and not the surgical aspect alone . secondly , an attempt was made to assess the predictors of outcome in such patients . the assessment of such patient is very difficult as they are usually either under the influence of alcohol or have decreased gcs score due to associated head injuries . the emphasis was to dwell upon the factors responsible for injuries , types of interventions needed specifically for the airway management , the outcome of timely management and the impact of availability of icu services and trauma team in the prognosis of these serious fatal injuries . the number of patients who suffered roadside accidents was significantly higher in the age group of 1540 years ( p < 0.001 ) . the male gender predominance ( 83.72% ) among these victims was statistically significant ( p < 0.001 ) as was the alcohol consumption ( 31.78% ) . 0.001 ) was that majority of these victims ( 76% ) belonged to rural background . thus , demographic characteristics of craniofacial trauma are no different from those due to polytrauma where young male predominance is a common characteristic , and in majority of the cases alleged alcohol consumption is invariably present . however , a strikingly different aspect from other studies is the predominance of rural population in the present study and this is due to the fact that institute is located on the national highway and there are more than a hundred of villages in the surrounding area which it caters to . the higher consumption of alcohol and substance abuse in our country has further enhanced the statistical record of rta . the day by day increasing competition in all the fields has reduced the chances of employment and jobs . as a result , younger generation has to move from place to place in search of a suitable job and sometimes the job demands too much travelling on their part . one other big reason is that males in our indian society , whether young or old , tend to take responsibility upon them to carry out all the away home chores . the increasing use of mobile phones while driving is acquiring an epidemiologic proportion and the number of accidents during such negligent driving has not been reported accurately up till now . in the present study , nature of head injuries revealed that extra - dural hematoma ( 20.93% ) was the most common finding followed by sub - dural ( 17.83% ) and subarachnoid hemorrhage ( 13.18% ) . the injury to skull included fractures of frontal bone ( 20.15% ) , sphenoid bone ( 11.63% ) , orbital roof ( 13.18% ) and fracture of cribriform and ethmoid bone complex ( 13.18% ) with associated csf rhinorrhea . there were few associated injuries to other organ systems as well ( 36.43% ) , which were not life threatening and included undisplaced fractures of minor bones including ribs , abrasions , bruises and lacerations to various soft tissue structures . the biggest drawback during initial care includes lack of proper pre - hospital care and the timely transportation of these accident victims to the health centers . from time to time various guidelines have been published in dealing with craniofacial trauma but till today there is no universally accepted protocol in managing and prevention of this menace in the developing nations like india . the popularity of pre - hospital trauma life support guidelines has increased manifold in the west but it is a big laggard in our country due to a multitude of problems . the one big solution is the extensive training of paramedics in the transportation and resuscitation of critically injured patients . at present , our institute has come out with a novel and innovative reform as we have started a 1-year international academic and practical course in critical care for technicians and paramedics in collaboration with a canadian university . this project is the first of its kind in the country , and the basic aim is to train these primary caregivers with the best of knowledge and practices of both the developing and the developed world . the most common clinical presentation of these patients to emergency department includes loss of consciousness , agitation and restlessness , oro - nasal bleed , facial swelling , respiratory distress and vomiting and the similar scenario was observed in our study as well . the most common indication for immediate surgical intervention included depressed skull fracture , extradural hematoma ( edh ) , sub - dural hematoma ( sdh ) , brain contusion with intracranial bleed , csf rhinorrhea and fractured maxillofacial bones interfering with airway . airway management is of prime importance in these patients as the facial fractures , oro - nasal bleed and disrupted facial anatomy throws huge challenges to the attending intensivist in securing the airway . equally critical becomes the support of circulation as the trauma in these patients is invariably associated with circulatory shock . pupillary examination is an important component during initial evaluation but one should not get misguided by these observations as pupillary signs and size can be misleading sometimes due to hypoxemia , hypotension , hypothermia , 3 cranial nerve palsy , and various other etiological factors . the craniofacial trauma throws numerous challenges when they are first attended in the hospital . if the identity of the victim is in doubt , it opens the doors of numerous medico - legal concerns about the initiation of advance treatment after completion of initial resuscitative efforts . many a times , decision has to be taken on urgent basis as head injury and other associated life - threatening injuries require urgent operative intervention . the emergency surgery in craniofacial trauma is further warranted by csf leak which occurs in 1112% of cases with basal skull fractures , and the incidence in our study prevailed to the extent of 15% . the main goals of neurosurgical intervention at the earliest are to prevent the irreversible pressure changes in the brain , external deformity of the skull , sealing the csf leak and to avoid meningitis and sinusitis . sometimes , after the initial resuscitation , surgery is delayed in consideration of the optimization of hemodynamic status and regression of soft tissue swelling . long - term complications of such injuries include mucocele or pyocele , meningitis , subdural empyema and brain abscess . the controversy is never ending with regards to indication for surgery , timing of surgery , the best operative approach , the choice of material to close dural leaks and bone defects etc . the priority for surgery in craniofacial trauma this warrants a close co - ordination of neurosurgeon , anesthesiologist , intensivist , maxillofacial surgeon , plastic surgeon and the ent specialist in the process of precise diagnosis , decision about the time of surgery and surgical approach and availability of intensive care facilities . our task became much simpler as we have a well - equipped trauma unit and a trauma team , which is always available in the hospital for dealing with any type of emergency or mass disaster . in 77 ( 59.69% ) patients , immediate airway protection and intubation was mandatory on account of their airway trauma , respiratory distress , deteriorating clinical condition , intra - oral bleed and progressively decreasing gcs score [ table 4 ] . among 129 admissions , immediate emergency operative intervention was required in 53 ( 41% ) patients who had sustained head injuries while delayed surgery was carried out both for the head injury as well as the repair of facial bones in 76 ( 59% ) of the patients . mechanical ventilation was carried out in 65.90% of the patients as and when required during different stages of their stay in icu . blood transfusion was required due to presenting picture of severe hemorrhage or due to ongoing losses in emergency trauma ward in 28.68% of the victims , while 21.70% of these patients required ionotropic support as well for maintaining the hemodynamic stability . chest tube insertion was necessitated in 8.52% of the patients due to the presenting pneumo - hemothorax . tracheostomy was performed in 22.48% of the patients and surprisingly this was performed as an elective procedure for various indications and the availability of fiberoptic bronchoscope negated the need for surgical airway intervention in the emergency trauma ward . we observed a mortality of 16.28% in these patients and that was mainly involving the patients with gcs score of less than 5 [ table 4 ] . the traditional surgical management of complex craniofacial trauma is usually performed in three stages where immediate craniotomy is followed by orbitofacial repair in 710 days and last of all cranioplasty is carried out after 612 months . however , early single stage repair of craniofacial trauma was carried out in 12 of the craniofacial trauma victims due to massive disruption of facial bones and csf rhinorrhea . the earlier studies have also concluded that such intervention can be undertaken with an acceptable rate of morbidity and mortality , a decreased need for re - operation and improved cosmetic and functional outcome . the further considerations in our cases include decreased icu stay , cost - effectiveness and lesser anesthetic exposure as well . but the big question in these circumstances pertains to obtaining the valid consent for such an emergency operative intervention . this problem was faced by us in more than 12% of the patients with craniofacial trauma who had a severe degree of intracranial bleed and disruption of facial bones that necessitated an emergency operative intervention . the consent for surgery was obtained from the appropriate hospital authorities to proceed for surgery as that was the only possible life - saving measure . otherwise a delay in the appropriate therapy could have put their life into a situation of no hope . there is huge debate about such interventions and on the basis of medico - legal aspects the answer to such problems is plain one and that is not to undertake any surgical intervention in such circumstances . but if we keep an ethical view in consideration , such operative intervention should be undertaken to prevent the precious lives . certain protocols and amendments are also required in the constitution to deal with such delicate matters . in certain other cases when the patient gets identified but the relatives express their inability to bear any expenses of surgery and intensive care , it causes a huge dilemmatic situation for the attending doctors because these types of injuries takes a little time but definitely these interventions are life saving . referring them to another tertiary government institute again seems to be unethical as not only it will be a time - consuming transportation and wasting precious life - saving moments but will also not ensure whether they will get any timely and appropriate treatment there . the novel solution to this problem at least in our hospital included a clause for free treatment , which is provided to 2530% of such poor patients who are fighting for their life in emergency wards and icus . the provision of such a treatment methodology is not enough and the root cause of this menace has to be treated both at regional and national levels . education of the public about all the risk factors of accidents and their hazards has to be properly disseminated . at a local level our institute has been continuously coming up with various educational and awareness camps related to the timely management of all the medical and surgical emergencies and cover more than 120 villages with a total population of more than 4.5 - 5 lakh . continuing the efforts on similar lines , the institute is providing training to various volunteers from all these villages and teaching them how to effectively deal with such emergencies especially related to pre - hospital care and their transportation . institute has deployed ambulances at various critical points along with helpline numbers to deal with such emergencies . though the incidence of spinal injury is approximately 10% in such trauma cases but surprisingly we observed cervical spine injury in only 7 patients and fortunately there were no significant neurological deficits in these patients . the lower incidence can also be possibly explained on the basis of lower number of total cases in our study , which may have influenced the statistics . as per the american college of surgeons advanced trauma life support ( atls ) eastern association for the surgery of trauma guidelines , a missed or delayed diagnosis of cervical spine injury may be associated with permanent neurological damage . though the gcs , no consumption of intoxicants and drugs , no significant distracting injuries and no signs or symptoms related to cervical spine injury are the essential parameters to exclude the diagnosis , it was however not possible in 36.50% of patients as they were under the influence of alcohol and gcs could not be measured with preciseness . craniofacial trauma should be managed on priority basis with an emphasis on initial resuscitation measures , which included securing the airway , hemodynamic stabilization and evaluation and treatment of injuries to other vital organs . the decision of early and delayed surgical intervention can be well taken by a thorough discussion of the case between the various specialists of the trauma team . maxillofacial trauma with head injuries demands special attention as airway compromise is invariably present and it is difficult to assess the neurological status always due to inebriated state and severity of head injury . the management of craniofacial trauma requires special efforts from the well - trained trauma team and the early referral of such injuries to a well - equipped health center do decrease the incidence of mortality and morbidity . the role of pre - hospital care and pre - hospital trauma life support guidelines is as important as advanced trauma life support measures . preventive measures and legislations regarding traffic rules require a review also as higher incidence of accidents among young adults has acquired gigantic epidemiologic picture . certain amendments in the constitution as well as strict compliance of road traffic rules are essential to decrease the incidence of such injuries . | background and objectives : maxillofacial trauma is commonly associated with other injuries , predominantly head injuries .
the predictors of outcome in such concomitant injuries have been studied the least .
the present study aims at the evaluation of types of injury , management and outcome of patients sustaining maxillofacial trauma and concomitant cranial injuries.materials and methods : a retrospective study was carried out in the department of anesthesiology and intensive care .
a case series of 129 patients was evaluated who were admitted in icu ( intensive care unit ) with maxillofacial trauma and head injuries .
the data was then compiled systematically and analyzed using spss windows and value of p < 0.05 was considered significant and p < 0.001 as highly significant.results:among the 129 patients , majority of them had roadside accidents ( rsa > 90% ) and male gender predominance with male to female ratio of 5 : 1 .
fracture maxilla and nasal bones were the most commonly encountered injuries ( 51.93% ) followed by mandibular fractures ( 39.53% ) and fracture of zygomatic bones ( 28.68% ) .
eighty five patients ( 65.90% ) required mechanical ventilation , tracheostomy was needed in 29 ( 22.48% ) patients and 81 ( 62.8% ) patients were operated for head injuries as well .
majority of the victims were aged between 15 and 40 years.conclusions:maxillofacial trauma and cranial injuries are common among young males and so is the nature of injuries , that is , rsa . besides facial injuries , head injuries are important determinant of outcome in such patients . timely resuscitation and surgical interventions at specialized centers
are of prime importance as far as a better prognosis is concerned in such injuries . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
central venous catheter ( cvc ) placement is one of the most frequent interventions in the critical care units . one review has described an overall complication rate of 15% , while another observational cohort study reported that 14% of the placement attempts were associated with mechanical complications . failure to place , arterial puncture , malpositioning and hematoma formation are common immediate complications . a recent review done on complications of cvc in the pediatric age group classified the complications as early and late and further into fatal and non - fatal . pneumothorax , hydrothorax , hemothorax , and cardiac tamponade were reported as the most common early complications whereas septic and embolic complications , dislodgement , cardiac tamponade , catheter disruption and thrombotic complications were reported as the most common late complications . we report a rare complication of cvc placement where a left sided internal jugular vein ( ijv ) cannulation led to thedevelopment of a bilateral chylothorax , due to direct injury to thoracic duct . a 42 year old lady , a known case of systemic lupus erythematosus ( sle ) , on disease modifying drugs , presented with acute calculous cholecystitis and underwent an open cholecystectomy . her baseline hemogram , biochemical parameters , chest x - ray , and ultrasound abdomen were normal except for transient leukocytosis and abnormal gall bladder imaging . on day three , postoperatively she developed sepsis with multiorgan dysfunction . in view of suspected catheter - related blood stream infection ( crbsi ) , a cvc that had been placed preoperatively in the right subclavian vein was removed and a new cvc ( romsons centro , double lumen , 7 fr , 16 cm ) was placed in the left ijv . the vein was successfully cannulated in the second attempt and there was free flow of blood from all ports . the follow - up chest x - ray was normal , confirming the correct positioning and absence of pneumothorax . on the second day after catheter placement , she was noted to have a swelling on the left side of neck around the site of catheter insertion . the swelling was 2 cm 2 cm in size , fluctuant and non - tender . the left - sided catheter was immediately removed and a new catheter was placed in the right ijv . the next day she complained of rapidly worsening dyspnea , which was followed by desaturation at room air . an examination revealed diminished breath sounds bilaterally and urgent ultrasonography ( usg ) and a chest x - ray showed bilateral pleural effusion . bilateral pleurocentesis revealed a milky effusion [ figure 1 ] with biochemical analysis reporting increased triglycerides ( 588 mg / dl ) , strongly supporting the diagnosis of bilateral chylothorax . in the absence of any lymph - related disease pathology and with a history of left ijv cannulation , the etiology in the present case was believed to be a direct injury to the thoracic duct during central venous cannulation . intra pleural drainage tubes were placed on both sides and under - water seals were established . the patient was also kept nil per mouth to give the bowel the required rest . the total chest tube drainage reduced progressively over the next few days and the drains were successfully removed on the ninth day . chylothorax refers to accumulation of chyle in the pleural space and is an infrequent , but potentially life - threatening complication , with profound respiratory , nutritional , and immunological consequences . disruption or blockage of the thoracic duct or its lymphatic tributaries , at some point along their course in the chest , is the most common cause of chylothorax . malignancies , like lymphoma , chronic lymphocytic leukemia , and metastatic cancers , account for a majority of cases of non - traumatic chylothorax . surgical procedures , most notoriously cardiac and esophageal surgeries , have been implicated in the most traumatic cases of chylothorax . it ascends through the abdomen and chest and reaches behind the left subclavian artery , to about 3 5 cm above the clavicle . then it angles forward acutely and enters the venous system near the junction of the left subclavian and internal jugular vein . before termination , it receives additional lymph from the left bronchomediastinal , left subclavian , and left jugular trunks . on the right side , ductus lymphaticus dexter ( right lymphatic duct ) , which runs for about 1.3 cm . it receives lymphatic drainage from the right arm and right side of the thorax and head and empties into the right subclavian vein . , the jugular , subclavian , and bronchomediastinal lymphatic trunks may drain directly into the adjacent veins . also , the right lymphatic duct and the thoracic duct may terminate variably in the ipsilateral subclavian , jugular or brachiocephalic veins . in a healthy adult this gets altered with varying fat content of the diet , level of activity , and bowel function . remarkable increase is seen after a meal rich in long chain triglycerides , whereas , a flow as low as 0.20.3 l / d may be observed during periods of immobility , starvation , and continuous nasogastric suction . this forms the basis of using bowel rest as the cornerstone of conservative management for chylothorax . however , since not all cases of chylothorax have the typical appearance , an index of suspicion should be high whenever the risk factors exist ( like malignancy , thoracic surgery or trauma ) . diagnosis is established if the pleural fluid triglyceride levels are above 110 mg / dl . when the triglycerides are low , but the suspicion is high , the fluid should be subjected to lipoprotein electrophoresis , wherein , detection of chylomicrons would confirm the diagnosis of chylothorax . differentials to be considered when pleural fluid is milky or creamy in appearance , apart from chylothorax are , cholesterol effusions ( pseudochylothorax or chyliform effusions ) and empyema . in empyema the appearance is caused by high numbers of white blood cells and thus the milkiness would disappear after centrifugation , which will not happen in the other two cases . addition of ethyl alcohol to the supernatant fluid will clear the creamy appearance if it is due to cholesterol globules . also , pleural fluid to serum cholesterol ratio will typically be less than 1 in chylothorax and not so in cholesterol effusions . similarly , absolute pleural fluid cholesterol levels would be less than 200 mg / dl in chylothorax unlike that in pseudochylothorax . once chylothorax is confirmed , imaging studies are typically required to hunt for the etiology unless it is obvious . in traumatic causes , total parental nutrition ( tpn ) with central venous catheters leading to unilateral as well as bilateral pleural effusions , with milky pleural fluid with high triglyceride content , have been described . tpn extravasation can be differentiated from chylothorax by pleural fluid analysis , which shows characteristics similar to tpn fluid , a notably high glucose content . we did an exhaustive literature search and found 22 reports describing a total of 27 cases of chylothorax attributable to cvc placement [ table 1 ] . complete information could not be obtained in seven of the twenty - two reports and these have been listed at the end of the table [ table 1 : serial numbers 16 to 22 ] . out of the 19 cases where relevant information could be obtained , only in five cases was the chylothorax attributed to direct injury to the thoracic duct ( as in our case ) . thrombosis of the central veins wasimplicated as the cause of chylothorax in the remaining cases . incidence of this complication appeared to be slightly higher in paediatric age group and when the cannulation was done on the left side . there was no difference in the frequency of chylothorax based on whether ijv or the subclavian vein was chosen . summary of all reported cases of chylothorax secondary to cvc placement out of the five cases , where direct injury to the thoracic duct was implicated , three were placed through the left ( two ijv and one external jugular ) and two through the right side ( one ijv and one subclavian ) . in both of the latter two cases , an aberrant anatomy of the thoracic duct was described . all of these five cases were successfully managed with conservative management alone . in contrast , among the 22 cases with thrombosis related chylothorax , 6 patients died and only 5 cases ( table 1 : serial numbers 7 , 13 , 16 , 21 ) improved with conservative management alone . two cases had associated chylo - pericardium and one had chylo - peritoneum . despite the close anatomic proximity between the venous and lymphatic system , chylothoraces due to central venous catheterization have been infrequently described in literature . it may be a direct disruption of the thoracic duct , catheter - induced intrinsic thrombosis of the lymphatic - venous system or extrinsic venous compression from the extravasated fluid [ see table 1 ] . classically , a chyloma ( collection of chyle ) below the pleura develops when the thoracic duct first leaks , which may give rise to a swelling in the supraclavicular fossa . this collection can then leak into the pleural cavity through a pleural breech from the needle or following mediastinal pleural rupture . some authors have reported instances where a thoracic duct injury has occurred following cvc placement , without causing chylothorax . suspicion of a thoracic duct injury should arise whenever a swelling appears in the left supraclavicular fossa after central vein cannulation procedure . in all such cases , the central line should be removed , pressure dressing should be applied and patient should be kept fasting for 2 - 3 days to minimize the flow of chyle and promote spontaneous recovery . in few cases , total parenteral nutrition or a medium - chain triglycerides- thurer described a case where , after cvc placement , extravasation of the intravenous hyperalimentation solution occurred , resulting in mediastinitis and venous obstruction of the jugulosubclavian confluence bilaterally , leading to bilateral chylothorax . our patient was noticed to have a left supraclavicular swelling on the second day , from left - sided ijv catheterization . bilateral chylothorax in our patient was most likely due to direct injury of the thoracic duct during left ijv cannulation . thrombosis of the veins was unlikely , as the chylothorax regressed spontaneously in four days without any intervention . to the best of our knowledge , bilateral chylothorax as a complication of left internal jugular vein catheterization has been reported in only one case prior to this [ table 1 ] . also , this is the first comprehensive review of all the reported cases where chylothorax has occurred secondary to cvc placement . development of chylothorax is a rare complication of central venous catheterization and can cause serious morbidity and even mortality if not recognized . it is of utmost importance that intensive care professionals should be made aware of this eventuality . as the left ijv is in close proximity to the thoracic duct under the usual circumstances , right - sided catheterization should be preferred . thoracic duct injury should be suspected if the patient develops ipsilateral supraclavicular swelling or unilateral or bilateral pleural effusion after central venous catheterisation . the fluid should be aspirated and analyzed for appearance and triglyceride levels . among those with chylothorax secondary to cvc placement , those having direct injury to the thoracic duct / lymphatic vessels have a better outcome and usually respond to conservative treatment without any need for medical or surgical intervention . | central venous catheterization is one of the most prevalent procedures in the intensive care unit .
complications are reported in about 15% of the patients and usually comprise of infection , arterial puncture , malpositioning , pneumothorax , local hematoma , hemothorax , and so on .
chylothorax is a rare complication of this procedure .
we present a 42-year - old lady , who developed bilateral massive chylothorax after cannulation of her left internal jugular vein ( ijv ) , due to direct injury to the thoracic duct during the procedure .
the patient was successfully managed with bilateral chest tube drainage and omission of oral feeds for four days .
development of bilateral chylothorax as a complication of ijv cannulation is rare , but merits reporting , in view of a large number of central venous cannulations being undertaken .
critical care professionals should be aware of this rare complication of a common procedure to facilitate early identification and institute appropriate therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
most of the circulating insulin - like growth factor ( igf)-i is bound to igf - binding proteins
( igfbps ) , and small amounts of igf - i are present in the free form , which is called free
igf - i ( 1 , 2 ) .
since the free form is more freely transferred to the tissues , free igf - i is suggested to
have more potent biological action than the complex forms of igf - i ( 3,4,5,6,7,8 ) . two different methods are currently
used for the estimation of free igf - i levels . one is ultrafiltration by centrifugation ( uf )
( 9 ) and the other one is direct immunoradiometric
assay ( irma ) ( 10 ) . there is a difference between
these two methods : irma measures free plus readily dissociable igf - i , while uf measures only
free igf - i ( 11 ) . recently specific immunoradiometric
assays ( irma ) have been developed , and have demonstrated that serum free igf - i levels are
age- and sex - dependent ( 7 , 8 , 12 , 13 ) . serum free igf - i levels have also been demonstrated to show a
significant circadian variation that exhibits a nocturnal decrease and an increase in the
morning in healthy children ( 14 ) . in the present study , we measured serum free igf - i levels in fasting sera of 137 normal
boys and 120 normal girls aged from 8 to 15 yr to study their age- and sex - related changes ,
and relationships between free igf - i levels and total igf - i , lgfbp-1 , lgfbp-3 , and acid
labile subunit ( als ) levels . the subjects were 137 healthy japanese boys and 120 healthy girls aged from 8 to 15 yr . the
serum samples were obtained for screening of hyperlipemia in 1993 and had been frozen .
using the serum samples without abnormal biochemical data , we measured free igf - i , total
igf - i , igfbp-1 , igfbp-3 and als levels in 1996 and 1997 . the serum samples had been
obtained after overnight fasting , which is very useful for minimizing the effects of
diurnal changes in free igf - i and igfbp-1 levels ( 14 , 15 ) . free igf - i , total igf - i , igfbp-1 , igfbp-3 and als levels were determined in the same
serum samples . serum free igf - i levels were measured by an irma kit ( diagnostic systems
laboratories , inc . , webster , tx , usa ) ; the sensitivity is 0.03 ng / ml , the coefficient of
variation in the intra - assay was 3.310.3% and the coefficient of variation in the
inter - assay was 7.710.7% . serum total igf - i levels were measured by radioimmunoassay
( ria ) as reported previously ( 16 ) . serum igfbp-1
levels were measured by an immunoenzymometric assay ( iema ) kit ( medix biochemica ab ,
kauniainen , finland ) , serum igfbp-3 levels measured by an ria kit ( eiken chemical co. ,
ltd . , tokyo , japan ) , and serum als levels were also measured by an ria kit ( bioclone
australia pty . , ltd . , since free igf - i , total igf - i , igfbp-1 , igfbp-3 and als levels showed a normal
distribution of the data that had been converted logarithmically , we analyzed the data in
the logarithmic state . differences in the hormone levels and ratios among the age groups
were tested by analysis of variance . the subjects were 137 healthy japanese boys and 120 healthy girls aged from 8 to 15 yr . the
serum samples were obtained for screening of hyperlipemia in 1993 and had been frozen .
using the serum samples without abnormal biochemical data , we measured free igf - i , total
igf - i , igfbp-1 , igfbp-3 and als levels in 1996 and 1997 . the serum samples had been
obtained after overnight fasting , which is very useful for minimizing the effects of
diurnal changes in free igf - i and igfbp-1 levels ( 14 , 15 ) . free igf - i , total igf - i , igfbp-1 , igfbp-3 and als levels were determined in the same
serum samples . serum free igf - i levels were measured by an irma kit ( diagnostic systems
laboratories , inc . , webster , tx , usa ) ; the sensitivity is 0.03 ng / ml , the coefficient of
variation in the intra - assay was 3.310.3% and the coefficient of variation in the
inter - assay was 7.710.7% . serum total igf - i levels were measured by radioimmunoassay
( ria ) as reported previously ( 16 ) . serum igfbp-1
levels were measured by an immunoenzymometric assay ( iema ) kit ( medix biochemica ab ,
kauniainen , finland ) , serum igfbp-3 levels measured by an ria kit ( eiken chemical co. ,
ltd . , tokyo , japan ) , and serum als levels were also measured by an ria kit ( bioclone
australia pty . , ltd . , marrickville , new south wales , australia ) . since free igf - i , total igf - i , igfbp-1 , igfbp-3 and als levels showed a normal
distribution of the data that had been converted logarithmically , we analyzed the data in
the logarithmic state . differences in the hormone levels and ratios among the age groups
were tested by analysis of variance . in normal children , serum free igf - i increased with age in both sexes ( fig . 1 serum free igf - i levels in normal boys ( a ) and girls ( b ) . the means and means 2sds ( logarithmic converted data ) in each age
group are shown by the lines . ) . in boys , a statistically significant increment in free igf - i levels over the
consecutive age group 1a ) . in girls , statistically significant increments in free igf - i levels occurred
at 10 and 13 yr , and a statistically significant decrement in free igf - i levels was observed
at 15 yr ( fig . serum free igf - i levels in normal boys ( a ) and girls ( b ) . the means and means 2sds ( logarithmic converted data ) in each age
group are shown by the lines . 2 serum total igf - i levels in normal boys ( a ) and girls ( b ) . the means and means 2sds ( logarithmic converted data ) in each age
group are shown by the lines . ) . a statistically significant increment in total igf - i levels serum total igf - i levels in normal boys ( a ) and girls ( b ) . individual values are
shown by the dots . the means and means 2sds ( logarithmic converted data ) in each age
group are shown by the lines . the ratios of free to total igf - i were significantly higher in boys aged 1213 and 1415 yr
than in boys aged 89 and 1011 yr ( fig . 3 ratios of serum free to total igf - i in normal boys ( a ) and girls ( b ) . the vertical bars indicate 1sd . * ; p<0.0001 , * * ;
p<0.0005 . ) . the free to total igf - i ratios were significantly higher in girls aged 1213 and of
1415 yr than in girls aged 89 yr ( fig . 3b ) . ratios of serum free to total igf - i in normal boys ( a ) and girls ( b ) . the vertical bars indicate 1sd . * ; p<0.0001 , * * ;
p<0.0005 . 4 serum igfbp-3 levels in normal boys ( a ) and girls ( b ) . the means and means 2sds ( logarithmic converted data ) in each age group
are shown by the lines . ) . a statistically significant increment in igfbp-3 levels was observed at 12 yr in
boys ( fig . 4b ) . serum igfbp-3 levels in normal boys ( a ) and girls ( b ) . the means and means 2sds ( logarithmic converted data ) in each age group
are shown by the lines . 5 serum igfbp-1 levels in normal boys ( a ) and girls ( b ) . the means and means 2sds ( logarithmic converted data ) in each age group
are shown by the lines . ) . a statistically significant decrement in igfbp-1 levels was observed at 12 yr in
boys ( fig . 5b ) . serum igfbp-1 levels in normal boys ( a ) and girls ( b ) . the means and means 2sds ( logarithmic converted data ) in each age group
are shown by the lines . serum free igf - i positively correlated with total igf - i , igfbp-3 and als , and negatively
correlated with igfbp-1 ( table 1table 1 correlation between figf - i and other parameters ) . table 2table 2 mean sd ( logarithmic converted data ) and 2sd to + 2sd ( raw data ) of total
igf - i , free igf - i , igfbp-1 , igfbp-3 and als shows the levels of free igf - i , total igf - i , igfbp-1 , igfbp-3 and als in the
present study ; mean sd in logarithmically converted data and 2sd to + 2sd in raw data . although serum free igf - i levels in normal children , in patients with growth hormone
deficiency , and in patients with precocious puberty have been previously reported ( 5,6,7,8 , 12 , 13 ) , they were
determined in non - fasting samples . since heuck et al . reported circadian
variation in serum free ultrafiltrable igf - i concentrations in healthy children ( 14 ) , fasting samples obtained at similar times of day
would be preferable to assess age- and sex - dependent changes in the free igf - i levels . in
the present study , we determined the free igf - i levels in the fasting samples obtained in
the morning . we observed significantly higher ratios of free to total igf - i in pubertal age
groups than in prepubertal age groups , while yamada et al . and this
difference might conceivably be caused by the difference in the time of serum sampling . we observed significant increases in the mean free and total igf - i levels at the age of 12
yr in boys , which is close to the average age of peak pubertal height velocity in japanese
boys , and in the mean free igf - i levels at the age of 10 yr and in the mean total igf - i
levels at the age of 11 yr in girls , which are close to average age of peak pubertal height
velocity in japanese girls . although we also observed a significant increase in mean free
igf - i levels at the age of 13 yr in girls , it seems that this apparent increase was caused
by the relatively low free igf - i levels in 12-yr - old girls in the present study . furthermore , a significant decrement in free igf - i levels was observed in 15-yr - old girls ,
which is over the average age of peak pubertal height velocity in japanese girls . high ratios of free to total igf - i were reported in sera samples from early infancy and
normal pregnancy , and were attributed to increased igfbp-3 proteolytic activity ( 7 , 17 ) . in present
study , we observed that free and total igf - i and igfbp-3 levels increased , while igfbp-1
levels decreased during the pubertal period . pubertal decrease in igfbp-1 is ascribed to
increased insulin secretion during puberty ( 18 ) . it
is known that igf - i also binds to igfbp-1 ( 11 ) ; and
it is also well known that growth hormone ( gh ) secretion increases during puberty . igf - i ,
igfbp-3 and als are gh dependent factors ( 13 , 16 , 19 , 20 ) and free igf - i is also assumed to be gh dependent
( table 1 ) , since serum free igf - i levels have
been found to be decreased in patients with growth hormone deficiency ( ghd ) ( 5 , 8 , 13 ) . we think that the high free igf - i levels and the
high ratio of free to total igf - i during the pubertal period are attributable to the more
dramatic increase in total igf - i levels than that in igfbp-3 , caused by increased gh
secretion , and to the decrease in igfbp-1 along with pubertal maturation caused by increased
insulin secretion during puberty . since free igf - i is gh dependent and a more potent biological stimulator to bone than gh
itself , we hypothesize that increased igf - i levels during puberty have an important role in
the pubertal growth spurt , although we did nt have any auxological data in this study . sex
steroid hormones mainly regulate pubertal growth , since patients suffering from both
precocious puberty and ghd develop pubertal growth spurt without gh treatment ( 21 ) . however , gh also contributes to the pubertal growth
spurt , since gh secretion increases during puberty and the pubertal growth spurt in ghd is
small without gh treatment ( 22 ) . the high ratios of free to total igf - i might also play a role in the pubertal growth spurt ,
although the ratios further increased in late puberty when growth velocity decreases .
although the ratios further increased in late puberty when growth velocity decreased in this
study , the situation is the same as the relation between sex steroid hormones and growth
velocity during puberty . sex steroid hormones increase along with pubertal maturation and
reach an adult level , but the growth velocity decreases in the late pubertal period . the
decrease in growth velocity in the late puberty is mainly regulated by bone maturation
toward epiphyseal fusion and not by growth factors or sex steroid hormones . in conclusion , increased free igf - i levels during puberty were caused by dramatic increase
in total igf - i levels , rather than that in igfbp-3 , and by a decrease in igfbp-1 . also ,
igf - i levels may play some role in the pubertal growth spurt . these findings strengthen
further the concept that pubertal increase in gh secretion serves a role in generating the
growth spurt . | serum levels of free insulin - like growth factor ( igf)-i were measured by
immunoradiometric assay ( irma ) in fasting sera of 137 normal boys and 120 normal girls
aged from 8 to 15 yr to study relationships between free igf - i levels and ages , total
igf - i , igf binding protein ( igfbp)-1 , igfbp-3 , and acid - labile subunit ( als ) levels . in
both sexes ,
serum free igf - i levels and the ratios of free igf - i to total igf - i were
significantly higher in the pubertal age groups than in the prepubertal age groups .
serum
levels of free igf - i showed a significant positive correlation with those of total igf - i ,
igfbp-3 and als , while they showed a significant negative correlation with those of
igfbp-1 .
these observations suggest that increase in serum free igf - i levels during
puberty is caused by a dramatic increase in total igf - i , rather than igfbp-3 , and a
decrease in igfbp-1 .
also , high free igf - i levels may play an important role in pubertal
growth spurt . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
gastrointestinal stromal tumor ( gist ) is a gastric submucosal tumor ( smt ) , originating from the interstitial cells of cajal . around 40% of gists gastric gist is treated with surgery , including laparoscopy , endoscopic mucosal resection , or endoscopic submucosal dissection , and imatinib is also used for the treatment of gist . for appropriate treatment , there are several markers that are useful for the diagnosis of gist , such as cd34 , cd117 , and ki-67 . kit gene mutation is a feature of gist , and patients with gist , along with kit gene mutation , have a poor prognosis . ki-67 is involved in cell proliferation , and its high expression correlates with poor prognosis of gist . to exert the above analysis eus - guided fine needle aspiration ( eus - fna ) enables histological evaluation , leading to the pathological diagnosis of gastric gist . there are three sizes of needles available for this procedure : 19-gauge ( 19 g ) , 22-guage ( 22 g ) , and 25-guage ( 25 g ) . based on the method of specimen collection , the needles are classified into aspiration type and biopsy type . aspiration needles are used to acquire specimens by aspirating tissues into the lumen of the outer sheath , while biopsy needles are used to cut specimens that are aspirated into the lumen of the needle . here , we report a case of gastric gist diagnosed with specimens obtained by eus - fna with a 25 g biopsy needle . a 56-year old woman underwent screening with upper gastrointestinal endoscopy ( gif - xrq260 ; olympus , tokyo , japan ) . contrast - enhanced computed tomography ( somatom emotion 16 ; siemens , munich , germany ) was performed for further analysis of the submucosal tumor ( fig . the low - density area was covered with a thin layer of gastric mucosa . for further investigation of the submucosal tumor , eus was performed ( gf - uct260 ; olympus ) . a hypoechoic lesion with a clear margin color doppler image showed a pulsating vascular signal extending into the center of the low - echo lesion from the periphery . eus - fna was performed for pathological evaluation of the submucosal tumor with a 25 g biopsy needle ( echo - hd-25c , cook medical inc . , a fragment of tissue was obtained from the clot and was stained using hematoxylin and eosin ( fig . there was a possibility that these spindle - shaped cells were gastrointestinal stromal tumor or leiomyoma cells . no signal was observed on immunostaining with antit - s100 , a marker of nerve cells ( fig . 3b ) or anti- smooth muscle actin , a marker of smooth muscle cells ( fig . eus - fna is an established and relatively safe technique , with virtually no complications . there are two types of needles available for eus - fna : aspiration type and biopsy type . one major limitation of eus - fna with the aspiration needle is that the acquired specimens are sometimes fragmented and not suitable for pathological analysis such as immunostaining . the 19 g biopsy needle is used to cut specimens that are aspirated into the lumen of the needle . this 19 g biopsy needle in eus - fna can obtain enough specimens for pathological analysis compared to a 22 g aspiration needle . potential complications associated with the used of the 19 g biopsy needle are bleeding and perforation . they concluded that the 22 g biopsy needle is more suitable to obtain enough specimens for pathological analysis . in our case , the 25 g biopsy needle was used . our data suggested that the 25 g needle was adequate to obtain specimens for pathological analysis . the 22 g or 25 g aspiration needle is used for gastric smts less than 10 mm in size . it was expected that the 25 g biopsy needle would be useful to obtain specimens suitable for pathological analysis , with fewer complications even from a small gastric smt . in conclusion , it was found that a 25 g biopsy needle was suitable for eus - fna of gastric gist . it was not assigned as a clinical trial , but was considered a part of daily clinical practice . written informed consent for this report was obtained from the patient . patient records were anonymously and retrospectively analyzed . written informed consent was obtained for upper gastrointestinal endoscopy , contrast - enhanced computed tomography , eus , and eus - fna . | endoscopic ultrasound - guided fine needle aspiration ( eus - fna ) is performed to obtain specimens for pathological analysis . for this procedure , 19-gauge ( 19 g ) ,
22-guage ( 22 g ) , and 25-guage ( 25 g ) needles are available .
the needles are classified into aspiration type and biopsy type .
a 56-year - old woman underwent upper gastrointestinal endoscopy that showed a 38-mm - diameter submucosal tumor .
the elevated lesion was diagnosed as a submucosal tumor of the stomach .
contrast - enhanced computed tomography showed a low - density area on the luminal surface of the gastric wall , which was covered with a thin layer of gastric mucosa .
eus showed a hypoechoic lesion in the submucosal layer .
color doppler image showed a pulsating vascular signal extending into the center of the hypoechoic lesion from the periphery .
eus - fna was performed with a 25 g biopsy needle . the specimen tissue consisted of spindle - shaped cells .
the cells were positive for cd117 and cd34 .
the submucosal tumor was diagnosed as a gastrointestinal stromal tumor . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
endometrial carcinoma is one of the most common gynecologic cancers detected in europe and the united states ( 1 ) , and its incidence is increasing in korea and other asian countries due to higher fat diets and longer life spans . exploratory laparotomy through a midline incision , total abdominal hysterectomy ( tah ) , bilateral salpingo - oophorectomy , peritoneal washing , and dissection of the pelvic or both the pelvic and para - aortic lymph nodes constitute the standard procedures used for the surgical staging of endometrial carcinoma ( 2 ) . recently , due to advances in the use of laparoscopic surgical techniques , laparoscopy has been reportedly used for both the exact staging and the effective treatment of endometrial carcinoma . it has also been demonstrated that laparoscopic surgery results in shorter hospital stays , earlier recovery times , and a better quality of life ( 3 , 4 , 5 ) . obesity is a common risk factor for uterine neoplasia , and accounts for more than half of the patients with endometrial cancer ( 6 , 7 ) . obesity also greatly increases the risk of developing endometrial cancer by as much as 40% . an earlier study reported that obesity is associated with a two- to five - fold increase in the risk of endometrial cancer in both pre- and postmenopausal women ( 8) . there is also a linear increase in the endometrial cancer risk with an increasing body mass index ( bmi ) ( 9 ) . however , the influence of a high bmi on the prognosis of endometrial carcinoma remains controversial . obesity has been associated with a worse prognosis of endometrial carcinoma in several published studies , although there was no association in other and in korean population studies ( 10 , 11 , 12 , 13 , 14 ) . obesity was once a contraindication for advanced laparoscopic procedures ( 15 , 16 ) , although this has recently been reconsidered ( 17 ) . improved instrumentation and techniques have allowed the safe use of many advanced laparoscopic procedures in women with a high bmi ( 18 , 19 , 20 , 21 , 22 ) . however , there are few reports regarding the feasibility of laparoscopic hysterectomy and dissection of the pelvic or both the pelvic and para - aortic lymph nodes in obese korean women . therefore , study attempted to evaluate the feasibility and survival outcome of laparoscopy in obese korean women with endometrial cancer . the medical records of all patients with uterine cancer who were treated at asan medical center between january 1999 and august 2012 were retrospectively reviewed after we received institutional review board approval . in total , 555 patients with endometrial cancer were identified and all had undergone surgery at asan medical center . of these patients , 270 underwent open surgery and 285 underwent laparoscopic surgery . four patients did not receive adequate follow - up examinations following surgery , and the medical records of three other patients were missing . as a result , 278 patients with early - stage endometrial cancer were eligible for inclusion in study . they were divided into three groups , non - obese ( bmi<25.0 ) , overweight ( bmi 25 - 27.99 ) , and obese ( bmi28.0 ) , which is more strict and higher classification than the proposed international obesity task force ( iotf ) classifications for bmi in asia ( 23 , 24 ) . the korean ministry of health and welfare and iotf defined obesity in korea and asia as bmi25 , however , we defined obesity as bmi28.0 in our study in order to reach global standard and to truly evaluate the feasibility and safety of laparoscopic surgery in obese women . one of our patients in whom we performed laparotomy due to stromal adenocarcinoma with adenosquamous features , was included in our study cohort because most of the procedure was finished at the time of the frozen section was sent . laparoscopic pelvic lymphadenectomy was not performed in patients diagnosed with stage ia tumors and who had grade 1 differentiation with favorable histological findings . therefore , pelvic lymphadenectomy was performed in patients with differentiation of grade 2 or above in stage ia , and unfavorable histological types , such as type ii endometrial cancer , regardless of the stage and differentiation of the grade . para - aortic lymphadenectomy was performed in patients with serous , adenosquamous , clear - cell or grade 3 tumors and in tumors with frozen sections demonstrating > 50% myometrial invasion . if grossly enlarged lymph nodes were not seen or if no metastases in the pelvic lymph nodes were found on analysis of the frozen sections , para - aortic lymphadenectomy was performed on the areas below the inferior mesenteric artery . para - aortic lymphadenectomy above the infra mesenteric artery ( i m a ) was performed when there was an extra - uterine lesion seen on frozen sections or type ii histology detected on the pre - operative dilation & currettage ( d&c ) biopsy . in our study , there were 12 patients who underwent para - aortic lymphadenectomy above the i m a . a drain was inserted in all of the patients who underwent lymphadenectomy and in six of the 31 patients who underwent simple hysterectomy . patient age , parity , bmi ( kg / m ) , histological type , international federation of gynecology and obstetrics ( figo ) surgical stage ( 25 ) , the number of harvested lymph nodes , operative time , post - operative hospital stay ( calculated from the date of surgery to the date of discharge ) , estimated blood loss ( ebl ) , need for intra - operative or post - operative blood transfusion , intra- , post - operative , and long - term complications , conversion to laparotomy , disease recurrence , and death were recorded as clinical parameters . conversion to laparotomy , ureteral , bowel , bladder , and vascular injuries , an ebl>1,000 ml , and blood transfusion were considered intra - operative complications . the surgical staging was determined according to the figo 2009 staging system ( 25 ) . the dates and locations of any recurrences were recorded . overall survival ( os ) was calculated from the date of surgery to the date of the last follow - up examination or a patient 's death . disease - free survival ( dfs ) was calculated from the date of surgery to the date of recurrence or to the last follow - up examination in patients who did not develop recurrence . the kaplan - meier method was used to determine the recurrence rate , dfs , and os for all patients . this study was reviewed and approved by the institutional review board ( irb ) of asan medical center ( irb approved protocol no . 2013 - 0301 ) . as this study was a retrospective study using our institution 's electrical database and medical records , this study was reviewed and approved by the institutional review board ( irb ) of asan medical center ( irb approved protocol no . 2013 - 0301 ) . as this study was a retrospective study using our institution 's electrical database and medical records , informed consent was waived . patient age , height , parity , and history of previous laparotomies were similar in the three patient groups ( table 1 ) . obese patients demonstrated more medical problems than the non - obese and overweight group patients ( p=0.025 ) . disease characteristics , procedures , and adjuvant treatments for the study subjects are indicated in table 2 . there were no significant differences between the non - obese , overweight , and obese groups in terms of the surgical stage , histology , procedure , and type of adjuvant therapy . the majority of women in the three groups were diagnosed with stage i endometrioid tumors . there were no differences between the non - obese , overweight , and obese patient groups in terms of the proportions of women who required lymphadenectomy ( 86.8% vs. 93.8% vs. 95.7% , respectively , p=0.067 ) . there were no significant differences between the non - obese , overweight , and obese groups in terms of the operative time ( 180.7 vs. 182.8 vs. 184.5 min ; p=0.124 ) , hospital stay ( 7.9 vs. 8.4 vs. 8.2 days ; p=0.831 ) , ebl ( 233.3 vs. 244.6 vs. 261.6 ml ; p=0.739 ) , post - operative drop in hb ( 1.9 vs. 2.0 vs. 1.9 g / dl ; p=0.748 ) , and the total number of harvested lymph nodes ( 28.9 vs. 27.6 vs. 28.3 ; respectively ; p=0.770 ; table 3 ) . the median follow - up time for the non - obese , overweight , and obese patient groups were 71.7 ( range , 8.3 - 152.4 ) , 75.9 ( range , 6.3 - 131.1 ) , and 80.8 months ( 15.4 - 139.5 ) ( p=0.460 ) . in total , the median follow - up time for the 278 patients was 74.1 months ( range , 6.3 - 152.4 ) . the rates of recurrence , death , disease - free survival , and overall survival were similar in the three groups ( fig . all of the patient groups were similar in terms of their need for intra - operative blood transfusion and the incidences of intra- , post - operative , and long - term complications . there were no complications related to the insertion of the laparoscopic trocars . among the non - obese patients , two developed intra - operative complications including , respectively , small - bowel injury that required bowel repair and bladder wall weakening because of dissection from the uterus with severe adhesion that required reinforcement . three , overweight women developed intra - operative complications , including , respectively , bladder - wall weakening due to dissection from the uterus that required reinforcement , ebl more than 1,000 ml , and conversion to laparotomy due to cervical stromal invasion by endometrioid and adenosquamous tumors , was all of which were noted on the frozen sections . one obese woman developed intra - operative complications including left , internal , iliac - vein injury that required primary repair with ebl more than 1,000 ml ( table 4 ) . the words , " small " and " lean " , have always been used to describe asian populations , and the prevalence of obesity in korea , and in asia in general , is lower than elsewhere in the world . the incidence of endometrial cancer is also increasing in korea and in other asian countries . obesity is one of the most important risk factors for the development of type i endometrial carcinoma , particularly in postmenopausal women ( 26 ) . many previous studies have shown that the use of total laparoscopic hysterectomy and laparoscopic - assisted vaginal hysterectomy are associated with a significant decrease in blood loss , the need for transfusions , postoperative pain , and the duration of hospitalization compared with the use of open surgery for the treatment of endometrial cancer ( 27 , 28 , 29 , 30 , 31 ) . in order to minimize the risk of intra- and post - operative complications the role of vaginal surgery is restricted by the need to harvest lymph nodes for complete nodal staging , although it also demonstrates many advantages by reducing morbidity and the operative time ( 32 ) . since the first report describing the use of laparoscopic surgical staging to assess two patients with clinical stage i endometrial cancer ( 33 ) , the use of laparoscopic surgery for the management of gynecologic cancer , including endometrial cancer , has increased ( 34 ) . many studies have since supported the theory that laparoscopic surgery is feasible for the management of patients with early - stage disease ( 3 , 4 , 5 , 27 , 28 , 30 ) . in our study , there were no significant differences between the non - obese , overweight , and obese groups in terms of the operative time , volume of transfused blood , and the ebl . the mean hospital stay of our patients was longer than that reported in other studies , most likely because most korean patients only want to be discharged after a complete recovery , including the removal of any drainage tubes and stitches and improvement in their general health condition , and the korean medical insurance system covers this ( 3 ) . the no drainage method has been shown to be as effective as the conventional drainage method ( 35 ) . patients could probably be discharged sooner by safely removing drainage tubes earlier than several days following their procedure or by completely avoiding the need for drainage tubes . we did not close the retro - peritoneum following laparoscopic lymphadenectomy in order to allow the free flow of lymphatic fluid into the peritoneal space , and thus resulting in a lower incidence of lymphocyst formation . in our study , there was no difference in terms of the operative time and the rate of transfusion compared to those in previous studies , and our study showed a lower rate of intra- and post - operative complications , a larger number of retrieved lymph nodes , and a better survival outcome after the longest follow - up period ( table 5 ) . farthing et al . ( 19 ) reported a short operative time and low ebl compared to previous studies , including our study . the complication rates observed in the three patient groups in our study were low , which highlights the safety of the surgical approach . intra - operative complications included injuries to the great vessels , bladder , and bowel serosa . this was repaired by clip ligation , and the patient did not undergo a laparotomy . other complications were also resolved during surgery , and no conversions to laparotomy were required as a result of the intra - operative complications . a recent study from an ancillary data analysis of the gynecologic oncology group ( gog ) lap2 also revealed that there was no difference in intra - operative complications in obese patients ( 14 ) . this indicates that obesity is not an obstacle for performing both open and laparoscopic surgery for endometrial cancer . a higher post - operative complication rate was observed in the higher bmi groups as the frequency of these complications increased significantly at a bmi higher than 30 for the duration of the use of antibiotics , and at 35 for venous thrombophlebitis and wound infection ( 14 ) . the etiology of the difference in post - operative complications between western studies and our study might be due to the fact that korean patients are less obese compared to those patients in western studies . however , the mean bmi of the obese group in our study was 30.9 with a range of 28 to 42.2 , and which was also sufficiently ' obese ' for the western criteria . in addition , the aim of the study based on ancillary data of gog lap2 was to investigate the association of obesity on complications , recurrence , and survival outcome in endometrial cancer patients regardless of the type of surgery rather than investigating the surgical feasibility and survival outcome of laparoscopic surgery , as in our study ( 14 ) . increasing bmi did not impact the rate of post - operative complications of laparoscopy in another western study ( 21 ) . this indicates that not only the severity of obesity , itself , but also the difference in patient characteristics in terms of diet , socio - behavior patterns , ethnic group , and differences in study design should be considered and investigated for determining the differences in surgical and survival outcomes . to our knowledge , ours is the first study regarding the surgical feasibility and safety of laparoscopic surgery for treating endometrial cancer in obese korean women . in our study , laparoscopic surgery was feasible in terms of the intra- and post - operative complications , such as one of the previous reports of gog lap2 study data which compared laparoscopy with laparotomy for comprehensive surgical staging of endometrial cancer ( 36 ) . the rate of conversion to laparotomy in laparoscopic surgery was 1.04% to 10.6% in previous studies ( 18 , 19 , 27 , 37 ) . ( 38 ) reported the conversion rate in their studies as 25.8% and 36.4% , respectively . in our study , there was only one case of conversion in the overweight group and thus with a rate of 1.3% . walker et al . ( 36 ) revealed that conversion to laparotomy is associated with obesity , metastatic disease , and increasing age . in our study , the rate of extra - uterine spread was lower and the mean age was younger than that of the gog lap2 data . however , the mean bmi of the obese group in our study was higher than the gog lap2 data , indicating that the reason for the difference in conversion rate between the two studies should be considered with other factors including the rate of metastatic disease and patient age rather than only obesity itself . the surgeon 's preference and clinical experience as well the conventions of medical institutions should be considered , although these are difficult to quantify . we assume that the most important factor is the difference in the rate of pelvic and/or para - aortic lymphadenectomy . walker et al . reported that 98.3% of their patients underwent lymphadenectomy and 91.9% underwent para - aortic lymphadenectomy , and scribner et al . reported the utility of laparoscopy in lymphadenectomy and all patients in this study underwent pelvic and para - aortic lymphadenectomy ( 36 , 38 ) . performed pelvic lymphadenectomy in 77.5% of their patients and para - aortic lymphadenectomy in 17.5% of the patients in his earlier study , and with 75.7% for pelvic and 21.1% for para - aortic lymphadenectomy in his later study , while obermair et al . performed lymphadenectomy in 67.8% of their patients ( 18 , 27 , 37 ) . in our study , 98.8% and 95.7% , respectively , underwent lymphadenectomy , and 26.8% and 31.4% underwent para - aortic lymphadenectomy in the overweight group and the obese group . reported that an increasing bmi in laparoscopic surgery patients decreases the frequency of lymphadenectomy and the number of harvested para - aortic lymph nodes with 4.6 in the obese group with a bmi of 30 - 39 and 2.2 in the morbidly obese group with a bmi of 40 - 49 ( 39 ) . ( 21 ) also reported that the performance of para - aortic and pelvic lymphadenectomy had an inverse relationship with an increasing bmi , although an increasing bmi did not impact the number of para - aortic and pelvic lymph nodes removed . scribner et al . and eltabbakh et al . harvested 6.6 and 2.5 para - aortic lymph nodes in their studies ( 27 , 38 ) . in our study , 5.3 and 3.7 para - aortic lymph nodes were harvested in the overweight group and the obese group , respectively , and which seems to have no significant difference compared to previous studies . although not statistically significant , the obese group showed less recurrence and death in our study . previous studies have suggested that obesity is associated with a worse prognosis , while there no relationship seen in other studies ( 10 , 11 , 12 , 13 ) . gunderson et al . ( 14 ) recently reported that a high bmi was not associated with the patient survival outcome , but showed a lower recurrence although not of statistical significance . this is probably because an increasing bmi shows a lower figo stage , a higher proportion of well - differentiated endometrioid type tumors , and a lower risk factor for recurrence such as lymph node / ovarian metastasis , as well as positive cytology as defined by keys et al . in gog 99 also in a previous korean population study , overweight and obese women had an earlier figo stage with less cervical extension and positive peritoneal cytology ( 13 ) . as seen in previous studies , there were no significant differences from our study in terms of the disease - free and overall survival rates in our three patient groups . it indicates , therefore , that the use of laparoscopic surgery to manage obese patients has no appreciable impact on their prognosis ( 22 ) . the limitation of our study is its retrospective design and the possibility of a selection bias as most of the laparoscopic surgeries were chosen by the patient and/or surgeon based on their preference and decision , although there was no difference in the patient characteristics in the three groups . at the same time , this is the largest korean study to date to directly investigate the surgical and survival outcomes of obese korean patients with endometrial cancer who underwent laparoscopic surgery during such a long study period . in conclusion , our findings indicate that laparoscopic surgery is a safe and feasible procedure for managing obese , korean , early - stage endometrial carcinoma patients and does not appear to affect the prognosis in these cases . large , randomized , prospective , multi - center studies regarding the safety and feasibility of laparoscopic surgery for the management of obese korean women with early endometrial carcinoma are still needed . | the purpose of this study was to evaluate the surgical feasibility of and survival outcome after laparoscopy in obese korean women with endometrial cancer which has recently been increasing .
we reviewed the medical records of the patients treated at our medical institution between 1999 and 2012 .
the patients were divided into three groups , non - obese ( body mass index [ bmi]<25.0 ) , overweight ( bmi 25 - 27.99 ) , and obese ( bmi28.0 ) .
these patient groups were compared in terms of their clinical characteristics , treatment methods , as well as surgical and survival outcomes . in total ,
55 of the 278 eligible patients were obese women .
there were no differences in the three groups in terms of the proportion of patients who underwent lymphadenectomy , their cancer stage , histologic type , type of adjuvant treatment administered , intra- , post - operative , and long - term complications , operative time , number of removed lymph nodes , blood loss , and duration of hospitalization ( p=0.067 , 0.435 , 0.757 , 0.739 , 0.458 , 0.173 , 0.076 , 0.124 , 0.770 , 0.739 , and 0.831 , respectively ) . the disease - free survival ( dfs ) times were 139.1 vs. 121.6 vs. 135.5 months ( p=0.313 ) , and the overall survival ( os ) times were 145.2 vs. 124.8 vs. 139.5 months ( p=0.436 ) for each group , respectively .
obese women with endometrial cancer can , therefore , be as safely managed using laparoscopy as women with normal bmis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
colloid science deals with entities in size ranges between 1 nm and some micrometers , due to these small dimensions the surfaces are most important , and thus it is closely linked with interface science . at the lower size limit , it embraces nanosciences which deals with dimensions below 100 nm , although not all scientists in this field have realized how much it relies on classical colloid science . on the other hand the field is defined by a dimension , not by a type of material and it therefore includes inorganic , organic and biomaterials . thus , it is the basic of many fashionable disciplines like bio- , medical and nanotechnology , and hence will experience a bright future as enabling science . however , one may ask the questions if there are also challenges in the development of colloid and interface science and if there emerged new advances to tackle these challenges . answers to these questions are yes , and i will below give examples from work out of my own department . these examples are not at all exhaustive , and i have selected them because of own competence but by no means claiming to cover this broad field . i see major challenges in the following areas :
structure and dynamics of fluid interfaces at submolecular resolution.nonequilibrium structures and properties.from smart to feed back and remote controlled systems . the last 2 decades have seen a tremendous development of techniques to study interfaces directly and with molecular resolution . these are synchrotron x - ray and neutron scattering , ftir spectroscopy , nonlinear optical spectroscopies as well as simulations . concerning molecules or particles at interfaces , the trend has moved from classical insoluble surfactants and phospholipids towards more complex molecules like amphiphilic polymers , peptides , proteins and their mixtures as well as nanoparticles . this is understandable from the desire to construct more complex systems and also to answer biomedical questions . on the other hand , there are still burning questions related to most simple interfaces and on these i will present two examples below : the first concerns the structure of water at the free surface and its influence by ions in the subphase . to conclude on this vis / ir sum frequency generation ( sfg ) applying sfg a high intensity visible and a tuneable ir beam are impinging on a surface , and a beam at the sum frequency may result if the ir beam is in resonance with a vibration . since this is a second order non - linear effect only species at the interface with a symmetry break figure 1 shows a typical spectrum of the water surface with various amounts of scn in the subphase . the bands of the ion free water surface have traditionally been assigned to the free oh vibration ( 3700 cm ) , liquid water and solid water ( 3,450 cm and 3,200 cm , respectively ) . accordingly one realizes that the ice like peak is reduced by ion addition , i.e. that the ion disturbs the hydrogen bonding network in agreement with simulations . measuring the sfg signal for different polarizations one also deduces that the ion , in this case an anisotropic one , is preferentially oriented at the surface . 1left : sketch of a sum frequency measurement . a visible ( wvis ) and an ir ( wir ) laser beam impinge on a surface and scattering with the sum frequency wsfg may result in resonance with wir . right top sfg spectrum of the free water in absence ( grey ) or presence of kscn ( dark ) in the subphase . right bottom : sfg spectrum of the scn anion for different polarization of incoming and reflected beam left : sketch of a sum frequency measurement . a visible ( wvis ) and an ir ( wir ) laser beam impinge on a surface and scattering with the sum frequency wsfg may result in resonance with wir . right top sfg spectrum of the free water in absence ( grey ) or presence of kscn ( dark ) in the subphase . right bottom : sfg spectrum of the scn anion for different polarization of incoming and reflected beam there are also many attempts to measure ion distribution at charged interfaces which would be a stringent test of theories . however , estimates for charged monolayers indicate that even for monovalent ions more than 90% of them are expected within a distance below 5 from the surface . therefore one needs methods with spatial resolution better than 1 , and this is very difficult to achieve . one way could be to use standing x - ray waves which can be produced via interference at interfaces , but even the most sophisticated attempts have been not convincing in view of this goal . an alternative may be not to dwell on distribution but to measure competitive ion binding . as an example fig . 2 shows measurements of x - ray fluorescence of different ions near an interface . in this example an evanescent x - ray beam hits the surface exciting ions residing within its penetration depth of about 50 . the fluorescence of these ions is then detected measuring their concentration . for calibration one may use films with exclusively one ion in the subphase or a higher incidence angle where the bulk concentration is detected . principally one can also vary the penetration depth via the incidence angle , but in reality this variation is possible between 40 and 100 , and thus distributions in this range , e.g. for polymer brushes , can be resolved . in the specific example of fig . 2 , top , one can distinguish the emission of s ( from the surfactant ) and of argon ( from the gas in the measurement chamber ) which may serve for normalization , and the emission of k and of cs . comparing with the situation of only one ion in the subphase this lack of ion specifity is expected if the ions do not bind at all or with the same strength . a qualitatively different behaviour is , however , expected comparing li and cs ( fig . 2 , bottom ) . there , an excess of li / cs of 9:1 is apparently necessary to achieve equal binding . these studies can be extended to many different ions , but they need a dedicated set - up at a synchroton . they will provide very important information on ion - specific binding including the hofmeister effect , but will require dedicated theoretical simulations to achieve an understanding . fig.2a x - ray fluorescence spectrum after irradiation by an evanescent x - ray beam with peaks of s , ar , k and cs for the solution containing only one type of cation and for a 1:1 mixture ( full line ) . b x - ray fluorescence spectrum for a solution containing only li and cs+ and for a li : cs = 9:1 ratio ( full line ) a x - ray fluorescence spectrum after irradiation by an evanescent x - ray beam with peaks of s , ar , k and cs for the solution containing only one type of cation and for a 1:1 mixture ( full line ) . b x - ray fluorescence spectrum for a solution containing only li and cs+ and for a li : cs = 9:1 ratio ( full line ) in view of the rapid progress concerning x - ray sources including free electron lasers one may ask how this will affect science with fluid interfaces . i am convinced that by these x - ray sources other techniques , previously developed for hard surfaces in vacuum , will become available like photoelectron spectroscopy or extended x - ray fine structure analysis with glancing x - rays . the latter could shed light on the local environment of binding ions , an important question concerning the above example . also more refined analysis of two - dimensional arrays of polymers , peptides , proteins and nanoparticles will be possible . i am , however , sceptical on the use of the most brilliant x - ray sources . they cause severe sample damage within some fsec , and the questions will be which information can be gathered within this time frame . many colloidal systems are kinetically hindered to minimize their surface energy and thus are used in a nonequilibrium state . prominent classical areas are emulsions and dispersions but also the field of nucleation and growth has encountered much interest at least since the times of wolfgang ostwald . although being far away from a quantitative understanding it encounters at present a boom in view of preparation of nanoparticles of defined size and shape and their aggregation [ 11 , 36 ] . i will spare here examples of my department on this topic [ 12 , 34 ] but concentrate on the field of sonochemistry which sounds exotic and is rather difficult to study quantitatively . on the other hand it is very important and many scientists have used ultrasound to clean a surface or to disperse a sample by this process . if a liquid is exposed to ultrasound gas bubbles may be nucleated and grown ( cavitation ) and the later collapse of the bubble converts the surface energy into mechanical energy and heat . thus temperatures above 5.000 k and pressures above 1.000 atm result for short times ( < s ) and very local ( < m ) . due to extreme cooling rates ( 10 k / s ) structures can thus be formed far away from equilibrium . examples are composites of immiscible elements , sintering of particles , cross - linking of polymers and proteins , flotation and selective dispersion from solids . hence one can perform high temperature and pressure chemistry with a reactor at normal conditions , but the main problem arises to control nonequilibrium processes locally and in short time . as an example of using high pressures fig . 3 shows electron micrographs of clays sonochemically treated in the presence of au nanoparticles and surfactant . here the surfactant causes exfoliation , and hence a large amount ( 5% ) of particles can be stably inserted . this system serves as a model of a catalyst carrier , and in the process , compared to conventional procedures , the incorporation time is reduced from days to less than an hour , i.e. by about a factor 100 . fig 3top : scheme of ultrasonic exfoliation of clays by tensides ( left ) and following insertion of au nanoparticles ( right ) . bottom : sem of clay microparticles ( left ) and tem of au nanoparticles on clay sheets top : scheme of ultrasonic exfoliation of clays by tensides ( left ) and following insertion of au nanoparticles ( right ) . bottom : sem of clay microparticles ( left ) and tem of au nanoparticles on clay sheets in the example of fig . 3 , the cavitation bubble is formed in bulk with clay and au nanoparticles concentrating at the bubble surface . the process may be easier to describe , at least theoretically , if one considers sonochemistry at surfaces . there 4 ) and the latter should be favoured , the amount depending on the surface energy of the solid . consequently preparing a surface with hydrophobic and hydrophilic patterns this can indeed be verified ( belova v , gorin d , shchukin dg , mohwald h. , to be published ; fig . 4 ) . preparing by stamping an al2o3 surface with hydrophilic spots in a hydrophobic laterally continuous area one can clearly realize the influence of the ultrasound causing nm - sized corrugations only on the hydrophobic areas . although in this case a measurement of nucleation rates and a theoretical relation between nucleation rate , contact angle and ultrasonic power are still pending , i expect this is the beginning of a field with large potential : varying and measuring contact angles one should be able to control nucleation , varying the sizes of hydrophobic areas one should learn about critical radii , varying their shape one may also produce peculiar bubble shapes . with ultrasound as a reproducible trigger and patterning one can also define time and space of nucleation enabling direct measurements of nucleation and growth via optical scattering and imaging . on the application side one can use the high definition to prepare and/or to use patterned surfaces and control their selective dispersion as well as to use the process for selective cleaning without destruction . whereas in the first case the surface tension of the liquid is most important , in the second case also the interfacial tension s of the solid and the contact angles are relevant , the gas pressures p and chemical potentials in both phases being equal . bottom : sem image at different magnification of an al surface after 10 min of ultrasonication top left : bubble nucleation and growth in bulk and at a surface . whereas in the first case the surface tension of the liquid is most important , in the second case also the interfacial tension s of the solid and the contact angles are relevant , the gas pressures p and chemical potentials in both phases being equal . bottom : sem image at different magnification of an al surface after 10 min of ultrasonication ultrasound has also revealed to be an important tool in the design of feedback active coatings as is shown by means of the example of fig . there use is made of the fact that ultrasound causes defined surface corrugations ( fig . 5a ) , and predominantly by ftir - spectroscopy one may show that the surface is completely oxidized . this , in contrast to the untreated surface , enables a complete surface coating by the layer - by - layer technique . it can also be extended to prepare containers with walls defined as precise as multilayers but containing large amounts of functional molecules . of special importance here is the fact that in many cases stability and properties are determined by electrostatic interactions . these in turn can be modulated via ph , salt or electrochemical potential , and this is made use of in designing corrosion protective coatings . figure 5b shows even macroscopically that a surface coated suitably is protected against visible corrosion in contrast to an unprotected one . 5top : sketch of a bubble in bulk and on a hydrophilic ( al ) surface . bottom left : sem image of untreated ( a ) and sonochemically treated al ( b ) . bottom right : optical micrograph of untreated ( top ) and treated ( middle ) al after 24 h in salt solution . right lower corner : sketch of the coating of the ultrasonicated surface by the layer - by - layer technique with corrosion inhibitor inside top : sketch of a bubble in bulk and on a hydrophilic ( al ) surface . bottom left : sem image of untreated ( a ) and sonochemically treated al ( b ) . bottom right : optical micrograph of untreated ( top ) and treated ( middle ) al after 24 h in salt solution . right lower corner : sketch of the coating of the ultrasonicated surface by the layer - by - layer technique with corrosion inhibitor inside the principles of this protection mechanism can be understood and also quantified by means of the scheme and results in fig . 6 : if a corrosion pit forms its local potential or ph differs from that of the majority of the surface . this then affects the electrical balance within the coating , in consequence increasing its permeability and releasing bound or encapsulated ( in dispersed nanocontainers ) corrosion inhibitors . . the action of this mechanism can be followed by scratching the coating and locally following the corrosion current by the scanning vibrating electrode technique . 7 that the corrosion current increases for the unprotected surface but it decays with time for the protected one due to the inhibitor action . in addition there may be a change in local mobility in the polyelectrolyte multilayer enabling molecular movement to seal the defected coating . 6top left : concept of self - repairing coating : nanocontainers are opening near a defect due to a different local ph or electrochemical potential and thus release a corrosion inhibitor . bottom left : possible realization : sio2 nanoparticles are coated by multilayers of ( polyethyleneimine ( pei ) and polystyrenesulfonic acid ( pss ) and embedded into a zro2/ sio2 sol/ gel coating on an al alloy surface technically used . top right : laterally resolved corrosion current in a cm for an unprotected surface after indicated times in salt solution ( a ) following a scratch on the surface seen in the optical micrograph ( b ) . bottom right : time and space dependent corrosion current for a surface protected by an inhibitor containing layer ( a ) following a scratch optically visualized ( b)fig . a capsule containing the signal peptide siinfekl is brought into a mammalian cell ( vero - cells ) and opened there by ir - light ( 13 ) . the released peptide is bound to the receptor mhc class i proteins ( 4 ) forming the complex , and is finally transported to the cell surface ( 5 ) . bottom : confocal fluorescence micrograph showing the cytosol ( green ) , the nucleus ( dark ellipse ) and a capsule ( red dot ) top left : concept of self - repairing coating : nanocontainers are opening near a defect due to a different local ph or electrochemical potential and thus release a corrosion inhibitor . bottom left : possible realization : sio2 nanoparticles are coated by multilayers of ( polyethyleneimine ( pei ) and polystyrenesulfonic acid ( pss ) and embedded into a zro2/ sio2 sol/ gel coating on an al alloy surface technically used . top right : laterally resolved corrosion current in a cm for an unprotected surface after indicated times in salt solution ( a ) following a scratch on the surface seen in the optical micrograph ( b ) . bottom right : time and space dependent corrosion current for a surface protected by an inhibitor containing layer ( a ) following a scratch optically visualized ( b ) top : scheme describing immunological response under study . a capsule containing the signal peptide siinfekl is brought into a mammalian cell ( vero - cells ) and opened there by ir - light ( 13 ) . the released peptide is bound to the receptor mhc class i proteins ( 4 ) forming the complex , and is finally transported to the cell surface ( 5 ) . bottom : confocal fluorescence micrograph showing the cytosol ( green ) , the nucleus ( dark ellipse ) and a capsule ( red dot ) in the above example we have made use of one of the many present developments of so - called smart materials , i.e. materials that respond to the environment . these are the base elements of more sophisticated devices that , analogous to many regulating and regulated systems are connected as a positive or negative feedback . feedbacks are typically used in nature or technology to maintain a certain concentration , potential or mechanical force on a desired level and uses are maximum amplification for a triode , fast response for a muscle or delivery of stored chemical energy on demand . here the prime questions will not concern molecular mechanisms but the interplay and coupling of different responsive elements . i expect that another important area in the future will be the remote control of processes via external fields , electromagnetical , optical , acoustical or thermal ones . for demonstration , i selected an example of own work towards biosciences . the base elements here are :
polyelectrolyte multilayer capsules , which are known to be at high temperature very soft and permeable also for macromolecules , are glassy and virtually impermeable at low temperature . the transition between high and low temperature can be described like a glass transition , and the corresponding temperature may be tuned via ph , salt and type of polymer between room temperature and 90 c.metallic inorganic nanoparticles can be incorporated into the multilayers . via aggregation , preparation of rods or core / shell geometry they can be made to strongly absorb near ir - light [ 24 , 25 ] . this light is then converted into heat and one can show that with a low power ir diode one can increase the temperature of the particle by some 10 k whereas the temperature may be kept below 35 c some 10 nm apart . therefore one can create locally hot spots with permeability for large molecules controlled spatially and temporally via the ir laser diode.by consecutively heating and shrinking of the capsules in a solution of a signal peptide the latter can be encapsulated and these capsules can be brought into a cell by electroporation . this method can be used for virtually any type of cells ( even those which do nt exhibit phagocytosis ) , although other cells like macrophages or various cancer cells would incorporate these capsules spontaneously .since the capsules are not biodegradable one can wait for some hours till the cells have recovered from the harsh electroporation treatment . then one may select a specific capsule and location and open it by ir light , the process we call optoporation .intracellular delivery and release can be used for investigation of a receptor - mediated antigen presentation a process of fundamental importance in immunology . the idea of these experiments consists in bringing a microcapsule filled with peptides into a mammalian cell . then one can follow the binding of the peptide to a receptor , trace its intracellular transport , and eventually use the corresponding antibodies to investigate the surface presentation . approaches typically used for assessing this and , it is fair to say , other biological processes are rather descriptive , so further developments are expected in using math for quantification . polyelectrolyte multilayer capsules , which are known to be at high temperature very soft and permeable also for macromolecules , are glassy and virtually impermeable at low temperature . the transition between high and low temperature can be described like a glass transition , and the corresponding temperature may be tuned via ph , salt and type of polymer between room temperature and 90 c . preparation of rods or core / shell geometry they can be made to strongly absorb near ir - light [ 24 , 25 ] . this light is then converted into heat and one can show that with a low power ir diode one can increase the temperature of the particle by some 10 k whereas the temperature may be kept below 35 c some 10 nm apart . therefore one can create locally hot spots with permeability for large molecules controlled spatially and temporally via the ir laser diode . by consecutively heating and shrinking of the capsules in a solution of a signal peptide the latter this method can be used for virtually any type of cells ( even those which do nt exhibit phagocytosis ) , although other cells like macrophages or various cancer cells would incorporate these capsules spontaneously . since the capsules are not biodegradable one can wait for some hours till the cells have recovered from the harsh electroporation treatment . then one may select a specific capsule and location and open it by ir light , the process we call optoporation . intracellular delivery and release can be used for investigation of a receptor - mediated antigen presentation a process of fundamental importance in immunology . the idea of these experiments consists in bringing a microcapsule filled with peptides into a mammalian cell . then one can follow the binding of the peptide to a receptor , trace its intracellular transport , and eventually use the corresponding antibodies to investigate the surface presentation . approaches typically used for assessing this and , it is fair to say , other biological processes are rather descriptive , so further developments are expected in using math for quantification . figure 7 ( top ) presents a model of the process and the expected response , while fig . 7 ( bottom ) shows that the encapsulated peptide ( red ) can be brought near the cell nucleus ( dark ellipse ) . according to our model , the released signal peptide should be transferred via several compartments , bind to a receptor and form the complex which should be transported to the cell surface , fig . a fine detail of this experiment is the surface binding of the antibody which is specific to the complex but which is added from outside of the cell . the binding manifests visibility of the cell under study by t - cells the hall - mark of the immune system response . the question now arises if this model is correct and at which time scales the processes occur . to answer the above question fig . 8 shows time dependent fluorescence micrographs on the distribution of the peptide ( sinfekl - tamra ) and of the receptor mhc class i. measuring the intensity at the center of the cell and at the edge one can thus quantify the transport of the receptor to the surface ( right in fig . 8) , and via different labelling this confirms that the suggested model is correct and that the corresponding processes last on the order of hours . 8left : fluorescence micrograph of the distribution of a green labelled receptor ( top row ) as a function of time ( from left 0 , 10 , 20 h ) and of the signal peptide ( red labelled , bottom row ) . to quantify the increasing receptor concentration at the cell surface the intensities at the edge are related to those at the center ( right in fig . the scale bar corresponds to 50 m left : fluorescence micrograph of the distribution of a green labelled receptor ( top row ) as a function of time ( from left 0 , 10 , 20 h ) and of the signal peptide ( red labelled , bottom row ) . to quantify the increasing receptor concentration at the cell surface the intensities at the edge are related to those at the center ( right in fig . the scale bar corresponds to 50 m in this example as well as in the previous one the task is not to answer fundamentally new questions although this is possible too , but to look into the interplay of multiple components , the problems coming from disciplines like materials science , medicine and biology . in this respect colloid and interface science may become a helper science which i do not mean negative since this help will be most important and can spread into many disciplines . the last 2 decades have seen a tremendous development of techniques to study interfaces directly and with molecular resolution . these are synchrotron x - ray and neutron scattering , ftir spectroscopy , nonlinear optical spectroscopies as well as simulations . concerning molecules or particles at interfaces , the trend has moved from classical insoluble surfactants and phospholipids towards more complex molecules like amphiphilic polymers , peptides , proteins and their mixtures as well as nanoparticles . this is understandable from the desire to construct more complex systems and also to answer biomedical questions . on the other hand , there are still burning questions related to most simple interfaces and on these i will present two examples below : the first concerns the structure of water at the free surface and its influence by ions in the subphase . to conclude on this vis / ir sum frequency generation ( sfg ) applying sfg a high intensity visible and a tuneable ir beam are impinging on a surface , and a beam at the sum frequency may result if the ir beam is in resonance with a vibration . since this is a second order non - linear effect only species at the interface with a symmetry break figure 1 shows a typical spectrum of the water surface with various amounts of scn in the subphase . the bands of the ion free water surface have traditionally been assigned to the free oh vibration ( 3700 cm ) , liquid water and solid water ( 3,450 cm and 3,200 cm , respectively ) . accordingly one realizes that the ice like peak is reduced by ion addition , i.e. that the ion disturbs the hydrogen bonding network in agreement with simulations . measuring the sfg signal for different polarizations one also deduces that the ion , in this case an anisotropic one , is preferentially oriented at the surface . 1left : sketch of a sum frequency measurement . a visible ( wvis ) and an ir ( wir ) laser beam impinge on a surface and scattering with the sum frequency wsfg may result in resonance with wir . right top sfg spectrum of the free water in absence ( grey ) or presence of kscn ( dark ) in the subphase . right bottom : sfg spectrum of the scn anion for different polarization of incoming and reflected beam left : sketch of a sum frequency measurement . a visible ( wvis ) and an ir ( wir ) laser beam impinge on a surface and scattering with the sum frequency wsfg may result in resonance with wir . right top sfg spectrum of the free water in absence ( grey ) or presence of kscn ( dark ) in the subphase . right bottom : sfg spectrum of the scn anion for different polarization of incoming and reflected beam there are also many attempts to measure ion distribution at charged interfaces which would be a stringent test of theories . however , estimates for charged monolayers indicate that even for monovalent ions more than 90% of them are expected within a distance below 5 from the surface . therefore one needs methods with spatial resolution better than 1 , and this is very difficult to achieve . one way could be to use standing x - ray waves which can be produced via interference at interfaces , but even the most sophisticated attempts have been not convincing in view of this goal . an alternative may be not to dwell on distribution but to measure competitive ion binding . as an example fig . 2 shows measurements of x - ray fluorescence of different ions near an interface . in this example an evanescent x - ray beam hits the surface exciting ions residing within its penetration depth of about 50 . the fluorescence of these ions is then detected measuring their concentration . for calibration one may use films with exclusively one ion in the subphase or a higher incidence angle where the bulk concentration is detected . principally one can also vary the penetration depth via the incidence angle , but in reality this variation is possible between 40 and 100 , and thus distributions in this range , e.g. for polymer brushes , can be resolved . in the specific example of fig . 2 , top , one can distinguish the emission of s ( from the surfactant ) and of argon ( from the gas in the measurement chamber ) which may serve for normalization , and the emission of k and of cs . comparing with the situation of only one ion in the subphase this lack of ion specifity is expected if the ions do not bind at all or with the same strength . a qualitatively different behaviour is , however , expected comparing li and cs ( fig . 2 , bottom ) . there , an excess of li / cs of 9:1 is apparently necessary to achieve equal binding . these studies can be extended to many different ions , but they need a dedicated set - up at a synchroton . they will provide very important information on ion - specific binding including the hofmeister effect , but will require dedicated theoretical simulations to achieve an understanding . fig.2a x - ray fluorescence spectrum after irradiation by an evanescent x - ray beam with peaks of s , ar , k and cs for the solution containing only one type of cation and for a 1:1 mixture ( full line ) . b x - ray fluorescence spectrum for a solution containing only li and cs+ and for a li : cs = 9:1 ratio ( full line ) a x - ray fluorescence spectrum after irradiation by an evanescent x - ray beam with peaks of s , ar , k and cs for the solution containing only one type of cation and for a 1:1 mixture ( full line ) . b x - ray fluorescence spectrum for a solution containing only li and cs+ and for a li : cs = 9:1 ratio ( full line ) in view of the rapid progress concerning x - ray sources including free electron lasers one may ask how this will affect science with fluid interfaces . i am convinced that by these x - ray sources other techniques , previously developed for hard surfaces in vacuum , will become available like photoelectron spectroscopy or extended x - ray fine structure analysis with glancing x - rays . the latter could shed light on the local environment of binding ions , an important question concerning the above example . also more refined analysis of two - dimensional arrays of polymers , peptides , proteins and nanoparticles will be possible . i am , however , sceptical on the use of the most brilliant x - ray sources . they cause severe sample damage within some fsec , and the questions will be which information can be gathered within this time frame . many colloidal systems are kinetically hindered to minimize their surface energy and thus are used in a nonequilibrium state . prominent classical areas are emulsions and dispersions but also the field of nucleation and growth has encountered much interest at least since the times of wolfgang ostwald . although being far away from a quantitative understanding it encounters at present a boom in view of preparation of nanoparticles of defined size and shape and their aggregation [ 11 , 36 ] . i will spare here examples of my department on this topic [ 12 , 34 ] but concentrate on the field of sonochemistry which sounds exotic and is rather difficult to study quantitatively . on the other hand it is very important and many scientists have used ultrasound to clean a surface or to disperse a sample by this process . if a liquid is exposed to ultrasound gas bubbles may be nucleated and grown ( cavitation ) and the later collapse of the bubble converts the surface energy into mechanical energy and heat . thus temperatures above 5.000 k and pressures above 1.000 atm result for short times ( < s ) and very local ( < m ) . due to extreme cooling rates ( 10 k / s ) structures examples are composites of immiscible elements , sintering of particles , cross - linking of polymers and proteins , flotation and selective dispersion from solids . hence one can perform high temperature and pressure chemistry with a reactor at normal conditions , but the main problem arises to control nonequilibrium processes locally and in short time . as an example of using high pressures fig . 3 shows electron micrographs of clays sonochemically treated in the presence of au nanoparticles and surfactant . here the surfactant causes exfoliation , and hence a large amount ( 5% ) of particles can be stably inserted . this system serves as a model of a catalyst carrier , and in the process , compared to conventional procedures , the incorporation time is reduced from days to less than an hour , i.e. by about a factor 100 . fig 3top : scheme of ultrasonic exfoliation of clays by tensides ( left ) and following insertion of au nanoparticles ( right ) . bottom : sem of clay microparticles ( left ) and tem of au nanoparticles on clay sheets top : scheme of ultrasonic exfoliation of clays by tensides ( left ) and following insertion of au nanoparticles ( right ) . bottom : sem of clay microparticles ( left ) and tem of au nanoparticles on clay sheets in the example of fig . 3 , the cavitation bubble is formed in bulk with clay and au nanoparticles concentrating at the bubble surface . the process may be easier to describe , at least theoretically , if one considers sonochemistry at surfaces . there 4 ) and the latter should be favoured , the amount depending on the surface energy of the solid . consequently preparing a surface with hydrophobic and hydrophilic patterns this can indeed be verified ( belova v , gorin d , shchukin dg , mohwald h. , to be published ; fig . 4 ) . preparing by stamping an al2o3 surface with hydrophilic spots in a hydrophobic laterally continuous area one can clearly realize the influence of the ultrasound causing nm - sized corrugations only on the hydrophobic areas . although in this case a measurement of nucleation rates and a theoretical relation between nucleation rate , contact angle and ultrasonic power are still pending , i expect this is the beginning of a field with large potential : varying and measuring contact angles one should be able to control nucleation , varying the sizes of hydrophobic areas one should learn about critical radii , varying their shape one may also produce peculiar bubble shapes . with ultrasound as a reproducible trigger and patterning one can also define time and space of nucleation enabling direct measurements of nucleation and growth via optical scattering and imaging . on the application side one can use the high definition to prepare and/or to use patterned surfaces and control their selective dispersion as well as to use the process for selective cleaning without destruction . whereas in the first case the surface tension of the liquid is most important , in the second case also the interfacial tension s of the solid and the contact angles are relevant , the gas pressures p and chemical potentials in both phases being equal . bottom : sem image at different magnification of an al surface after 10 min of ultrasonication top left : bubble nucleation and growth in bulk and at a surface . whereas in the first case the surface tension of the liquid is most important , in the second case also the interfacial tension s of the solid and the contact angles are relevant , the gas pressures p and chemical potentials in both phases being equal . bottom : sem image at different magnification of an al surface after 10 min of ultrasonication ultrasound has also revealed to be an important tool in the design of feedback active coatings as is shown by means of the example of fig . there use is made of the fact that ultrasound causes defined surface corrugations ( fig . 5a ) , and predominantly by ftir - spectroscopy one may show that the surface is completely oxidized . this , in contrast to the untreated surface , enables a complete surface coating by the layer - by - layer technique . it can also be extended to prepare containers with walls defined as precise as multilayers but containing large amounts of functional molecules . of special importance here is the fact that in many cases stability and properties are determined by electrostatic interactions . these in turn can be modulated via ph , salt or electrochemical potential , and this is made use of in designing corrosion protective coatings . figure 5b shows even macroscopically that a surface coated suitably is protected against visible corrosion in contrast to an unprotected one . 5top : sketch of a bubble in bulk and on a hydrophilic ( al ) surface . bottom left : sem image of untreated ( a ) and sonochemically treated al ( b ) . bottom right : optical micrograph of untreated ( top ) and treated ( middle ) al after 24 h in salt solution . right lower corner : sketch of the coating of the ultrasonicated surface by the layer - by - layer technique with corrosion inhibitor inside top : sketch of a bubble in bulk and on a hydrophilic ( al ) surface . bottom left : sem image of untreated ( a ) and sonochemically treated al ( b ) . bottom right : optical micrograph of untreated ( top ) and treated ( middle ) al after 24 h in salt solution . right lower corner : sketch of the coating of the ultrasonicated surface by the layer - by - layer technique with corrosion inhibitor inside the principles of this protection mechanism can be understood and also quantified by means of the scheme and results in fig . 6 : if a corrosion pit forms its local potential or ph differs from that of the majority of the surface . this then affects the electrical balance within the coating , in consequence increasing its permeability and releasing bound or encapsulated ( in dispersed nanocontainers ) corrosion inhibitors . they then anneal the defect , and we therefore have a self - repairing coating . the action of this mechanism can be followed by scratching the coating and locally following the corrosion current by the scanning vibrating electrode technique . 7 that the corrosion current increases for the unprotected surface but it decays with time for the protected one due to the inhibitor action . in addition there may be a change in local mobility in the polyelectrolyte multilayer enabling molecular movement to seal the defected coating . 6top left : concept of self - repairing coating : nanocontainers are opening near a defect due to a different local ph or electrochemical potential and thus release a corrosion inhibitor . bottom left : possible realization : sio2 nanoparticles are coated by multilayers of ( polyethyleneimine ( pei ) and polystyrenesulfonic acid ( pss ) and embedded into a zro2/ sio2 sol/ gel coating on an al alloy surface technically used . top right : laterally resolved corrosion current in a cm for an unprotected surface after indicated times in salt solution ( a ) following a scratch on the surface seen in the optical micrograph ( b ) . bottom right : time and space dependent corrosion current for a surface protected by an inhibitor containing layer ( a ) following a scratch optically visualized ( b)fig . a capsule containing the signal peptide siinfekl is brought into a mammalian cell ( vero - cells ) and opened there by ir - light ( 13 ) . the released peptide is bound to the receptor mhc class i proteins ( 4 ) forming the complex , and is finally transported to the cell surface ( 5 ) . bottom : confocal fluorescence micrograph showing the cytosol ( green ) , the nucleus ( dark ellipse ) and a capsule ( red dot ) top left : concept of self - repairing coating : nanocontainers are opening near a defect due to a different local ph or electrochemical potential and thus release a corrosion inhibitor . bottom left : possible realization : sio2 nanoparticles are coated by multilayers of ( polyethyleneimine ( pei ) and polystyrenesulfonic acid ( pss ) and embedded into a zro2/ sio2 sol/ gel coating on an al alloy surface technically used . top right : laterally resolved corrosion current in a cm for an unprotected surface after indicated times in salt solution ( a ) following a scratch on the surface seen in the optical micrograph ( b ) . bottom right : time and space dependent corrosion current for a surface protected by an inhibitor containing layer ( a ) following a scratch optically visualized ( b ) top : scheme describing immunological response under study . a capsule containing the signal peptide siinfekl is brought into a mammalian cell ( vero - cells ) and opened there by ir - light ( 13 ) . the released peptide is bound to the receptor mhc class i proteins ( 4 ) forming the complex , and is finally transported to the cell surface ( 5 ) . bottom : confocal fluorescence micrograph showing the cytosol ( green ) , the nucleus ( dark ellipse ) and a capsule ( red dot ) in the above example we have made use of one of the many present developments of so - called smart materials , i.e. materials that respond to the environment . these are the base elements of more sophisticated devices that , analogous to many regulating and regulated systems are connected as a positive or negative feedback . feedbacks are typically used in nature or technology to maintain a certain concentration , potential or mechanical force on a desired level and uses are maximum amplification for a triode , fast response for a muscle or delivery of stored chemical energy on demand . here the prime questions will not concern molecular mechanisms but the interplay and coupling of different responsive elements . i expect that another important area in the future will be the remote control of processes via external fields , electromagnetical , optical , acoustical or thermal ones . for demonstration , i selected an example of own work towards biosciences . the base elements here are :
polyelectrolyte multilayer capsules , which are known to be at high temperature very soft and permeable also for macromolecules , are glassy and virtually impermeable at low temperature . the transition between high and low temperature can be described like a glass transition , and the corresponding temperature may be tuned via ph , salt and type of polymer between room temperature and 90 c.metallic inorganic nanoparticles can be incorporated into the multilayers . via aggregation , preparation of rods or core / shell geometry they can be made to strongly absorb near ir - light [ 24 , 25 ] . this light is then converted into heat and one can show that with a low power ir diode one can increase the temperature of the particle by some 10 k whereas the temperature may be kept below 35 c some 10 nm apart . therefore one can create locally hot spots with permeability for large molecules controlled spatially and temporally via the ir laser diode.by consecutively heating and shrinking of the capsules in a solution of a signal peptide the latter can be encapsulated and these capsules can be brought into a cell by electroporation . this method can be used for virtually any type of cells ( even those which do nt exhibit phagocytosis ) , although other cells like macrophages or various cancer cells would incorporate these capsules spontaneously .since the capsules are not biodegradable one can wait for some hours till the cells have recovered from the harsh electroporation treatment . then one may select a specific capsule and location and open it by ir light , the process we call optoporation .intracellular delivery and release can be used for investigation of a receptor - mediated antigen presentation a process of fundamental importance in immunology . the idea of these experiments consists in bringing a microcapsule filled with peptides into a mammalian cell . then one can follow the binding of the peptide to a receptor , trace its intracellular transport , and eventually use the corresponding antibodies to investigate the surface presentation . approaches typically used for assessing this and , it is fair to say , other biological processes are rather descriptive , so further developments are expected in using math for quantification . polyelectrolyte multilayer capsules , which are known to be at high temperature very soft and permeable also for macromolecules , are glassy and virtually impermeable at low temperature . the transition between high and low temperature can be described like a glass transition , and the corresponding temperature may be tuned via ph , salt and type of polymer between room temperature and 90 c . preparation of rods or core / shell geometry they can be made to strongly absorb near ir - light [ 24 , 25 ] . this light is then converted into heat and one can show that with a low power ir diode one can increase the temperature of the particle by some 10 k whereas the temperature may be kept below 35 c some 10 nm apart . therefore one can create locally hot spots with permeability for large molecules controlled spatially and temporally via the ir laser diode . by consecutively heating and shrinking of the capsules in a solution of a signal peptide the latter can be encapsulated and these capsules can be brought into a cell by electroporation . this method can be used for virtually any type of cells ( even those which do nt exhibit phagocytosis ) , although other cells like macrophages or various cancer cells would incorporate these capsules spontaneously . since the capsules are not biodegradable one can wait for some hours till the cells have recovered from the harsh electroporation treatment . then one may select a specific capsule and location and open it by ir light , the process we call optoporation . intracellular delivery and release can be used for investigation of a receptor - mediated antigen presentation a process of fundamental importance in immunology . the idea of these experiments consists in bringing a microcapsule filled with peptides into a mammalian cell . then one can follow the binding of the peptide to a receptor , trace its intracellular transport , and eventually use the corresponding antibodies to investigate the surface presentation . approaches typically used for assessing this and , it is fair to say , other biological processes are rather descriptive , so further developments are expected in using math for quantification . figure 7 ( top ) presents a model of the process and the expected response , while fig . 7 ( bottom ) shows that the encapsulated peptide ( red ) can be brought near the cell nucleus ( dark ellipse ) . according to our model , the released signal peptide should be transferred via several compartments , bind to a receptor and form the complex which should be transported to the cell surface , fig . 7 ( top ) [ 32 , 33 ] . a fine detail of this experiment is the surface binding of the antibody which is specific to the complex but which is added from outside of the cell . the binding manifests visibility of the cell under study by t - cells the hall - mark of the immune system response . the question now arises if this model is correct and at which time scales the processes occur . to answer the above question fig . 8 shows time dependent fluorescence micrographs on the distribution of the peptide ( sinfekl - tamra ) and of the receptor mhc class i. measuring the intensity at the center of the cell and at the edge one can thus quantify the transport of the receptor to the surface ( right in fig . 8) , and via different labelling one this confirms that the suggested model is correct and that the corresponding processes last on the order of hours . 8left : fluorescence micrograph of the distribution of a green labelled receptor ( top row ) as a function of time ( from left 0 , 10 , 20 h ) and of the signal peptide ( red labelled , bottom row ) . to quantify the increasing receptor concentration at the cell surface the intensities at the edge are related to those at the center ( right in fig . the scale bar corresponds to 50 m left : fluorescence micrograph of the distribution of a green labelled receptor ( top row ) as a function of time ( from left 0 , 10 , 20 h ) and of the signal peptide ( red labelled , bottom row ) . to quantify the increasing receptor concentration at the cell surface the intensities at the edge are related to those at the center ( right in fig . the scale bar corresponds to 50 m in this example as well as in the previous one the task is not to answer fundamentally new questions although this is possible too , but to look into the interplay of multiple components , the problems coming from disciplines like materials science , medicine and biology . in this respect colloid and interface science may become a helper science which i do not mean negative since this help will be most important and can spread into many disciplines . in this brief contribution i intended to point into three different areas where i believe colloid and interface science to develop in the future . i have selected examples from my own environment and apologize to those colleagues whom i did not cite nor mention their directions . the field is very broad because it is not confined to any type of material and building up of hierarchical structures and functions is a challenge depending also on the types of material . among these materials , supramolecular systems are especially promising because the interplay of their weak interactions enables a variety of hierarchical structures and functions . there is also a trend to answer more biological questions , and one should be aware that there is no qualitative difference between synthetic and biological molecules . on the other hand biological techniques are now at hand to synthesize well - defined and interesting molecules which may become optimum models for our science , e.g. carbohydrates with most defined structures as recognition elements and as hydrogels . therefore our science may not only help other disciplines but these may be also useful for us . in any case i am optimistic that colloid science has a bright future on one hand as helper science on the other hand it provides still many challenging fundamental questions . | this article deals with topics where i expect special future challenges , exemplifying these by experiments out of my own department .
one area where i expect large progress also in view of many technical developments in the past concerns the understanding of the structure of fluid interfaces at the atomic level .
it is shown by non - linear optical spectroscopies that the free water surface is ice - like and can be liquefied by ion adsorption .
x - ray fluorescence from the interface demonstrates that ion binding is very specific which can not be explained by existing theories .
a second major area are nonequilibrium features , and one of the old and new ones here is nucleation and growth .
this presentation concentrates on effects produced by ultrasound , a well - defined trigger of gas bubble formation .
it exhibits high potential for chemistry at extreme conditions but with a reactor at normal conditions .
it has special importance for treatment of surfaces that can be also manipulated via controlled surface energies .
a third area will concern complex and smart systems with multiple functions in materials and biosciences .
as next generation , i anticipate those with feedback control , and examples on this are self - repairing coatings . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
sleep disorders have been linked to a number of generalized health and behavioral disorders , including reduced efficiency while operating a motor vehicle . in recent years , a number of studies have shown consistent linkages between lack of sleep , circadian rhythm disorders ( crsds ) , and fatigue , on the one hand , and psychosocial problems , behavioral disorders , and motor vehicle accidents on the other . furthermore , reduced or inadequate sleep is per se considered as a risk factor for several chronic disorders , including hypertension , obesity , type ii diabetes , coronary disorders , cancer , and premature death . a number of specific health and sleep problems have now been shown to have adverse consequences during waking hours . these problems include : ( a ) sleep deprivation or chronic sleep restriction ; ( b ) excessive daytime somnolence ; ( c ) tiredness and/or fatigue;[1315 ] ( d ) high body mass index ( bmi ) ; ( e ) obstructive sleep apnea ( osa ) associated with alcohol consumption ; and f ) other sleep disorders . globally , thousands of accidents occur due to lack of sleep , tiredness , and fatigue . an awareness of this linkage has increasingly prompted public health concerns regarding the possible role of inadequate sleep in road accidents and fatalities . these concerns have in turn resulted in recommendations for specific preventive steps and public education . in several countries , various contributors to traffic accidents have been discussed and considered closely . in 2004 and 2010 , the un general assembly and world health organization ( who ) reviewed the costs of traffic accidents , and unanimously approved a policy statement urging that in the years 2011 to 2020 increased attention be given to the issue of road safety , with the aim of halting or reversing the trend of increasing accidents and deaths worldwide . member states were invited to perform activities in the areas of road safety , infrastructure , vehicle safety , road users behavior , reduction of accidents , traffic education and clinical care post - crash . the recommended activities were to conform to the following five target areas of concern : 1 . road safety management ; 2 . the purpose of these efforts was to change public behavior concerning road safety and to influence the attitudes of government policy makers . more specifically , these activities aimed to increase local government enforcement of road laws , to involve public health sectors , to increase awareness of vehicle manufacturers and to educate local communities . studies have shown that a large proportion of traffic accidents around the world are related to inadequate or disordered sleep , with its resulting decrease in driver alertness being associated with serious injuries and deaths . in view of the direct implications of these associations for public health and safety , the present review sought to examine them more closely . the aim of this review was hopefully to promote greater understanding of driver sleepiness and to suggest possible strategies for dealing with the problem . the seriousness of traffic accidents for public health and safety has been pointed out by a number of surveys and governmental statistics . these have shown that a large number of injuries and deaths have been caused by automobile accidents . in a worldwide survey , who tallied the road traffic injury fatality rates ( per 10.000 population ) of major global regions : south - east asia region ( 16,6 ) ; african region ( 32,2 ) ; eastern mediterranean region ( 32,2 ) ; region of the americas ( 15,8 ) ; european region ( 13,4 ) and western pacific region ( 15,6 ) . india and china have the highest traffic accident rates in the world : 105,725 and 89 , 455 people died in 2006 , respectively . in 2008 , 39,000 people in the european union lost their lives in traffic related accidents ; the european countries with the highest rates of traffic fatalities were mostly eastern countries , namely , lithuania ( 14.8/100,000 inhabitants ) , poland ( 14.3/100,000 inhabitants ) and romania ( 14.2/100,000 ) . in 2008 , out of all deaths in argentina , 3,988 were found to be due to traffic accidents . in the us , 37,261 deaths were the result of car accidents . in a study by seaht et al . traffic accidents in tehran accounted for 17.3% of all accidents and mortality was 26.6 per 1000 people per year . in brazil , there were 158,893 traffic accidents in 2009 , with 93,851 injuries and 7,376 deaths . the brazilian national health system ( sistema nico de sade - sus ) found that , out of nine million hospital admissions , 8.1% were due to external causes , and of these external causes , 15% were due to motor vehicle accidents . several studies have underscored the need for urgency in developing methods to prevent errors associated with traffic accidents and for designing practical tests of driver fatigue , which is the root cause of these accidents . various authors have emphasized the vital importance of directing the attention of society and governments worldwide to the issue of sleepy driving ( falling asleep while driving ) and the threat it represents to public safety . it has been concluded that the need for adequate legislation in this regard is absolutely essential.[2931 ] fatigue as a result of sleep disorders , excessive workload and lack of physical and mental rest , are known to be major contributors to motor vehicle accidents . it has been estimated that in the usa 56,000 accidents a year are related to inadequate sleep . in the uk , 20% of highway accidents and up to one quarter of fatal and serious accidents are known to have occurred because of driver fatigue . in australia , it has been shown that driver fatigue is responsible for 17% of all accidents , 30% of which resulted in deaths . in 2010 , 41% of a sample of u.s . drivers who responded to a telephone survey admitted to having fallen asleep or nodded off at the wheel . in general , fatigue is reported by brazilian drivers to be the cause of approximately 20% of the accidents and over 30% of the 24,000 deaths that occur annually on brazilian highways . in 2008 , the brazilian federal highway police reported that nearly 2,400 accidents had been caused by sleep problems . souza et al . concluded that brazilian truck drivers in mato grosso do sul had increased alcohol consumption , bad sleeping habits and sleep restriction , excessive driving duration and poor quality of life ; these behavioural factors were reflected in the poor scores of epworth sleepiness scale ( ess ) and the pittsburgh sleep quality index ( psqi ) scales . silva - junior et al . interviewed brazilian truck drivers and found that 18.3% stated that they snored , 48.3% consumed alcohol while driving , and that 35% used stimulants , further , the investigations found that and that these factors were involved in 34% of the reported accidents . vakulin et al . surveyed 38 untreated individuals with osa and found that , compared to a control group , the osa respondents were more likely to have had at least one accident resulting from falling asleep at the wheel if they additionally experienced in combination with sleep restriction ( or = 4.0 [ 1.8 - 8.8 ] ) or had consumed alcohol ( or = 2.3 [ 1.0 - 5.1 ] ) . dawson et al . compared the effects of blood alcohol concentration with sleep deprivation and found that 17 - 19 h of sleep deprivation resulted in task performance decrements that were equivalent to the effects of a 0.05% blood alcohol concentration , while further increases in sleep deprivation ( 20 - 25 h of wakefulness ) were as damaging to driving performance as a blood alcohol concentration of 0.10% . carried out telephone interviews with 4,774 french drivers and found that 11.8% of the sample had ess scores of 11 , 28.6% reported experiencing sleepiness at the wheel severe enough to require stopping , feeling sleepy during night - time ( 46.8% ) and daytime of driving ( 39.4% ) , having a near - miss accident during the previous year ( 10.7% ) ( of which 46% of the incidents were reportedly sleep - related ) , and of having a driving accident ( 5.8% ) ( of which 5.2% of were sleep related ) . the authors also found that among the factors linked to motor vehicle accidents or near - miss accidents , the ones having the strongest associations were male gender ( 1.22 - 1.87 , p < 0.001 ) , being a younger driver ( 1.41 - 2.44 , p < 0.001 ) , frequently reporting feeling sleepy ( or 1.67 , 1.29 - 2.15 , p < 0.001 ) , having a sensitivity to caffeine , experiencing episodes of anxiety - depression ( or 1.82 , 1.27 - 2.62 , p < 0.001 ) and having at least one episode of severe sleepiness at the wheel in the previous year ( 5.20 - 8.12 , p < 0.001 ) . an elevated risk of having a motor vehicle accident were being unmarried ( 0.99 - 1.96 , p < 0.05 ) , being in the age range of 18 to 30 ( 1.51 - 3.00 , p < 0.001 ) , being a professional driver ( or 1.52 , 1.08 - 2.13 , p < 0.05 ) , having a sensitivity to caffeine ( 1.11 - 1.85 , p < 0.01 ) and at least one episode of severe sleepiness at the wheel in the previous year ( 1.57 - 2.64 , p < 0.001 ) . found that values of apnea hypopnea index ( ahi 40 ) and ess ( ess 11 and ess 16 ) of 616 japanese drivers were correlated with an increased risk of dozing off at the wheel , as well as a higher risk of being involved in motor vehicle accidents . studies have shown that , compared to normal individuals , individuals with osa have a higher risk of falling asleep while driving and are three times more likely to cause accidents . and george reported that , among sleep disorders , osa represented the highest risk factor for sleepiness and accidents . the partial or total obstruction of the upper airway that is associated with severe oxyhemoglobin desaturation is a cause of hypoxemia , hypercapnia , sleep fragmentation , es , and cognitive impairments . among the impairments caused by osa are those which involve frontal lobe executive functions , essential for decision making while driving . it has been recently demonstrated that these critical functions do not improve following cpap treatment . in one study it was found that , compared to a group without osa ( ahi = 0 to 5 ) , patients with osa had a greater relative risk of having an accident ( 1.6 to 2.9 ) , and a greater rate of having an accident in which there was a personal injury ( 3.0 to 4.8 ) . it was found further that the increase in the risks and rates of accidents was proportional to the seriousness of sleep apnea . vakulin et al . showed that osa patients had performance impairments in a driving simulator when compared with the control group . the authors also reported that after three months of cpap treatment , the osa group had improved their driving performance . a systematic review and meta - analysis of the relationships among osa , cpap and accidents found that cpap use reduced the accident risk of drivers with moderate to severe osa ( rr = 0.278 , 95% ci : 0:22 to 0:35 , p < 0.001 ) , and , additionally , decreased self reported sleepiness , one of the symptoms of osa . interviewed 677 drivers and found that 12% reported having osa symptoms and having fallen asleep at the wheel , and that among these 7% were involved in accidents . tippin et al . compared normal drivers with those who had osa and demonstrated that the osa group had reduced peripheral vision ( 80.7 14.8% vs. 86.7 8.8% , p = 0.03 ) and reported feeling greater sleepiness at the wheel ( stanford sleep scale = 4.2 1.2 vs. 3.6 1.2 , p = 0.03 ) . the authors also showed that an association existed between increased sleepiness and decreased heart rate in osa patients ( r = -0.49 , p = 0.01 ) . philip et al . surveyed 35,004 drivers , and found that 5.2% had osa , 2.3% had restless legs syndrome , 9.3% insomnia , 0.1% narcolepsy and hypersomnia , and 4.4% had multiple disorders . of these drivers , 7.2% reported having had at least one accident in the previous year , 5.8% of which were related to sleep . these results are reflected in related findings that the highest risk of having a motor vehicle accident was associated with narcolepsy or hypersomnia [ or = 8.78 ( 1.97 - 39.06 ) ] , osa [ or = 2.09 ( 1.06 - 4.13 ) ] , insomnia [ ( or = 1.78 ( 1.01 - 3.14 ) ] and others multiple sleep disorders [ or = 1.46 1.20 - 1.78 ) ] . accidents caused by sleepiness occurred primarily on highways ( 77.6% ) and on long trips ( 63.8% ) and more frequently at night ( 40.9% ) than during the day ( 29.4% ) . found an association between sleep disorders ( narcolepsy , insomnia , and osa ) and accidents caused by sleepiness , as well as an association between sleepiness and near miss accidents . concluded that untreated narcolepsy can impair driving performance and increase the risk of traffic accidents . evaluated 750 drivers and found that 14.5% reported sleepiness while driving , and , further , that 2% of the respondents had been involved in accidents caused by sleepy driving . a study conducted by prez - chada et al . of 770 argentinian truck drivers found that 80% were overweight , 71.9% snored ( of those , 4.7% reported apnea ) , 37.8% were hypertensive , 86.9% had insomnia , 13.9% had ess scores above 10 , and 43.8% became sleepy while driving . those suffering from apnea had higher scores on the ess , were more likely to be overweight and a higher prevalence of hypertension . in this population , snoring , ess scores > 10 , and driving for long hours were associated with sleepiness at the wheel , as well as an increased likelihood of having accidents or near misses . out of the total 11% had already had at least one accident because of sleepiness while driving , 33% snored during sleep , 8% reported having respiratory disorders , and more than 50% were obese . de pinho et al . found that out of 300 truck drivers evaluated , 46.3% experienced poor sleep quality , 46% had excessive sleepiness , and 40% were chronically sleep - deprived . snoring was present in 18.3% of the drivers . excessive sleepiness ( es ) was the cause of the majority of accidents reported by the drivers ( 26.5% ) while the reported frequency of es was even greater among drivers who had a history of accidents . a number of studies of shift workers , especially professional drivers , have documented the occurrence of changes in sleep architecture over time . the associated symptoms , including poor quality of sleep , fragmentation due to osa , and sleep deprivation and/or restriction , were thought to explain the es , fatigue , health deficits , possible driving errors , and serious accidents . most european countries now have specific traffic laws for sleep disorders and diseases . several u.s . states , as well as canada and australia , have established laws that prohibit drivers with osa or narcolepsy from driving a car and/or obtaining a drivers license unless their condition is medically controlled . in 2007 , 128,467 traffic accidents were recorded in brazil , with 42,508 being caused by inattention and 3,367 being caused by sleepy driving . in 2008 there were 60,370 confirmed deaths due to accidents , with 36,666 deaths resulting from traffic accidents . in brazil , due to the high rate of traffic accidents caused by sleepiness , a resolution was adopted by departamento nacional de trnsito ( denatran ) in 2008 ( resolution contran / denatran 267/2008 ) to reduce the number of accidents caused by sleepiness , fatigue , sleep respiratory disorders and changes in biological rhythms . some studies have shown that individuals with insomnia and those who were taking various sleep medications had an increased risk of accidents due to fatigue symptoms , reduced alertness and sleepiness at the wheel.[6264 ] over the past 30 years , on - road driving research conducted in the netherlands examined the effects on driving of various medicinal drugs . they were instructed to drive with a steady lateral position and constant speed ( 95 km / h ) . the standard deviation of lateral position ( sdlp ) , i.e. the weaving of the car , was the primary outcome measure of the test . a study of unmedicated healthy volunteers concluded that prolonged nighttime highway driving is associated with increased driver sleepiness , and that this was further associated with progressively increasing sdlp values . after 2 to 3 h of driving , performance impairments are comparable to those seen in drivers who have consumed alcohol and have a blood alcohol concentration ( bac ) or 0.05% , i.e. the legal limit for driving in many countries . as a result of these findings it has been shown effective if during these breaks drivers consume caffeinated beverages such as coffee or energy drinks in order to increase their alertness . the results of these studies showed that benzodiazepine hypnotics and zopiclone significantly impair driving performance , whereas zolpidem and zaleplon seem relatively safe.[6971 ] ramelteon , a melatonin receptor agonist , also significantly impaired next morning driving performance . the findings of these studies are in line with epidemiological evidence showing increased accident risks among those who use benzodiazepine hypnotics and zopiclone and are also generally consistent with other findings cited in this paper showing that a number of sleep disorders can reduce daytime alertness , and thus have adverse effects on driving performance . the various types of evaluations and their respective instruments that are commonly used to study sleep disorders , sleepiness , and wakefulness - rest activity are listed below [ table 1 ] :
optalert ( system of infrared reflectance oculography ) : this is a new method for monitoring eye and eyelid movements by infrared reflectance oculography . the method uses transducers attached to a glass frame to measure drivers drowsiness continuously on a new scale ( johns drowsiness scale - jds ) during driving task.the pittsburgh sleep quality index ( psqi ) , includes issues related to sleepiness during daily activities and daily life , sleep , and sleep disorders;the multiple sleep latency test ( mlst),[7779 ] assesses the propensity to sleep in a comfortable position , a factor that is commonly used in the diagnosis of narcolepsy;the oxford sleep resistance test ( osler ) , determines the onset of sleep;the maintenance of wakefulness test ( mwt ) , assesses the individual 's ability to stay awake;pupillography , which evaluates the diameter and variability of the pupil and the relationship of these variables to subjective sleepiness complaints;actigraphy , assesses the activity - rest periods and circadian rhythm disorders of shift workers and may be used to infer hypersomnia and/or fatigue;polysomnography ( psg ) ( the gold standard for diagnosing osa ) is the most commonly used test to evaluate sleep and its disorders . it includes measures based on the electroencephalogram ( eeg ) , mentonian and lower limb electromyography ( emg ) , electrooculogram ( eog ) , electrocardiogram ( ecg ) , pulse oximetry , oro - nasal airflow , respiratory effort measurements , blood gas , snoring , and body position . ( it has been noted however that while psg can contribute importantly to an overall assessment of sleep quality , it is not a specific instrument for assessing sleepiness).[8587 ] the clinical diagnosis of osa is made with protocols used by a physician who specializes in sleep disorders . optalert ( system of infrared reflectance oculography ) : this is a new method for monitoring eye and eyelid movements by infrared reflectance oculography . the method uses transducers attached to a glass frame to measure drivers drowsiness continuously on a new scale ( johns drowsiness scale - jds ) during driving task . the pittsburgh sleep quality index ( psqi ) , includes issues related to sleepiness during daily activities and daily life , sleep , and sleep disorders ; the multiple sleep latency test ( mlst),[7779 ] assesses the propensity to sleep in a comfortable position , a factor that is commonly used in the diagnosis of narcolepsy ; the oxford sleep resistance test ( osler ) , determines the onset of sleep ; the maintenance of wakefulness test ( mwt ) , assesses the individual 's ability to stay awake ; pupillography , which evaluates the diameter and variability of the pupil and the relationship of these variables to subjective sleepiness complaints ; actigraphy , assesses the activity - rest periods and circadian rhythm disorders of shift workers and may be used to infer hypersomnia and/or fatigue ; polysomnography ( psg ) ( the gold standard for diagnosing osa ) is the most commonly used test to evaluate sleep and its disorders . it includes measures based on the electroencephalogram ( eeg ) , mentonian and lower limb electromyography ( emg ) , electrooculogram ( eog ) , electrocardiogram ( ecg ) , pulse oximetry , oro - nasal airflow , respiratory effort measurements , blood gas , snoring , and body position . ( it has been noted however that while psg can contribute importantly to an overall assessment of sleep quality , it is not a specific instrument for assessing sleepiness).[8587 ] the clinical diagnosis of osa is made with protocols used by a physician who specializes in sleep disorders . various methods and instruments for evaluating drowsiness and daytime sleepiness these survey instruments and physiological tests are very important for accurately diagnosing sleep disorders and their symptoms so that driver errors and accidents , which may affect public health , can be avoided . rodenstein summarized several studies dealing with the financial consequences of a - related accidents and concluded that the resulting cost to the public was $ 16 billion per year . it has been projected that cpap treatment could reduce these costs to $ 11 billion per year . further , it has been calculated that 567,000 crashes and 980 traffic deaths could be prevented with osa treatment by cpap . these projections underscore the urgency of the need to develop policies for preventing accidents and promoting the health of drivers who are affected by sleep disorders or other conditions that restrict sleep . the preventive or therapeutic interventions should be emphasized to minimize the deleterious effects of drowsy driving and to educate drivers about the risks of economic loss , poor quality of life and death . figure 1 summarizes of the causes and preventing strategies of sleepiness during driving . due to the high prevalence of osa and sleepiness among drivers , some studies have recommended that educational activities related to drowsy driving and how osa may be an important cause of traffic accidents be made a requirement for the licensure of professional drivers . a summary of the causes and preventing strategies of sleepiness during driving the literature highlights the importance of restorative sleep and the need for drivers to examine the external environment , to recognize the presence of fatigue symptoms , and to determine when to stop to sleep . a number of prevention strategies have been proposed . awareness programs based on educational lectures the aim of these is to promote behavioral change , sleep hygiene strategies , healthy nutritional habits , exercise at certain times , changes in behavior , drugs and alcohol abuse , time of driving and signs of fatigue , stop driving to doze and scheduled naps . some therapeutic interventions include phototherapy to promote alertness and vigilance , with different intensities for each individual , substances or drugs to promote either sleepiness or alertness ( i.e. , caffeine , modafinil , melatonin and others ) , as well as specific sleep disorders treatment . several studies report that naps , phototherapy and caffeine can be helpful for increasing awareness , alertness and memory consolidation . phototherapy using bright light is recommended for night shift workers with insomnia , excessive sleepiness and fatigue . mets et al . demonstrated that 80 mg of caffeine , comparable to a regular cup of coffee or a 250 ml can of red bull energy drink , reduces sleepiness and improves driver performance . similarly , reyner and horne found that 200 mg of caffeine reduced subjective sleepiness in the morning as well decreased accidents . reported that japanese non - professional drivers used naps and coffee intake as strategies for preventing sleepiness at the wheel and possible accidents . lic and summala reported that the most common strategy used by argentinian drivers for avoiding sleepiness was to take a nap for 10 min ( 66.2% ) followed by ingestion of yerba mate infusion with caffeine ( 53.1% ) . the national sleep foundation has recommended that for maintaining alertness and optimal driving performance that sleep be adequate to meet biological needs , should not be fragmented , that the sleep cycle should be synchronized , and that the sleeping environment should be free of disturbances.[104107 ] another strategy reported in the scientific literature is physical exercise in the evening or during the workday to increase the alertness and vigilance of drivers who do shift work or who spend long periods of time behind the wheel . exercise has been shown to increase alertness , reduce sleepiness and accidents by increasing body temperature , as well as to promote restorative sleep . the quality of sleep that an individual experiences , not only its quantity , is an important factor for enhancing ambient , physical and social functioning . sleep that is refreshing , restorative sleep , is important for promoting homeostasis and thermoregulation , and is basic in memory consolidation and cognition , energy restoration and the cerebral energy metabolism . it is known that many individuals experience and adequate total sleep time ( 6 to 8 h ) but do not have enough quality sleep due to repeated awakenings , and/or sleep disorders.[108111 ] abe et al . reported that short duration ( < 6 h ) of nocturnal sleep is associated with an increased risk of rear - end collisions and single - car accidents . it is known that among the numerous types of sleep disorders , excessive sleepiness is more prevalent among drivers with osa . thus , cpap has been recommended as a gold standard therapeutic strategy for remediating osa . yamamoto et al . , sassani et al . , barbe et al . and komada et al . reported that osa treatment with cpap in particular reduces the number and risk of accidents and deaths , as well as improving mood , and reducing excessive sleepiness . fatigue as a result of sleep disorders , excessive workload and lack of physical and mental rest , are known to be major contributors to motor vehicle accidents . it has been estimated that in the usa 56,000 accidents a year are related to inadequate sleep . in the uk , 20% of highway accidents and up to one quarter of fatal and serious accidents are known to have occurred because of driver fatigue . in australia , it has been shown that driver fatigue is responsible for 17% of all accidents , 30% of which resulted in deaths . in 2010 , 41% of a sample of u.s . drivers who responded to a telephone survey admitted to having fallen asleep or nodded off at the wheel . in general , fatigue is reported by brazilian drivers to be the cause of approximately 20% of the accidents and over 30% of the 24,000 deaths that occur annually on brazilian highways . in 2008 , the brazilian federal highway police reported that nearly 2,400 accidents had been caused by sleep problems . souza et al . concluded that brazilian truck drivers in mato grosso do sul had increased alcohol consumption , bad sleeping habits and sleep restriction , excessive driving duration and poor quality of life ; these behavioural factors were reflected in the poor scores of epworth sleepiness scale ( ess ) and the pittsburgh sleep quality index ( psqi ) scales . silva - junior et al . interviewed brazilian truck drivers and found that 18.3% stated that they snored , 48.3% consumed alcohol while driving , and that 35% used stimulants , further , the investigations found that and that these factors were involved in 34% of the reported accidents . vakulin et al . surveyed 38 untreated individuals with osa and found that , compared to a control group , the osa respondents were more likely to have had at least one accident resulting from falling asleep at the wheel if they additionally experienced in combination with sleep restriction ( or = 4.0 [ 1.8 - 8.8 ] ) or had consumed alcohol ( or = 2.3 [ 1.0 - 5.1 ] ) . dawson et al . compared the effects of blood alcohol concentration with sleep deprivation and found that 17 - 19 h of sleep deprivation resulted in task performance decrements that were equivalent to the effects of a 0.05% blood alcohol concentration , while further increases in sleep deprivation ( 20 - 25 h of wakefulness ) were as damaging to driving performance as a blood alcohol concentration of 0.10% . carried out telephone interviews with 4,774 french drivers and found that 11.8% of the sample had ess scores of 11 , 28.6% reported experiencing sleepiness at the wheel severe enough to require stopping , feeling sleepy during night - time ( 46.8% ) and daytime of driving ( 39.4% ) , having a near - miss accident during the previous year ( 10.7% ) ( of which 46% of the incidents were reportedly sleep - related ) , and of having a driving accident ( 5.8% ) ( of which 5.2% of were sleep related ) . the authors also found that among the factors linked to motor vehicle accidents or near - miss accidents , the ones having the strongest associations were male gender ( 1.22 - 1.87 , p < 0.001 ) , being a younger driver ( 1.41 - 2.44 , p < 0.001 ) , frequently reporting feeling sleepy ( or 1.67 , 1.29 - 2.15 , p < 0.001 ) , having a sensitivity to caffeine , experiencing episodes of anxiety - depression ( or 1.82 , 1.27 - 2.62 , p < 0.001 ) and having at least one episode of severe sleepiness at the wheel in the previous year ( 5.20 - 8.12 , p < 0.001 ) . other factors linked to an elevated risk of having a motor vehicle accident were being unmarried ( 0.99 - 1.96 , p < 0.05 ) , being in the age range of 18 to 30 ( 1.51 - 3.00 , p < 0.001 ) , being a professional driver ( or 1.52 , 1.08 - 2.13 , p < 0.05 ) , having a sensitivity to caffeine ( 1.11 - 1.85 , p < 0.01 ) and at least one episode of severe sleepiness at the wheel in the previous year ( 1.57 - 2.64 , p < 0.001 ) . found that values of apnea hypopnea index ( ahi 40 ) and ess ( ess 11 and ess 16 ) of 616 japanese drivers were correlated with an increased risk of dozing off at the wheel , as well as a higher risk of being involved in motor vehicle accidents . studies have shown that , compared to normal individuals , individuals with osa have a higher risk of falling asleep while driving and are three times more likely to cause accidents . and george reported that , among sleep disorders , osa represented the highest risk factor for sleepiness and accidents . the partial or total obstruction of the upper airway that is associated with severe oxyhemoglobin desaturation is a cause of hypoxemia , hypercapnia , sleep fragmentation , es , and cognitive impairments . among the impairments caused by osa are those which involve frontal lobe executive functions , essential for decision making while driving . it has been recently demonstrated that these critical functions do not improve following cpap treatment . in one study it was found that , compared to a group without osa ( ahi = 0 to 5 ) , patients with osa had a greater relative risk of having an accident ( 1.6 to 2.9 ) , and a greater rate of having an accident in which there was a personal injury ( 3.0 to 4.8 ) . it was found further that the increase in the risks and rates of accidents was proportional to the seriousness of sleep apnea . vakulin et al . showed that osa patients had performance impairments in a driving simulator when compared with the control group . the authors also reported that after three months of cpap treatment , the osa group had improved their driving performance . a systematic review and meta - analysis of the relationships among osa , cpap and accidents found that cpap use reduced the accident risk of drivers with moderate to severe osa ( rr = 0.278 , 95% ci : 0:22 to 0:35 , p < 0.001 ) , and , additionally , decreased self reported sleepiness , one of the symptoms of osa . interviewed 677 drivers and found that 12% reported having osa symptoms and having fallen asleep at the wheel , and that among these 7% were involved in accidents . tippin et al . compared normal drivers with those who had osa and demonstrated that the osa group had reduced peripheral vision ( 80.7 14.8% vs. 86.7 8.8% , p = 0.03 ) and reported feeling greater sleepiness at the wheel ( stanford sleep scale = 4.2 1.2 vs. 3.6 1.2 , p = 0.03 ) . the authors also showed that an association existed between increased sleepiness and decreased heart rate in osa patients ( r = -0.49 , p = 0.01 ) . philip et al . surveyed 35,004 drivers , and found that 5.2% had osa , 2.3% had restless legs syndrome , 9.3% insomnia , 0.1% narcolepsy and hypersomnia , and 4.4% had multiple disorders . of these drivers , 7.2% reported having had at least one accident in the previous year , 5.8% of which were related to sleep . these results are reflected in related findings that the highest risk of having a motor vehicle accident was associated with narcolepsy or hypersomnia [ or = 8.78 ( 1.97 - 39.06 ) ] , osa [ or = 2.09 ( 1.06 - 4.13 ) ] , insomnia [ ( or = 1.78 ( 1.01 - 3.14 ) ] and others multiple sleep disorders [ or = 1.46 1.20 - 1.78 ) ] . accidents caused by sleepiness occurred primarily on highways ( 77.6% ) and on long trips ( 63.8% ) and more frequently at night ( 40.9% ) than during the day ( 29.4% ) . found an association between sleep disorders ( narcolepsy , insomnia , and osa ) and accidents caused by sleepiness , as well as an association between sleepiness and near miss accidents . concluded that untreated narcolepsy can impair driving performance and increase the risk of traffic accidents . evaluated 750 drivers and found that 14.5% reported sleepiness while driving , and , further , that 2% of the respondents had been involved in accidents caused by sleepy driving . a study conducted by prez - chada et al . of 770 argentinian truck drivers found that 80% were overweight , 71.9% snored ( of those , 4.7% reported apnea ) , 37.8% were hypertensive , 86.9% had insomnia , 13.9% had ess scores above 10 , and 43.8% became sleepy while driving . those suffering from apnea had higher scores on the ess , were more likely to be overweight and a higher prevalence of hypertension . in this population , snoring , ess scores > 10 , and driving for long hours were associated with sleepiness at the wheel , as well as an increased likelihood of having accidents or near misses . out of the total 11% had already had at least one accident because of sleepiness while driving , 33% snored during sleep , 8% reported having respiratory disorders , and more than 50% were obese . de pinho et al . found that out of 300 truck drivers evaluated , 46.3% experienced poor sleep quality , 46% had excessive sleepiness , and 40% were chronically sleep - deprived . snoring was present in 18.3% of the drivers . excessive sleepiness ( es ) was the cause of the majority of accidents reported by the drivers ( 26.5% ) while the reported frequency of es was even greater among drivers who had a history of accidents . a number of studies of shift workers , especially professional drivers , have documented the occurrence of changes in sleep architecture over time . the associated symptoms , including poor quality of sleep , fragmentation due to osa , and sleep deprivation and/or restriction , were thought to explain the es , fatigue , health deficits , possible driving errors , and serious accidents . most european countries now have specific traffic laws for sleep disorders and diseases . several u.s . states , as well as canada and australia , have established laws that prohibit drivers with osa or narcolepsy from driving a car and/or obtaining a drivers license unless their condition is medically controlled . in 2007 , 128,467 traffic accidents were recorded in brazil , with 42,508 being caused by inattention and 3,367 being caused by sleepy driving . in 2008 there were 60,370 confirmed deaths due to accidents , with 36,666 deaths resulting from traffic accidents . in brazil , due to the high rate of traffic accidents caused by sleepiness , a resolution was adopted by departamento nacional de trnsito ( denatran ) in 2008 ( resolution contran / denatran 267/2008 ) to reduce the number of accidents caused by sleepiness , fatigue , sleep respiratory disorders and changes in biological rhythms . some studies have shown that individuals with insomnia and those who were taking various sleep medications had an increased risk of accidents due to fatigue symptoms , reduced alertness and sleepiness at the wheel.[6264 ] over the past 30 years , on - road driving research conducted in the netherlands examined the effects on driving of various medicinal drugs . they were instructed to drive with a steady lateral position and constant speed ( 95 km / h ) . the standard deviation of lateral position ( sdlp ) , i.e. the weaving of the car , was the primary outcome measure of the test . a study of unmedicated healthy volunteers concluded that prolonged nighttime highway driving is associated with increased driver sleepiness , and that this was further associated with progressively increasing sdlp values . after 2 to 3 h of driving , performance impairments are comparable to those seen in drivers who have consumed alcohol and have a blood alcohol concentration ( bac ) or 0.05% , i.e. the legal limit for driving in many countries . as a result of these findings it has been shown effective if during these breaks drivers consume caffeinated beverages such as coffee or energy drinks in order to increase their alertness . the results of these studies showed that benzodiazepine hypnotics and zopiclone significantly impair driving performance , whereas zolpidem and zaleplon seem relatively safe.[6971 ] ramelteon , a melatonin receptor agonist , also significantly impaired next morning driving performance . the findings of these studies are in line with epidemiological evidence showing increased accident risks among those who use benzodiazepine hypnotics and zopiclone and are also generally consistent with other findings cited in this paper showing that a number of sleep disorders can reduce daytime alertness , and thus have adverse effects on driving performance . the various types of evaluations and their respective instruments that are commonly used to study sleep disorders , sleepiness , and wakefulness - rest activity are listed below [ table 1 ] :
optalert ( system of infrared reflectance oculography ) : this is a new method for monitoring eye and eyelid movements by infrared reflectance oculography . the method uses transducers attached to a glass frame to measure drivers drowsiness continuously on a new scale ( johns drowsiness scale - jds ) during driving task.the pittsburgh sleep quality index ( psqi ) , includes issues related to sleepiness during daily activities and daily life , sleep , and sleep disorders;the multiple sleep latency test ( mlst),[7779 ] assesses the propensity to sleep in a comfortable position , a factor that is commonly used in the diagnosis of narcolepsy;the oxford sleep resistance test ( osler ) , determines the onset of sleep;the maintenance of wakefulness test ( mwt ) , assesses the individual 's ability to stay awake;pupillography , which evaluates the diameter and variability of the pupil and the relationship of these variables to subjective sleepiness complaints;actigraphy , assesses the activity - rest periods and circadian rhythm disorders of shift workers and may be used to infer hypersomnia and/or fatigue;polysomnography ( psg ) ( the gold standard for diagnosing osa ) is the most commonly used test to evaluate sleep and its disorders . it includes measures based on the electroencephalogram ( eeg ) , mentonian and lower limb electromyography ( emg ) , electrooculogram ( eog ) , electrocardiogram ( ecg ) , pulse oximetry , oro - nasal airflow , respiratory effort measurements , blood gas , snoring , and body position . ( it has been noted however that while psg can contribute importantly to an overall assessment of sleep quality , it is not a specific instrument for assessing sleepiness).[8587 ] the clinical diagnosis of osa is made with protocols used by a physician who specializes in sleep disorders . optalert ( system of infrared reflectance oculography ) : this is a new method for monitoring eye and eyelid movements by infrared reflectance oculography . the method uses transducers attached to a glass frame to measure drivers drowsiness continuously on a new scale ( johns drowsiness scale - jds ) during driving task . the pittsburgh sleep quality index ( psqi ) , includes issues related to sleepiness during daily activities and daily life , sleep , and sleep disorders ; the multiple sleep latency test ( mlst),[7779 ] assesses the propensity to sleep in a comfortable position , a factor that is commonly used in the diagnosis of narcolepsy ; the oxford sleep resistance test ( osler ) , determines the onset of sleep ; the maintenance of wakefulness test ( mwt ) , assesses the individual 's ability to stay awake ; pupillography , which evaluates the diameter and variability of the pupil and the relationship of these variables to subjective sleepiness complaints ; actigraphy , assesses the activity - rest periods and circadian rhythm disorders of shift workers and may be used to infer hypersomnia and/or fatigue ; polysomnography ( psg ) ( the gold standard for diagnosing osa ) is the most commonly used test to evaluate sleep and its disorders . it includes measures based on the electroencephalogram ( eeg ) , mentonian and lower limb electromyography ( emg ) , electrooculogram ( eog ) , electrocardiogram ( ecg ) , pulse oximetry , oro - nasal airflow , respiratory effort measurements , blood gas , snoring , and body position . ( it has been noted however that while psg can contribute importantly to an overall assessment of sleep quality , it is not a specific instrument for assessing sleepiness).[8587 ] the clinical diagnosis of osa is made with protocols used by a physician who specializes in sleep disorders . various methods and instruments for evaluating drowsiness and daytime sleepiness these survey instruments and physiological tests are very important for accurately diagnosing sleep disorders and their symptoms so that driver errors and accidents , which may affect public health , can be avoided . rodenstein summarized several studies dealing with the financial consequences of a - related accidents and concluded that the resulting cost to the public was $ 16 billion per year . it has been projected that cpap treatment could reduce these costs to $ 11 billion per year . further , it has been calculated that 567,000 crashes and 980 traffic deaths could be prevented with osa treatment by cpap . these projections underscore the urgency of the need to develop policies for preventing accidents and promoting the health of drivers who are affected by sleep disorders or other conditions that restrict sleep . the preventive or therapeutic interventions should be emphasized to minimize the deleterious effects of drowsy driving and to educate drivers about the risks of economic loss , poor quality of life and death . figure 1 summarizes of the causes and preventing strategies of sleepiness during driving . due to the high prevalence of osa and sleepiness among drivers , some studies have recommended that educational activities related to drowsy driving and how osa may be an important cause of traffic accidents be made a requirement for the licensure of professional drivers . a summary of the causes and preventing strategies of sleepiness during driving the literature highlights the importance of restorative sleep and the need for drivers to examine the external environment , to recognize the presence of fatigue symptoms , and to determine when to stop to sleep . the aim of these is to promote behavioral change , sleep hygiene strategies , healthy nutritional habits , exercise at certain times , changes in behavior , drugs and alcohol abuse , time of driving and signs of fatigue , stop driving to doze and scheduled naps . some therapeutic interventions include phototherapy to promote alertness and vigilance , with different intensities for each individual , substances or drugs to promote either sleepiness or alertness ( i.e. , caffeine , modafinil , melatonin and others ) , as well as specific sleep disorders treatment . several studies report that naps , phototherapy and caffeine can be helpful for increasing awareness , alertness and memory consolidation . phototherapy using bright light is recommended for night shift workers with insomnia , excessive sleepiness and fatigue . mets et al . demonstrated that 80 mg of caffeine , comparable to a regular cup of coffee or a 250 ml can of red bull energy drink , reduces sleepiness and improves driver performance . similarly , reyner and horne found that 200 mg of caffeine reduced subjective sleepiness in the morning as well decreased accidents . reported that japanese non - professional drivers used naps and coffee intake as strategies for preventing sleepiness at the wheel and possible accidents . lic and summala reported that the most common strategy used by argentinian drivers for avoiding sleepiness was to take a nap for 10 min ( 66.2% ) followed by ingestion of yerba mate infusion with caffeine ( 53.1% ) . the national sleep foundation has recommended that for maintaining alertness and optimal driving performance that sleep be adequate to meet biological needs , should not be fragmented , that the sleep cycle should be synchronized , and that the sleeping environment should be free of disturbances.[104107 ] another strategy reported in the scientific literature is physical exercise in the evening or during the workday to increase the alertness and vigilance of drivers who do shift work or who spend long periods of time behind the wheel . exercise has been shown to increase alertness , reduce sleepiness and accidents by increasing body temperature , as well as to promote restorative sleep . the quality of sleep that an individual experiences , not only its quantity , is an important factor for enhancing ambient , physical and social functioning . sleep that is refreshing , restorative sleep , is important for promoting homeostasis and thermoregulation , and is basic in memory consolidation and cognition , energy restoration and the cerebral energy metabolism . it is known that many individuals experience and adequate total sleep time ( 6 to 8 h ) but do not have enough quality sleep due to repeated awakenings , and/or sleep disorders.[108111 ] abe et al . reported that short duration ( < 6 h ) of nocturnal sleep is associated with an increased risk of rear - end collisions and single - car accidents . it is known that among the numerous types of sleep disorders , excessive sleepiness is more prevalent among drivers with osa . thus , cpap has been recommended as a gold standard therapeutic strategy for remediating osa . reported that osa treatment with cpap in particular reduces the number and risk of accidents and deaths , as well as improving mood , and reducing excessive sleepiness . this review has cited studies showing that sleep disorders such as narcolepsy , insomnia , periodic leg movement disorder , osa , and a number of other common diseases are all associationed with excessive sleepiness , fatigue symptoms such as reduced driving skills , and cognitive deficits . these in turn have been linked to an increased risk of accidents and fatalities on the highway . although , pharmacological treatment for insomnia is meant to improve sleep and thereby reducing daytime sleepiness , driving studies show that many sleep drugs may actually contribute to daytime sleepiness and the increased risk of accidents . the evidence summarized in this paper supports the conclusion that excessive sleepiness is a serious public health concern that directly affects the safety of all who drive motor vehicles . this evidence further supports the recommendation that all disorders which produce excessive sleepiness should be investigated and monitored so that highway accidents and associated injuries and loss of lives can be reduced . | studies have shown that a large proportion of traffic accidents around the world are related to inadequate or disordered sleep .
recent surveys have linked driver fatigue to 16% to 20% of serious highway accidents in the uk , australia , and brazil .
fatigue as a result of sleep disorders ( especially obstructive sleep apnea ) , excessive workload and lack of physical and mental rest , have been shown to be major contributing factors in motor vehicle accidents .
a number of behavioral , physiological , and psychometric tests are being used increasingly to evaluate the impact of fatigue on driver performance .
these include the oculography , polysomnography , actigraphy , the maintenance of wakefulness test , and others .
various strategies have been proposed for preventing or reducing the impact of fatigue on motor vehicle accidents .
these have included : educational programs emphasizing the importance of restorative sleep and the need for drivers to recognize the presence of fatigue symptoms , and to determine when to stop to sleep ; the use of exercise to increase alertness and to promote restorative sleep ; the use of substances or drugs to promote sleep or alertness ( i.e. caffeine , modafinil , melatonin and others ) , as well as specific sleep disorders treatment ; the use of cpap therapy for reducing excessive sleepiness among drivers who have been diagnosed with obstructive sleep apnea .
the evidence cited in this review justifies the call for all efforts to be undertaken that may increase awareness of inadequate sleep as a cause of traffic accidents .
it is strongly recommended that , for the purpose of promoting highway safety and saving lives , all disorders that cause excessive sleepiness should be investigated and monitored . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hepatic encephalopathy ( he ) is a potentially reversible condition associated with neuropsychiatric symptoms and neuromuscular dysfunction of varying severity.1 he is caused by liver insufficiency , portosystemic shunting , or both.2 he comprises a spectrum of abnormalities spanning a range from minimal ( covert ) he ( eg , subtle alterations in cognitive function determined via neuropsychometric tests ) to overt he ( eg , evaluable clinical symptoms , such as generalized motor dysfunction with alterations in consciousness).2,3 additionally , as the condition progresses from minimal he to overt he , patients and caregivers may report personality changes , such as apathy , lack of inhibition , and irritability.2 sleep disturbances ( eg , reversal of the sleep wake cycle ) and changes in motor function ( eg , development of asterixis ) and consciousness may also be observed . he is a common complication of decompensated cirrhosis.3 up to 40% of patients with cirrhosis eventually develop overt he , and many patients experience repeated episodes ( ie , recurrence).2,4 the presence of overt he at the time of an initial diagnosis of cirrhosis has been reported in 10% to 14% of patients overall , in 16% to 21% of patients diagnosed with decompensated cirrhosis , and in 10% to 50% of patients with a transjugular intrahepatic portosystemic shunt.2 the prognosis after developing overt he is poor , with a 1-year survival rate as high as 40% to 50% and a 3-year survival rate of approximately 20%.5,6 in a study of us adults on the united network for organ sharing and organ procurement and transplantation network registry waitlist for liver transplantation , patients with severe ( grade 34 ) overt he at the time of waitlist registration had a significantly greater risk of 90-day mortality than patients without he ( hazard ratio , 1.6 ; 95% confidence interval , 1.4 , 1.9 ; p<0.001).7 he can progress quickly , and the severity of symptoms often leads to patients being hospitalized for treatment.3 in the 2006 nationwide inpatient sample , which included 65,072 discharge records involving hospitalizations due to complications of cirrhosis , 41% of cirrhosis - related hospitalizations requiring critical care were associated with he.8 the number of hospital discharges associated with he based on codes from the international classification of diseases , ninth revision , clinical modification has progressively increased since 2004 and exceeded 400,000 in 2010.9,10 based on the nationwide inpatient sample , the estimated hospitalization incidence for patients with he as a primary or secondary diagnosis ranged from 102,293 in 2005 to 115,814 in 2009 ; the prevalence was 0.33% of all hospitalizations.11 although hospitalizations related to he have been increasing , for patients with a primary diagnosis of he , the mean length of stay decreased between 1993 and 1996 in the usa and has subsequently remained constant at approximately 6 days.9,1214 on average , the length of stay included 0.9 days in the intensive care unit , based on an analysis of a large us hospital database ( june 2010 to december 2011).14 although the burden and cost of initial hospitalization for he and other factors such as treatment for he generally have been characterized , it is not apparent that the risks and costs associated with rehospitalization have been studied to the same extent . indeed , the risk of rehospitalization for patients with cirrhosis appears to be substantial . in a retrospective study of patients with decompensated cirrhosis , 69% ( 276 ) of 402 records showed > 1 readmission related to complications , with a median time to first readmission of 67 days.15 the authors reported a median number of readmissions of two ( range , 040 ) ; however , readmissions could have resulted from any of the reported complications of cirrhosis and were not limited to he . the objective of this systematic review is to evaluate the impact of rehospitalization on costs and clinical outcomes for patients with cirrhosis initially hospitalized for he . a systematic review of the pubmed medical literature was conducted for english - language articles with no time limitation ( up to february 18 , 2015 ) . the primary search was performed using the keywords hepatic encephalopathy , hospitalization , admission , rehospitalization , and readmission . to ensure all relevant articles were identified , additional ( secondary ) search terms and search strings were tested with the following keywords : quality of life , factor , predictors , mortality , survival , transplantation , burden , cost , no treatment , untreated , placebo , and prophylaxis . selection criteria ( papers discussing randomized , controlled trials ; observational studies ; and meta - analyses ) were applied to the initial searches to enrich the quality of the studies reported . these criteria were later relaxed to expand the pool of eligible studies to include open - label , retrospective , uncontrolled , and cross - sectional study designs . bibliographies of identified publications were also reviewed for relevant references that had escaped detection using the predefined search terms . because the initial literature search identified a relatively low number of studies , the review was expanded to include abstracts published for pertinent medical conferences between 2010 and 2014 . included were abstracts for the american college of gastroenterology annual meeting , digestive disease week , the liver meeting ( american association for the study of liver diseases ) , and the international liver congress ( european association of the study of the liver ) , based on a search for encephalopathy . the search of medical conferences was limited to those taking place in the last 5 years at the time the initial searches were conducted ; the author anticipated a larger number of studies would be identified in the pubmed literature . all references and abstracts selected for inclusion reported on the prevalence , costs , or clinical consequences of rehospitalization in adult patients with he . outcomes of the systematic search are summarized in the prisma ( preferred reporting items for systematic reviews and meta - analyses ) flow diagram ( figure 1 ) . results of the pubmed search yielded 95 studies ; an additional 27 studies were identified from medical conferences ( n=9 ) and secondary search terms ( n=18 ) . studies from the latter category included pertinent data for inclusion in the review that were not identified when the primary search string was performed . of those studies initially identified , the majority ( n=92 ) were excluded upon further review . the primary reasons for exclusion were studies in animals , hospitalization attributed to other complications of cirrhosis , acute liver disease , and initial hospitalization event without recurrence , among others . this review includes results from 12 journal publications and six abstracts ( table 1).6,8,9,11,12,14,1627 a retrospective analysis of data from > 500 us hospitals assessed hospital readmissions in 8,766 adults discharged from the hospital between june 2010 and december 2011 with a primary diagnosis of he.14 overall , 17.6% of discharged patients were readmitted within 30 days , and 39.5% were readmitted within 1 year for he - related reasons . incidence rates for all - cause readmission were 27.4% at 30 days and 56.4% at 1 year . in another retrospective us study , approximately one - third of 402 patients with de compensated cirrhosis had he at admission , 78% ( 314 of 402 ) of patients were readmitted during a median follow - up period of 203 days , with 88% ( 276 of 314 ) of patients having 1 non - elective readmission.22 the median time to first readmission was 67 days , with 14% of patients readmitted within 1 week and 37% within 1 month . overall , 22% of readmissions within 1 month were considered preventable . in fact , recurrent he was among the most preventable reasons for readmission . notably , after adjusting for potential confounding factors , patients with more frequent readmissions had a significantly increased risk of mortality . furthermore , a retrospective review analyzed data from 139 patients admitted to a us tertiary hospital for the treatment of complications of liver cirrhosis and reported that he was an indication for admission in 36% of these patients.24,25 of the 31% of patients readmitted within 1 month , 47% were readmitted for he . in an attempt to analyze possible causes of readmission due to he , an analysis of medical records of 145 patients admitted with overt he to a single hospital identified poor social support , failure to fill a prescription , and lack of follow - up with a health care provider as factors associated with a high likelihood of readmission.26 hospitalization for he is associated with substantial economic burden . the total national cost of hospitalizations of patients with he ( primary or secondary diagnosis ) increased from us$1.7 billion in 2005 to us$2.0 billion in 2009.11 the total cost per he - related hospital discharge increased from us$22,511 in 2004 to us$37,598 in 2010.9 this analysis included patients with any international classification of diseases , ninth revision , clinical modification discharge diagnosis code indicative of he ( ie , not limited to patients with a primary or secondary diagnosis of he ) . the mean hospital cost for he - related hospitalization ( primary or secondary diagnosis ) did increase between 2005 ( us$16,512 ) and 2009 ( us$17,812 ) , but the difference was not statistically significant.11 a study reported that the mean hospital cost in 2003 for patients admitted with a primary diagnosis of he was us$23,192.12 the mean cost of hospitalization for he ( as a primary diagnosis ) in a large ( > 500 ) us hospital database ( june 2010 to december 2011 ) was us$10,629 , with room and board accounting for approximately 50% of overall hospitalization costs ( mean , us$5,518 ) and pharmacy costs accounting for 11.5% of overall hospitalization costs ( mean , us$1,223).14 in a study of a university health system , the mean cost of readmission for patients with decompensated cirrhosis was us$25,898 for readmission within 1 week and us$20,581 for readmission between weeks 1 and 4.22 overall , these data underscore the high costs of hospitalization for he and the economic impact of rehospitalization . for patients hospitalized with cirrhosis , he doubles the risk of in - hospital mortality.8 in us hospitals , the in - hospital mortality rate for overt he ranges between approximately 7% and 15%.11,14 higher in - hospital mortality rates have been reported in patients with severe he ( ~40%)6 and in patients treated in developing countries ( ~33% to 50%).20,21 risk factors for inpatient mortality in patients with he include a higher number of concomitant diagnoses , comorbid fluid and electrolyte disorders , more procedures during admission , and major or extreme severity of illness.11 interestingly , a 2014 study reported that non - hospitalized patients with cirrhosis and minimal he were at an increased risk of hospitalization compared with patients without minimal he , when adjusted for sex , age , and cirrhosis etiology ( hazard ratio , 2.5 ; 95% confidence interval , 1.4 , 4.5 ; p=0.002).28 cirrhosis and overt he are both associated with impairment in health - related quality of life ( qol ) . in patients with cirrhosis and varying degrees of neuropsychiatric impairment , the severity of he was significantly associated with patient qol scores as well as the degree of caregiver burden.19 among 160 consecutive adults with cirrhosis presenting for an initial evaluation for liver transplantation in a university setting between january 2001 and september 2001 , 125 patients ( 78% ) had he ( 36 with minimal he and 89 with overt he).16 compared with the general us population , patients with cirrhosis had poorer health - related qol based on short form ( 36 ) health survey ( sf-36 ) domain and summary scores . patients with cirrhosis and overt he experienced significantly worse physical and mental health - related qol than those without he . in addition , the reduction in health - related qol related to he was independent of the child pugh score . of note , the physical component summary score of the sf-36 was lower in patients with cirrhosis who had previously been hospitalized than in patients who had never been hospitalized . this observation may be related to an increase in disease severity among patients requiring hospitalization and may also be related to hospitalizations for complications of cirrhotic decompensation , such as he . unfortunately , cognitive deficits have been shown to persist after an episode of overt he resolves . in a cross - sectional study of 226 patients with cirrhosis , patients with a history of overt he ( n=54 ) performed significantly worse than patients without a history of overt he ( n=172 ) on psychometric tests.17 a cross - sectional study assessed cognitive function in 50 patients with cirrhosis who had experienced 1 episode of overt he . of the 50 patients , 32 were being treated with lactulose monotherapy , eleven were being treated with rifaximin monotherapy , and seven were being treated with rifaximin and lactulose combination therapy . all patients had normal mental status at the time of testing . in that study , the severity of cognitive impairment increased both with the number of episodes of overt he and with the number of hospitalizations related to overt he . furthermore , the number of previous episodes and the number of hospitalizations for overt he correlated with psychometric scores , which were used to assess severity of residual cognitive impairment ( table 2).17 a retrospective analysis of data from > 500 us hospitals assessed hospital readmissions in 8,766 adults discharged from the hospital between june 2010 and december 2011 with a primary diagnosis of he.14 overall , 17.6% of discharged patients were readmitted within 30 days , and 39.5% were readmitted within 1 year for he - related reasons . incidence rates for all - cause readmission were 27.4% at 30 days and 56.4% at 1 year . in another retrospective us study , approximately one - third of 402 patients with de compensated cirrhosis had he at admission , 78% ( 314 of 402 ) of patients were readmitted during a median follow - up period of 203 days , with 88% ( 276 of 314 ) of patients having 1 non - elective readmission.22 the median time to first readmission was 67 days , with 14% of patients readmitted within 1 week and 37% within 1 month . notably , after adjusting for potential confounding factors , patients with more frequent readmissions had a significantly increased risk of mortality . furthermore , a retrospective review analyzed data from 139 patients admitted to a us tertiary hospital for the treatment of complications of liver cirrhosis and reported that he was an indication for admission in 36% of these patients.24,25 of the 31% of patients readmitted within 1 month , 47% were readmitted for he . in an attempt to analyze possible causes of readmission due to he , an analysis of medical records of 145 patients admitted with overt he to a single hospital identified poor social support , failure to fill a prescription , and lack of follow - up with a health care provider as factors associated with a high likelihood of readmission.26 the total national cost of hospitalizations of patients with he ( primary or secondary diagnosis ) increased from us$1.7 billion in 2005 to us$2.0 billion in 2009.11 the total cost per he - related hospital discharge increased from us$22,511 in 2004 to us$37,598 in 2010.9 this analysis included patients with any international classification of diseases , ninth revision , clinical modification discharge diagnosis code indicative of he ( ie , not limited to patients with a primary or secondary diagnosis of he ) . the mean hospital cost for he - related hospitalization ( primary or secondary diagnosis ) did increase between 2005 ( us$16,512 ) and 2009 ( us$17,812 ) , but the difference was not statistically significant.11 a study reported that the mean hospital cost in 2003 for patients admitted with a primary diagnosis of he was us$23,192.12 the mean cost of hospitalization for he ( as a primary diagnosis ) in a large ( > 500 ) us hospital database ( june 2010 to december 2011 ) was us$10,629 , with room and board accounting for approximately 50% of overall hospitalization costs ( mean , us$5,518 ) and pharmacy costs accounting for 11.5% of overall hospitalization costs ( mean , us$1,223).14 in a study of a university health system , the mean cost of readmission for patients with decompensated cirrhosis was us$25,898 for readmission within 1 week and us$20,581 for readmission between weeks 1 and 4.22 overall , these data underscore the high costs of hospitalization for he and the economic impact of rehospitalization . for patients hospitalized with cirrhosis , he doubles the risk of in - hospital mortality.8 in us hospitals , the in - hospital mortality rate for overt he ranges between approximately 7% and 15%.11,14 higher in - hospital mortality rates have been reported in patients with severe he ( ~40%)6 and in patients treated in developing countries ( ~33% to 50%).20,21 risk factors for inpatient mortality in patients with he include a higher number of concomitant diagnoses , comorbid fluid and electrolyte disorders , more procedures during admission , and major or extreme severity of illness.11 interestingly , a 2014 study reported that non - hospitalized patients with cirrhosis and minimal he were at an increased risk of hospitalization compared with patients without minimal he , when adjusted for sex , age , and cirrhosis etiology ( hazard ratio , 2.5 ; 95% confidence interval , 1.4 , 4.5 ; p=0.002).28 cirrhosis and overt he are both associated with impairment in health - related quality of life ( qol ) . in patients with cirrhosis and varying degrees of neuropsychiatric impairment , the severity of he was significantly associated with patient qol scores as well as the degree of caregiver burden.19 among 160 consecutive adults with cirrhosis presenting for an initial evaluation for liver transplantation in a university setting between january 2001 and september 2001 , 125 patients ( 78% ) had he ( 36 with minimal he and 89 with overt he).16 compared with the general us population , patients with cirrhosis had poorer health - related qol based on short form ( 36 ) health survey ( sf-36 ) domain and summary scores . patients with cirrhosis and overt he experienced significantly worse physical and mental health - related qol than those without he . in addition , the reduction in health - related qol related to he was independent of the child pugh score . of note , the physical component summary score of the sf-36 was lower in patients with cirrhosis who had previously been hospitalized than in patients who had never been hospitalized . this observation may be related to an increase in disease severity among patients requiring hospitalization and may also be related to hospitalizations for complications of cirrhotic decompensation , such as he . unfortunately , cognitive deficits have been shown to persist after an episode of overt he resolves . in a cross - sectional study of 226 patients with cirrhosis , patients with a history of overt he ( n=54 ) performed significantly worse than patients without a history of overt he ( n=172 ) on psychometric tests.17 a cross - sectional study assessed cognitive function in 50 patients with cirrhosis who had experienced 1 episode of overt he . of the 50 patients , 32 were being treated with lactulose monotherapy , eleven were being treated with rifaximin monotherapy , and seven were being treated with rifaximin and lactulose combination therapy . all patients had normal mental status at the time of testing . in that study , the severity of cognitive impairment increased both with the number of episodes of overt he and with the number of hospitalizations related to overt he . furthermore , the number of previous episodes and the number of hospitalizations for overt he correlated with psychometric scores , which were used to assess severity of residual cognitive impairment ( table 2).17 to reduce the risk of he recurrence , the american association for the study of liver diseases and european association of the study of the liver recommend prophylactic treatment after an episode of overt he resolves.2 however , routine prophylaxis is not recommended for preventing he after a transjugular intrahepatic portosystemic shunt.2 medications commonly administered to prevent the recurrence of overt he are similar to those for treating overt he episodes and include lactulose and rifaximin in fact , rifaximin is indicated for reducing the risk of overt he recurrence in adults ( figure 2).2 per treatment guidelines , [ r]ifaximin added to lactulose is the best - documented agent to maintain remission in patients who have already experienced one or more bouts of ohe [ overt hepatic encephalopathy ] while on lactulose treatment after their initial episode of ohe.2 prophylactic therapy to prevent he recurrence is usually continued indefinitely , until liver transplantation or death , but discontinuation may be considered if the precipitating factors have been well controlled or if a patient s liver function or nutritional status has improved.2 despite professional society recommendations for prophylactic therapy , many patients do not appear to be receiving preventive treatment after 1 episode of overt he . an analysis of national claims for medical and hospital activity from 2009 to 2011 indicated that more than 60% of eligible patients with overt he did not receive ongoing prophylactic therapy during each year studied.29 the apparent undertreatment of patients after an episode of overt he may potentially result in preventable he recurrences and , consequently , preventable rehospitalizations related to these recurrences . the burden and cost implications of undertreatment and potential resultant rehospitalizations for he episodes were the subject of this review . hospital readmissions after discharge for decompensated cirrhosis , and for he in particular , are common in patients with cirrhosis . in addition , a considerable number of patients are readmitted within 1 month of hospital discharge,14 and rehospitalization for he imposes a substantial economic burden . not surprisingly , statistical modeling data suggest that costs associated with hospitalization are some of the largest contributors to overall costs of he treatment.23 overall , given the various methodologies applied across studies to determine costs ( eg , review of current procedural terminology codes selected ) , it is difficult to compare results . indeed , differences exist in the availability and interpretation of current procedural terminology codes , studies are conducted across divergent time periods in which health care inflation may vary considerably , studies prospectively enroll or retrospectively review cases of different patient populations with varied severity of disease , and services offered tend to become more complex and costly over time . in the present review , the data support a substantial cost burden associated with hospitalizations related to he and suggest that the cost burden has increased over time . rehospitalization for he may lead to adverse consequences for patients with cirrhosis , including increased mortality , impaired health - related qol , and residual cognitive impairment . regarding the effects of cognitive impairment , key findings from studies identified for this review support a hypothesis that repeated overt he episodes may be neurotoxic and may lead to chronic neurologic damage , despite the apparent return of normal mental status initially after treatment . in a study by bajaj et al,30 cognitive impairment was observed across all tests employed , including persistent and cumulative deficits in memory , response inhibition , and learning in patients who had experienced episodes of overt he . the potential for persistent neurologic damage is an interesting hypothesis that has primarily been reported on in the context of patients observed after liver transplantation.31 in one such study , cognitive dysfunction was more pronounced in patients who had experienced overt he prior to liver transplantation.31 therefore , it will be important in the future to examine the potential for clinical and economic sequelae to extend beyond the primary he episode . additionally , mortality rates remain high for patients with cirrhosis ; however , some deaths attributed to an he episode may be preventable . notably , guidelines support the importance of prophylactic therapy to help prevent repeated episodes of overt he in , and the consequent rehospitalization of , patients with cirrhosis . this review has several important limitations . for instance , most of the studies identified were not prospective but , rather , retrospective chart reviews , smaller cross - sectional studies , or sample surveys . in addition , there was significant heterogeneity in the outcomes measured in the identified studies . nevertheless , data are accumulating to support the idea that he - related rehospitalization represents an important unmet medical need . because the published literature on he - related rehospitalization is limited , this review included medical conference abstracts , which are considered by some to be less desirable sources of information . in addition , estimated hospitalization costs for he were used as a proxy for rehospitalization costs in the absence of more specific data . furthermore , for qol and cognitive functioning , associations with rehospitalization were reported , but impairments may be related to he recurrence rather than to rehospitalization per se . the economic and clinical consequences of rehospitalization for patients with overt he underscore the importance of secondary prevention . nonetheless , about 60% of patients do not receive ongoing prophylactic therapy to prevent he recurrence after discharge.29 it is unclear whether the low rate of prophylaxis is the result of patients not filling prescriptions or providers not prescribing prophylactic therapy . further studies are warranted to help identify the reasons for the undertreatment of patients after hospitalization for overt he to enable health care providers to better address this gap in medical care . | backgroundovert hepatic encephalopathy ( he ) , which is associated with neuropsychiatric symptoms and neuromuscular dysfunction in patients with liver cirrhosis , is often managed in the hospital setting . approximately 60% of eligible patients do not receive prophylactic therapy after an overt he episode.objectivethe aim of this review is to evaluate the impact of rehospitalization on costs and clinical outcomes in he.methodsa pubmed search of english - language articles through july 9 , 2014 was conducted , and bibliographies of identified publications were reviewed .
abstracts from relevant professional society meetings from 2010 to 2014 were searched .
the selected references and abstracts reported on the prevalence , costs , or clinical consequences of rehospitalization in adults with he.data synthesishe is a key reason for readmission among patients hospitalized for complications of cirrhosis .
almost 40% of patients previously hospitalized for he may be readmitted within 1 year for he - related reasons .
furthermore , in - hospital us mortality for patients admitted for he is about 7% to 15% .
recurrent he and hospitalization for cirrhosis complications are associated with impaired quality of life .
in addition , recurrences ( especially those requiring hospitalization ) may contribute to persistent cognitive deficits ( eg , impairments in reaction time , attention , and working memory ) after resolution of an acute episode of overt he.conclusionthe economic and clinical consequences of rehospitalization for patients with overt he underscore the importance of secondary prevention and highlight the need to identify reasons for the undertreatment of patients after hospitalization for overt he . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 49-year - old , nonsmoking female had been treated for aml with one course of induction chemotherapy with the use of daunorubicin and cytosine arabinoside ( ara - c ) . after relapse of aml , the patient was treated with 10 mg / m iv mitoxantrone daily for six days and 3 g / m iv ara - c , daily for six days . on day six , flu - like symptoms including fever and cough developed after completion of the chemotherapy . on examination , the patient had an elevated temperature ( 38.5 ) and tachypnea . the results of arterial blood gas analysis in room air were as follows : pao2 92 mmhg , paco2 30 mmhg and ph , 7.37 . the results of a laboratory evaluation were as follows : hemoglobin level , 104 g / l ; platelet count , 140,000/l ; white blood cell count , 11,100/l . the level of c - reactive protein and the erythrocyte sedimentation rate did not increase . fiberoptic bronchoscopy showed patent airways and the bronchoalveolar lavage ( bal ) fluid was non - diagnostic . culture and microscopy of sputum and bal materials were negative for fungi , bacteria , acid - fast bacilli , pneumocystis carinii and cytomegalovirus . empirical antibiotic therapy was initiated for a case of presumed pneumonia . over the next few days , fever and cough persisted in spite of the antibiotic treatment . on day 11 , twenty hours later , a chest computed tomography ( ct ) scan confirmed the presence of numerous discrete 1-mm to 5-mm nodules throughout the lungs ( fig . 1b , c ) . due to the poor response to the antibiotic treatment and the questionable diagnosis of pulmonary metastases , a video - assisted thoracoscopic lung biopsy with wedge resection of the posterior segment of the right upper lobe was performed on day 13 . histopathological analysis revealed that polypoid granulation tissue was filling the air spaces and foamy macrophages and inflammatory cells with interstitial pneumonia and air - space fibrosis were present , consistent with cop ( fig . 1d , e ) . dramatic improvement of the clinical symptoms and radiographic abnormalities was noted after two weeks of appropriate steroid treatment ( fig . 1f ) , and the lesions were almost completely resolved after three weeks ( fig . 1 g ) . at a follow - up visit one month after discharge , the patient remained asymptomatic and chest radiograph showed a stable appearance . cryptogenic organizing pneumonia is a distinct clinicopathological entity characterized by a subacute illness with shortness of breath , fever , cough , malaise and patchy peripheral air - space infiltrates as depicted on chest radiographs ( 1 ) . the disease is defined histopathologically as granulation tissue plugs within the lumina of small airways , alveolar ducts and alveoli ( 2 ) . most cases are idiopathic and may be secondary to infections , a hematological malignancy , connective tissue disorders , drug administration , exposure to radiation or bone marrow or lung transplantation ( 2 , 3 ) . cryptogenic organizing pneumonia has a variable radiologic appearance and is usually characterized by unilateral or bilateral areas of patchy air - space consolidation with a subpleural and peribronchial distribution ( 1 , 2 ) . in a review of 14 patients with cop , mller and colleagues ( 4 ) found no single finding or combination of findings that could be considered diagnostic of this disease . the presentation of a patient with diffuse discrete 1-mm to 5-mm pulmonary nodules associated with cop is uncommon . correlation of the high - resolution ct abnormalities with the findings on video - assisted thoracoscopic biopsy suggest that the nodules seen on ct corresponded to localized areas of organizing pneumonia around the bronchiolitis obliterans . this pattern of lesions is separated from other involved bronchioles by a zone of relatively normal parenchyma , explaining the nodular appearance . the findings differ from the patchy or confluent nodular infiltrations usually associated with cop ( 5 , 6 ) . the clinical presentation in this case differs from that of neoplastic diseases , however , due to the rapid progression to diffuse nodules over a few days . furthermore , multiple nodules are not always a sign of malignant disease , and benign lesions such as tuberculosis and fungal and parasitic infections should be considered in the differential diagnosis . definitive differentiation of cop from infectious diseases by imaging studies , however , is usually not possible . the absence of microorganisms in cultures of blood , sputum , and bal fluid and the failure of empirical antibiotic treatment ruled out active infection at the onset of pulmonary symptoms in our patient . the factors responsible for cop in this case remain unclear but may include a direct immunologic reaction resulting from a possible subclinical viral infection , a toxic reaction to the chemotherapeutic agents and underlying hematological disease . however , whatever the etiology of cop in this case , the clinical symptoms and pulmonary lesions dramatically improved as the patient was responsive to steroid therapy . further , early diagnosis prevented the patient from having rapidly progressive cop that is a deadly form of the disease and can occur in a small percentage of patients ( 7 ) . as pointed out in previous studies , benign pulmonary nodules in patients with an underlying malignancy have occasionally been seen in the setting of allogeneic bone marrow transplantation ( 8) or in chemotherapeutic drug toxicity ( 9 ) . in our patient , the question of drug - induced cop arises as bone marrow transplantation was not performed and the clinical and radiological manifestations of pulmonary lesions developed after chemotherapy . our patient , however , was not given bleomycin , which has been associated with nodular cop mimicking pulmonary metastases ( 10 ) . the association between the administration of high - dose intravenous ara - c and lung toxicity is well recognized , and battistini et al . ( 11 ) reported the development of cop in three children with acute leukemia who received a combination of high - dose ara - c and anthracyclines , which is similar to the regimen that was followed by our patient . therefore , although undetectable infectious agents may be etiologic factors , chemotherapeutic toxicity can be presumed . in conclusion , our patient had an unusual radiological pattern of diffuse discrete pulmonary nodules associated with cop that mimicked pulmonary metastases . the development of new pulmonary symptoms accompanied by a radiological manifestation of diffuse pulmonary nodules in cancer patients during chemotherapy should prompt consideration of this diagnosis so that appropriate steroid treatment can be initiated . | the radiological appearance of diffuse discrete pulmonary nodules associated with cryptogenic organizing pneumonia ( cop ) has been rarely described .
we describe a case of cop in 49-year - old woman with acute myeloid leukemia who developed diffuse pulmonary nodules during the second course of induction chemotherapy .
the clinical status of the patient and imaging findings suggested the presence of a pulmonary metastasis or infectious disease .
a video - assisted thoracoscopic lung biopsy resulted in the unexpected diagnosis of cop as an isolated entity .
steroid therapy led to dramatic improvement of the clinical symptoms and the pulmonary lesions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
traumatic aneurysm of the superficial temporal artery ( sta ) was first described in the 17th century , after a blunt head trauma . since then approximately 200 cases have been reported . the sta is one of the terminal branches of the external carotid artery , which supplies blood to the scalp [ 13 ] . owing to its superficial and anatomical course , the sta is vulnerable to blunt head trauma , which can eventually result in traumatic aneurysms of the sta after a few weeks [ 47 ] . at the daily routine most often these were diagnosed as simple sebaceous cysts , epidermoid cysts , pilar cysts , lipomas and in case of a history of trauma as hematomas . traumatic aneurysms of the sta should be a differential diagnostic consideration in patients with a history of trauma and a swelling on their scalp as is prompted in this report . a 50-year - old healthy man presented with a lump on the temporal side of his head . six weeks before , he fell off his mountain bike , hitting the ground with the left side of his head while wearing a helmet . initially , there were no signs of injury , but after a few weeks a progressive painless lump has appeared at the place where his head smashed into the helmet at the time of the accident . physical examination revealed a smooth lump , measuring 1 cm with no signs of inflammation or tenderness ( fig . 1 ) . our patient was treated by excision of the swelling , which turned out to be an aneurysm of the sta ( fig . 2 ) . figure 1:clinical presentation of a lump on the scalp with a diameter of 1 cm . about 95% of the aneurysms of the sta have a traumatic cause , mostly as a result of blunt head trauma . the remaining 5% of the cases are considered spontaneous aneurysms from congenital or atherosclerotic origin . an aneurysm of the sta may be present as painless , pulsatile masses at the site of the injured arterial branch and could be associated with a palpable thrill . our case demonstrates that signs of injury can be absent at the time of the accident , but sta aneurysms may still develop a few weeks after the trauma has occurred . duplex ultrasonography is a reliable and safe method to confirm the diagnosis . in cases where sta aneurysms are left untreated , cosmetic concerns , headaches and more importantly ruptures of the aneurysm have been reported [ 2 , 9 ] . endovascular treatment modalities such as thrombin injection and catheter - based embolization have been described in a few cases . these techniques can be used in selected cases in which surgery is not possible or not preferred for cosmetic reasons . possible disadvantages of the endovascular treatment options could be a persisting lump or embolic complications of the carotid artery . after failure of the thrombin injections , a second injection was needed or surgery in a second stage . although a scar comes along with surgery , exploration with ligation and excision is considered as a safe and definitive treatment of aneurysms of the sta . in conclusion , physicians should be aware of traumatic aneurysms of the sta in patients with a history of trauma and a swelling on their head . | a male cyclist presented with a swelling on the forehead .
six weeks before , he fell of his bike and smashed his head on the ground while wearing a helmet .
a smooth lump of 1 cm had evolved on the temporal side of his forehead in a few weeks .
duplex ultrasonography demonstrated a dilated vessel with a minor defect in the luminal wall .
surgical exploration revealed an aneurysm of the superficial temporal artery ( sta ) .
the aneurysm was surgically removed and the patient recovered uneventfully . owing to its superficial course ,
the sta is vulnerable to blunt head trauma .
traumatic aneurysms of the sta should be a differential diagnostic consideration in patients with a history of trauma and a swelling on their head . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
phenols are synthesised by the plant as a defense against different pathogens . during the early stages of crushing , mixing and extraction of the oil from olive drupe , the biotransformation of phenolic products of the original fruit occurs ( kubo et al . , 1985 ; part of these compounds , in view of their strong water solubility will be concentrated in the vegetation water , a mass that is a rejection and as such can not be released neither into the sewer system nor dispersed in the open field . the vegetation water of the oil mill is a mass containing a solid residue ranging between 6 and just over 7% and where the phenols represent a percentage between 0.3 and 1.1% ( on wet mass ) . a suitable multistage filtration process allows to separate most of the solid fraction from the remaining liquid mass of the vegetation water . it is thus possible to lower the organic load of the water to levels consistent with those maximum permitted for the direct entering in the sewerage system . the solid extract which is separated from vegetation water is particularly rich in phenolic compounds , among them decarboxymethyl oleuropein aglycone which represents about 45% of the mass of the extract in addition to verbascoside , tyrosol and hydroxytyrosol , each one in a residual concentration less than 10% . the use of enriched extract , such as that from vegetation water , as an ingredient with antioxidant and/or antimicrobial aim in food products may be an example of sustainable use of by - products of the food industry . a basic formulation consisting of pork lean cuts ( shoulder and rump ) and fat ( belly ) in a ratio of about 70:30 was made . the meat was ground using a meat grinder equipped with a plate of 8 mm holes . the dough ( about 30 kg ) was added of salt ( 2.7% ) and starter culture ( lyophilised mixture of pediococci and staphylococci ) and mechanically mixed ( batch of control , c ) . the starter culture added was previously tested in a preliminary evaluation of lab survival in an environment enriched with phenols compounds . the dough , was divided into three portions of 10 kg each as follows : c = control ; f1=control+phenol concentration of 75 mg/100 g , f2=control+phenol concentration of 150 mg/100 g. the stuffing of the dough was carried out using natural casings . the size of the individual units ( salami ) ranged between 250 and 350 g. the ripening was carried out inside a cabinet equipped with automatic control and regulation of the temperature and relative humidity according to the following program : i ) dripping at room temperature for 12 h without humidity control , ii ) drying from 22 to 14c in 8 days and max humidity set at 75% in the first day and 82% in the eighth day , iii ) ripening , carried out at a temperature of 14c and maximum relative humidity of 82% , ended on reaching the total weight loss of 30% . an aliquot of each of the three batches of ripened salami was sliced and packaged in a protective atmosphere ( a mixture of nitrogen and carbon dioxide in the percentage ratio 80:20 ) into rigid trays ( 17623025 mm ) closed by hot welding with a sheet of polyethylene plastic film with antifog properties . the trays were placed within a refrigerator thermostat at a temperature of 2 - 4c and alternating exposure to light ( 12 h under light and 12 h in the dark ) obtained by a lamp of 36 w , 1600 lux intended for foods employment . in each tray 9 slices were laid for a total net weight of about 100 g. at the moment of packaging and after 10 , 20 and 30 days of storage in the refrigerated thermostat a few measurements and analytical determinations were carried out . all slices of each tray ( two independent units for each batch ) were finely homogenised ( 2500 rpm 10 s ; retsch , dsseldorf , germany ) . for the measurement of ph , 1 g of the homogenate was then taken immediately , dispersed in water ( 1:10 w / v ) and submitted to further crushing using a rod homogeniser ( 13,000 rpm / min , ultraturrax t25 basic ; ika werke , staufen , germany ) and the ph measurement was taken by a portamess ph - meter ( model 910 ; knick , berlin , germany ) coupled with an inlab 427 electrode ( mettler toledo , leicester , uk ) . for the measurement of water activity a teflon capsule was half - filled with homogenised sample and the measure taken using the aqualab 4 vte ( decagon devices , pullman , wa , usa ) . the titratable acidity was determined on an aliquot of fat ( 0.5 - 1 g ) , previously extracted according to the method of folch et al . ( 1957 ) , solubilised with a mixture of diethyl ether / ethanol ( 2/1 ) and titrated with 0.01 m sodium hydroxide in the presence of phenolphthalein . the peroxide number was determined on an aliquot of fat ( 0.5 - 1 g ) previously extracted from the product and then solubilised with a mixture of acetic acid / chloroform ( 3/2 ) . after the addition of 0.5 ml of saturated solution of ki and incubation in the dark for 2 min , elemental iodine developed by the hydroperoxides that were in the fat sample was titrated by a solution of 0.01 m sodium thiosulphate in the presence of starch as indicator . secondary products of lipid - peroxidation were determined by the thiobarbituric acid reactive substances ( tbars ) according to the method of botsoglou et al . , 8 ml of an aqueous solution of 5% trichloroacetic acid and 5 ml of n - hexane with 0.008% buthylhydroxytoluene ( antioxidant agent ) were added to approximately 2 g of the homogenised sample accurately weighed . after homogenisation with ultraturrax ( t25 basic ; ika werke ) for 30 sec at high speed , the sample was centrifuged for 3 min at 3000 g at 4c ( eppendorf 5810r ; eppendorf , hamburg , germany ) and the surnatant removed . to eliminate the residual solid component , an aliquot of the filtrate ( 2.5 ml ) was added to 2.5 ml of a solution of 0.02 m thiobarbituric acid ( tba ) and incubated for 35 min at 95c in a thermostated bath ( julabo ed-13 ; seelbach , baden - wrttemberg , germany ) . after cooling , ( jasco , oklahoma city , ok , usa ) set at a wavelength of 532 nm . a basic formulation consisting of pork lean cuts ( shoulder and rump ) and fat ( belly ) in a ratio of about 70:30 was made . the meat was ground using a meat grinder equipped with a plate of 8 mm holes . the dough ( about 30 kg ) was added of salt ( 2.7% ) and starter culture ( lyophilised mixture of pediococci and staphylococci ) and mechanically mixed ( batch of control , c ) . the starter culture added was previously tested in a preliminary evaluation of lab survival in an environment enriched with phenols compounds . the dough , was divided into three portions of 10 kg each as follows : c = control ; f1=control+phenol concentration of 75 mg/100 g , f2=control+phenol concentration of 150 mg/100 g. the stuffing of the dough was carried out using natural casings . the size of the individual units ( salami ) ranged between 250 and 350 g. the ripening was carried out inside a cabinet equipped with automatic control and regulation of the temperature and relative humidity according to the following program : i ) dripping at room temperature for 12 h without humidity control , ii ) drying from 22 to 14c in 8 days and max humidity set at 75% in the first day and 82% in the eighth day , iii ) ripening , carried out at a temperature of 14c and maximum relative humidity of 82% , ended on reaching the total weight loss of 30% . an aliquot of each of the three batches of ripened salami was sliced and packaged in a protective atmosphere ( a mixture of nitrogen and carbon dioxide in the percentage ratio 80:20 ) into rigid trays ( 17623025 mm ) closed by hot welding with a sheet of polyethylene plastic film with antifog properties . the trays were placed within a refrigerator thermostat at a temperature of 2 - 4c and alternating exposure to light ( 12 h under light and 12 h in the dark ) obtained by a lamp of 36 w , 1600 lux intended for foods employment . in each tray 9 slices were laid for a total net weight of about 100 g. at the moment of packaging and after 10 , 20 and 30 days of storage in the refrigerated thermostat a few measurements and analytical determinations were carried out . all slices of each tray ( two independent units for each batch ) were finely homogenised ( 2500 rpm 10 s ; retsch , dsseldorf , germany ) . for the measurement of ph , 1 g of the homogenate was then taken immediately , dispersed in water ( 1:10 w / v ) and submitted to further crushing using a rod homogeniser ( 13,000 rpm / min , ultraturrax t25 basic ; ika werke , staufen , germany ) and the ph measurement was taken by a portamess ph - meter ( model 910 ; knick , berlin , germany ) coupled with an inlab 427 electrode ( mettler toledo , leicester , uk ) . for the measurement of water activity a teflon capsule was half - filled with homogenised sample and the measure taken using the aqualab 4 vte ( decagon devices , pullman , wa , usa ) . the titratable acidity was determined on an aliquot of fat ( 0.5 - 1 g ) , previously extracted according to the method of folch et al . ( 1957 ) , solubilised with a mixture of diethyl ether / ethanol ( 2/1 ) and titrated with 0.01 m sodium hydroxide in the presence of phenolphthalein . the peroxide number was determined on an aliquot of fat ( 0.5 - 1 g ) previously extracted from the product and then solubilised with a mixture of acetic acid / chloroform ( 3/2 ) . after the addition of 0.5 ml of saturated solution of ki and incubation in the dark for 2 min , elemental iodine developed by the hydroperoxides that were in the fat sample was titrated by a solution of 0.01 m sodium thiosulphate in the presence of starch as indicator . secondary products of lipid - peroxidation were determined by the thiobarbituric acid reactive substances ( tbars ) according to the method of botsoglou et al . , 8 ml of an aqueous solution of 5% trichloroacetic acid and 5 ml of n - hexane with 0.008% buthylhydroxytoluene ( antioxidant agent ) were added to approximately 2 g of the homogenised sample accurately weighed . after homogenisation with ultraturrax ( t25 basic ; ika werke ) for 30 sec at high speed , the sample was centrifuged for 3 min at 3000 g at 4c ( eppendorf 5810r ; eppendorf , hamburg , germany ) and the surnatant removed . to eliminate the residual solid component , an aliquot of the filtrate ( 2.5 ml ) was added to 2.5 ml of a solution of 0.02 m thiobarbituric acid ( tba ) and incubated for 35 min at 95c in a thermostated bath ( julabo ed-13 ; seelbach , baden - wrttemberg , germany ) . after cooling , the absorbance of the chromatic adduct was read by means of the spectrophotometer mod . ( jasco , oklahoma city , ok , usa ) set at a wavelength of 532 nm . the ph values were comprised between 5.21 and 5.27 at the time of the slicing and did not show substantial variations neither among the batches nor as a function of storage time ( table 1 ) . water activity had values between 0.909 and 0.913 for salami just after slicing and there were no marked changes worthy of note after 30 days of storage whose values varied between 0.914 and 0.917 ( table 2 ) . the titratable acidity ( expressed as percentage of oleic acid per 100 g of fat ) showed values between 2.95 and 3.18% at the time of slicing with an increasing trend , as storage time passed , for all the three batches in comparison , reaching final values between 4.59 and 3.88% at 30 days ( table 3 ) . the peroxide number at the time of slicing showed a mean value in the control sample equal to 48.6 meq o2/kg fat against lower values in the two batches with phenols added whose values ranged between 12.7 and 19.9 meq o2/kg fat ( table 4 ) . the peroxide number in the control batch appeared to decrease with the days of storage , whereas it was relatively constant in the samples with phenols added . finally , the analysis of secondary products of oxidation ( i.e. tbars ) showed absorbance values close to 0.1 in the control sample at the beginning , while the batches with added phenols showed values that were > 80% lower ( table 4 ) . this difference was maintained even at the sampling conducted at 10 , 20 and 30 days of storage . apart from what stated in the title and target of the study , a further expected result was the magnitude of the impact played by phenols compounds by a sensory viewpoint . as is apparent from the formulation of the dough , deliberately other ingredients were not been added ( for example , pepper , nitrate and sugar ) which could in some way interfere with the phenols compounds . in this preliminary evaluation a structured analysis of the sensory characters was not provided . however , a simple evaluation of color , odor and taste , with particular reference to the feeling of bitter and astringent , allowed to identify in the formulation f1 ( with the addition of phenols in a concentration of 75 mg/100 g of dough ) the best one . the mixture with the double amount of phenols showed , especially to the taste , a bitter aftertaste though not unpleasant in the complex . differences in terms of smell and taste between f1 and control were not always recognised by those people who had served the experimental salami for tasting . in certain cases , the dough f1 was scored even higher than the control one in terms of overall satisfaction ( data not reported ) . the values of ph and water activity were not different between the control and the two batches containing phenols compounds . in other words , there seems to be no interference played by phenols neither respect to the action carried out by starter culture nor to the process of dehydration . similar results were also observed by bozkurt ( 2007 ) as a result of the addition of sesame oil and thymbra spicata during the manufacturing of turkish dry - fermented sausage and the same was observed by balev et al . ( 2005 ) studying the effect of some antioxidants on the lipid and pigment oxidation in dry - fermented sausages . on the other hand , gk et al . ( 2011 ) found an interaction between storage time and antioxidant addition ( rosemary and tocopherol ) on ph values of sucuk ( turkish dry - fermented sausage ) . the lipolytic activity in fermented salami is attributable to the muscular tissue lipase and esterase , a set of enzymes that are very efficient in the early stages of the drying process whereas it becomes prevalent the lipolytic enzymes of the lactic acid bacteria in the later stages of the ripening process . as can be seen for the values at the time zero , the lipolytic activity of the ripened product ( measured through titratable acidity ) was not compromised in the batches spiked with phenols compounds . however , the lipolytic activity seemed to increase more markedly in the batches enriched with phenols during the following 30 days of storage of the sliced salami packaged in a protective atmosphere . this finding still remains a simple observation with the need to proceed with a deepening of investigation in the course of a subsequent trial . the analysis of peroxides and secondary compounds of lipoperoxidation ( table 4 ) showed a substantial effect of the phenols added . ( 2005 ) after the use of rosemary in the amount of 1 g / kg of dough for fermented sausages . ( 2009 ) highlighted a significant reduction in peroxide number through the use of 340 ppm of freeze - dried extract borago officinalis added to the dough of sausage to be submitted to ripening . marangoni and de moura ( 2011 ) used essential oil from coriandrum sativum in italian salami in the amount of 0.01% demonstrating the effectiveness of this natural antioxidant against the oxidation of the lipid fraction of the meat mixture . the results reported in table 4 , for the number of peroxides , also show that the stabilising effect of the lipid by phenolic compounds was much more evident when the oxidative attack occurs by radical action , as is the case of the stuffed product ( as can be seen by the values at time zero when the salami were sliced just at the end of ripening ) . instead , in the case of the salami that have been sliced , packaged and then stored under refrigeration and exposed to light for at least 12 h / day , the photo - oxidation pathway seemed to be less affected by the protective action of phenolic compounds . although there is no statistical support , the difference between the control batch and those with phenols at time zero ( autoxidation via radical attack ) was much greater than the difference observed for the packaged salami after 30 days of storage ( photo - oxidation pathway ) . the secondary compounds of lipo - peroxidation reflected the situation already observed for the peroxides number . both the minimum load of peroxides at the end of ripening in the batches with phenol compounds and a minimum , but still significant , reduction of the lipo - peroxidation during the refrigerated storage of sliced product ensured a clear slowdown in the process of rancidity . also significant was the substantial similarity in the results between the two experimental batches ( f1 and f2 ) , which corroborates the hypothesis of an effective antioxidant effect at phenols concentration compatible with the maintenance of a more than acceptable level of quality in terms of sensory tasting . the phenolic compounds obtained by the concentration and purification of the solid fraction of the vegetation water of the oil mill have shown a clear and effective antioxidant capacity in a preliminary evaluation carried out directly in the food matrix . equally important was found to be also their compatibility with the lactic acid bacteria which are due the processing and shelf - life of the salami . | a purified extract of phenols compounds ( 65% of phenolic content of which decarboxymethyl oleuropein aglycone represented 45% of the wet mass ) obtained from vegetation water ( a by - product of oil mill ) was added to a ground meat dough intended for salami manufacture in two concentration levels : 75 and 150 mg/100 g of dough ( f1 and f2 , respectively ) .
the control batch was composed of lean and fat cuts of pork in 70:30 ratio , 2.7% salt and a mixed starter culture of staphylococci and pediococci . after stuffing into natural casings ,
salamis were aged until they reached a total weight loss of 30% .
the product was then sliced and packaged in a protective atmosphere ( nitrogen : carbon dioxide 80:20 ) and placed in a refrigerator thermostat ( 2 - 4c ) with alternating 12 h of artificial light and darkness .
the samples were analysed for the measurement of ph , water activity , organic acidity , peroxide number and secondary products of lipid peroxidation at the time of slicing and after 10 , 20 and 30 days of storage into the refrigerated thermostat .
the ph and water activity were not substantially different between the control and the two enriched batches .
the peroxide number and secondary products of lipid peroxidation values in the two batches with phenols were at least substantially lower than the control sample . in conclusion ,
the phenol compounds obtained from vegetation water have shown no interference with the ripening process while protecting the dough from oxidation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
accumulating evidence supports the hypothesis that dietary behaviour and in particular ingestion of fats contribute to alzheimer 's disease ( ad ) onset and progression . the work in reported that the prevalence of sporadic and late - onset ad in > 65 years of age subjects correlated with fat intake and was higher in western countries , compared to africa or asia . population and clinical studies also suggest that regular consumption of saturated fatty acids ( sfas ) and trans - fatty acids as well as cholesterol is synergistically and positively associated with increased risk of ad [ 1 , 2 ] through mechanisms that include dyslipidemia , endothelial dysfunction , inflammation , and oxidative stress . in contrast , populations with greater consumption of fats as poly- or mono - unsaturated oils ( pufa and mufa , resp . ) have lower prevalence of ad and vascular based dementias [ 14 ] , probably as a consequence of lower levels of systemic inflammation [ 57 ] . in ad , chronic inflammation leading to neuronal loss appears to be primarily associated with cerebrovascular and brain parenchymal deposits of amyloid beta ( a ) . derived from the amyloid precursor protein , a is the predominant component of amyloid ( or senile ) plaques [ 9 , 10 ] . key triggers of cerebrovascular amyloidosis are thought to include enhanced proteolytic processing of the precursor protein on the plasma membrane of neuronal cells [ 1113 ] , a phenomenon more common in early - onset ad . in addition , fibrillar formation of a and deposition upon extracellular matrices may also reflect decreased degradation and efflux by epithelial cells of the choroid plexus [ 14 , 15 ] . alternatively , cerebral parenchymal a load may be exacerbated if cerebrovascular integrity is compromised and blood - to - brain delivery of peripheral a is increased [ 16 , 17 ] . moreover , the latter typically results in the activation of astro - glial cells and oxidation of proteins and lipids [ 18 , 19 ] . significant plasma a is found associated with triglyceride - rich lipoproteins ( trls ) and cell culture and immunohistochemical studies confirm secretion of a as a trl from hepatocytes and absorptive epithelial cells of the small intestine [ 2022 ] . in humans there is a transient increase in plasma a concentration , following the consumption of a mixed lipid meal and kinetic studies in vivo showing that a serves as a regulating apolipoprotein of trls . however , several lines of evidence suggest that persistent disturbances in the trl - a pathway may contribute to ad risk . in three strains of amyloid transgenic mice , secretion into plasma of trl - a was strongly associated with onset and progression of amyloidosis . consistent with the concept of disease induction in response to exaggerated exposure , subjects with ad were reported to have significantly elevated plasma trl - a concomitant with evidence postprandial dyslipidaemia . moreover , in human cadaver and in transgenic - amyloid mice brain specimens , significant apolipoprotein b ( apo b ) immunoreactivity colocalized with early diffused amyloid plaque [ 27 , 28 ] . to explore directly the hypothesis of a dietary fat modulation of trl - a and cerebrovascular integrity axis , wild - type ( wt ) mice were fed diets enriched in either sfa , mufa , or pufas . within 12 weeks of dietary intervention , mice maintained on the sfa diet showed substantial parenchymal extravasation of plasma proteins including apo b lipoproteins enriched with a. the endothelial tight junction protein occludin was substantially attenuated in sfa - fed mice concomitant with substantially increased enterocytic abundance of a [ 28 , 29 ] . in contrast , mice maintained on either the mufa or pufa diets had no cerebrovascular aberrations and penetration of plasma proteins in these two groups was comparable to low - fat- ( lf- ) fed controls . the potential cytotoxic properties of sfa are established and the principal mechanisms include mitochondrial respiratory burst resulting in oxidative stress and endoplasmic reticulum dysfunction . polyunsaturates on the other hand and in particular docosahexanoic acid ( dha ) generally antagonise the effects of sfa and are purported to confer cytoprotection because of potent anti - inflammatory effects [ 5 , 3133 ] . however , unsaturated fatty acids such as dha are highly susceptible to lipid peroxidation and if inflammation is already established , then oxidative damage may be paradoxically amplified with the provision of unsaturated fatty acids such as dha . to explore the hypothesis that polyunsaturated fatty acids confer benefit and not risk in a cerebrovascular proinflammatory state , we explored parenchymal extravasation of apo b lipoproteins in wt mice initially maintained on an sfa - enriched diet for 3 months , followed by randomization to either an lf- or a pufa - enriched diet for 2 months . the animal housing , handling , and experimental procedures described for this study were approved by the curtin university animal experimentation and ethics committee . six - week - old female wt mice ( c57bl/6j ) were housed in groups and randomized into their respective diets ( n = 6 mice per group ) . all mice were maintained on a 12 h light and dark cycle room , at 22c and with free access to water and food . mice were fed an sfa diet ( sf07 - 050 , glen forrest stockfeeders , glen forrest , western australia ) for 3 months and then randomised to receive either an lf ( ain-93 m , glen forrest stockfeeders ) , pufa - enriched ( sf07 - 049 , glen forrest stockfeeders ) , or maintained on sfa for a further 2 months . fatty acid composition for each diet digestible energy for the sfa diet was 18.8 mj / kg and contained palmitic ( 16 : 0 ) and stearic ( 18 : 0 ) as the principle saturated fats ( 13% , w / w ) . the lf diet contained 4% ( w / w ) as total fat and 15.1 mj / kg of digestible energy and only < 1% of total digestible energy from lipids . the pufa diet contained 8.22% ( w / w ) of dha and 2.00% ( w / w ) eicosapentaenoic acid ( epa ) sourced from numega fish oil . the diet generated 18.8 mj / kg of digestible energy where 40% of energy derived from lipids . mice were anaesthetised with pentobarbitone ( 45 mg / kg i.p . ) , and exsanguinated by cardiac puncture . brain tissues were carefully isolated , washed with chilled phosphate buffer saline ( pbs , ph 7.4 ) , right hemispheres were separated , and fixed in 4% paraformaldehyde for 24 h. the tissues were then cryoprotected with 20% sucrose solution at 4c for 72 h , frozen in isopentane with dry ice and stored at 80c . for histology and fluorescence microscopy , serial cryosections of 18 m were cut from the right cerebral hemispheres for each mouse and mounted on polysine slides ( labserv , australia ) . brain cryosections ( 18 m ) were air - dried for 30 min , rehydrated with pbs and incubated in blocking serum ( 10% goat serum ) for 30 min prior to the application of the antibodies . cerebral apo b was detected by overnight incubation with the primary antibody polyclonal rabbit anti - apo b ( ab20737 , abcam , cambridge , uk ) at 1 : 500 dilution , at 4c . postovernight incubation and washing with pbs , primary antibody was labelled at room temperature with the secondary goat anti - rabbit igg - alexa 488 fluorochrome conjugate ( a-11034 , invitrogen ) for 2 h. the sections were then washed with pbs and the nuclei were counterstained with dapi ( 1 : 1000 ) for 5 min at room temperature . digital images for photomicroscopy were acquired through axiocam hrm camera ( carl zeiss , germany ) with an axiovert 200 m inverted microscope by zeiss ( germany ) at 200 magnification ( plan neofluar 20 objective , 1.3 numerical aperture ) . three - dimensional ( 3d ) images were captured through apotome optical sectioning methodology ( carl zeiss ) . each 3d image consisted of 610 two - dimensional ( 2d ) images and the distance between z - stack slices was 1.225 m optimised by nyquist . a minimum of nine 3d images were randomly captured per mouse , which include 5 images within the cortex ( ctx ) and 2 images each from brainstem ( bs ) and hippocampal formation ( hpf ) . cerebrovascular leakage of plasma protein apo b was quantified within the ctx excluding the hippocampus , bs , and hpf . the pixel intensity of the protein of interest for each 3d image was calculated utilising the automated optical intensity measurement tool in volocity ( software version 5.5 , perkin elmer , melbourne , australia ) and expressed as per unit volume . plasma cholesterol and triglycerides were determined in duplicate by enzymatic assays ( randox laboratories ltd , uk ) . nonesterified fatty acids ( nefas ) were determined with nefa - c ( asc - acod method , wako pure chemical industries , osaka , japan ) . plasma s100 is used as a marker of cerebrovascular inflammation and was measured using elisa kits according to manufacturers ' instructions ( cosmobio , tokyo , japan ) . plasma s100 was measured with 30 l of plasma sample or standard and incubated in precoated microtitre well plates at 4c overnight . plates were then incubated with biotinylated secondary antibody and streptavidin - hrp for 2 h , each . colour generated with substrate and optical density determined at 492 nm . after adjusting for sample dilution , final concentrations of plasma s100 this study utilised n = 6 mice per group and minimum of nine 3d images were captured per mouse for detection of apo b leakage . each 3d image was constructed by stacking of sequential 2d images , therefore generating 324540 two - dimensional images per group . all data was analysed by either parametric or nonparametric one - way analysis of variance to assess the main effects of lf and dha on dietary sfa - induced blood - brain barrier ( bbb ) dysfunction and their two - way interactions . post - hoc comparison of means was done if the associated main effect or interaction was statistically significant within the analysis of variance procedure . we confirm previous studies showing significant ctx > bs > hpf extravasation of apo b lipoproteins in wt mice maintained on an sfa diet for a total of 5 months ( 3 months plus randomization to sfa for an additional 2 months : figures 1 and 2 ) . mice randomized to an lf diet following 3 months of sfa feeding had comparable levels of parenchymal apo b lipoprotein abundance to mice maintained on sfa feeding alone ( figures 1 and 2 ) . however , in mice randomized to the dha - enriched diet following 3 months of sfa feeding , parenchymal apo b abundance was markedly increased ( figures 1 and 2 ) . the cerebrovascular effects of the dha diet occurred commensurate with a 2-fold increase in plasma cholesterol compared to mice maintained on the sfa diet ( table 2 ) . disturbances in bbb integrity and function were supported by the findings of substantially increased plasma s100 in the sfadha mice compared to sfa alone ( figure 3 ) . the protein s100 is commonly used as a surrogate marker of brain - to - blood leakage . the s100 is a cytokine produced exclusively by the astrocytes of the central nervous system . mice maintained on sfa or randomized to the lf consumed on average 3 g / day , whereas consumption of the dha - enriched diet was reduced to 2 g / day . the lower caloric intake of mice on the dha enriched diet resulted in a slower rate of growth following randomization ( table 2 ) . this study was designed to explore if provision of a diet enriched in dha attenuated cerebrovascular dysfunction induced by chronic ingestion of an sfa diet . the primary outcome measure was to determine the abundance of brain parenchymal apo b lipoproteins that transport significant endogenous a. cerebral capillary vessels normally have tightly apposed endothelial cells that ordinarily prevent transport of plasma proteins and macromolecules . the primary finding of this study showed that provision of a pufa diet principally enriched in dha exacerbated brain parenchymal extravasation of apo b lipoproteins that had been initially induced by chronic ingestion of sfa . previous studies exploring the effect on cerebrovascular integrity and function by the sfa and pufa diets described here , as well as an mufa - enriched diet , showed in c57bl/6j mice that only the sfa diet induced parenchymal accumulation of apo b lipoproteins . therefore , the paradoxical effects of the pufa diet are likely to be a consequence of amplification of proinflammatory pathways induced as a consequence of chronic sfa ingestion . consistent with this concept , sfa - fed mice randomized to an lf diet showed similar parenchymal apo b abundance and plasma s100 as mice that were maintained on sfa alone . several studies have provided evidence of a vasoactive role of a , with pathological manifestations prior to a deposition . exogenous administration of a is vasoconstrictive and vessels treated with a show significant endothelial cell damage with changes in the cell membrane , cytoplasm , nucleus , and other organelles . takechi et al . suggested that that chronic ingestion of sfa may increase trl - a secretion and that repeated postprandial excursions may eventually disrupt bbb function . consistent with this possibility , sfas were shown to stimulate enterocytic a abundance and released into the circulation associated with postprandial trl and a similar phenomenon may also occur in liver [ 20 , 35 ] . moreover , diets enriched in sfa reduce high affinity clearance pathways of trl - remnant lipoproteins and this may contribute to increased postprandial lipaemia and plasma a [ 36 , 37 ] . in this study , parenchymal apo b abundance did not correlate with plasma triglyceride concentration . mice fed the dha - enriched diet had comparable triglycerides to the sfa group and plasma triglycerides were greatest in sfa mice randomized to lf . saturated fats often increase plasma nefa concentration compared to low - fat diets , whereas dha generally accelerates trl clearance by facilitating lpl - mediated lipolysis [ 38 , 39 ] . however , in this study , there was no significant increase in net concentration of plasma nefa in mice randomized to the dha diet versus those maintained on sfa alone ( 0.53 0.05 versus 0.42 0.03 nonetheless , a role of fatty acids in modulating cerebrovascular integrity can not be ruled out because fatty acid phenotype may be critically important . human aortic endothelial cells treated with trl and lipoprotein lipase ( lpl ) were highly permeable , whilst cells treated with trl or lpl alone were not . furthermore , lpl - mediated trl lipolysis initiated degradation of the tight junction protein zo-1 and induced an endothelial apoptotic cascade . the most significant lipid effect of randomization to dha following chronic ingestion of sfa in this study was a twofold increase in plasma cholesterol compared to the mice maintained on the sfa diet , or mice randomied to the lf diet . a number of animal and clinical studies have shown that dha - enriched diets can increase plasma cholesterol associated with low- and high - density lipoproteins [ 4143 ] . hypercholesterolemia has been associated with many vasculature abnormalities including endothelial dysfunction , decreased vascular reactivity , and enhanced expression of adhesion molecules [ 44 , 45 ] . cell culture studies suggest several mechanisms by which cholesterol may be pro - inflammatory and some of these appear to be analogous to the effects of dietary sfa . yao and colleagues reported that excess cholesterol causes endoplasmic reticulum and mitochondrial stress that can lead to apoptosis . mitochondrial activity or microsomal processing also results in the production of oxidized lipids that trigger and exacerbate inflammatory pathways . the anti - inflammatory properties of particularly the n3 and n6 fatty acids have been unequivocally demonstrated in many studies . however , the propensity for pufa to oxidize may under some circumstances amplify oxidative stress sequelae . diets enriched in sfa enhance oxidation as a consequence of stimulated mitochondrial function in activated macrophages . dietary sfa diminish the proper function of the cerebrovascular endothelial cells and are thereafter likely to activate astro - glial cells which encompass cerebral capillary vessels . it 's plausible that enhanced interaction of plasma pufa 's in dha - fed mice with activated inflammatory cells may be a primary mechanism by which the effects of sfa are amplified . . showed a dose effect of dietary dha on bbb permeability in mice supplemented with 12% fish oil for 6 months , versus mice fed 3% fish oil . similarly , rats consuming fish oil exhibited increased lipid peroxidation [ 49 , 50 ] and oxidative stress - induced damage of dna in the absence of dietary antioxidants . in vitro , dha and epa enhanced lipid peroxidation and triggered cellular apoptosis [ 52 , 53 ] . chronic ingestion of diets enriched in sfa commonly causes vascular dysfunction , including in capillary vessels of the brain . the effects of sfa could be described as a response - to - injury phenomenon induced by exaggerated exposure to plasma triglyceride , cholesterol , nefa , or harmful inflammatory products of lipid metabolism , such as lipid peroxides . many studies support a role of n3 and n6 fatty acids in the prevention of vascular , based disorders primarily via suppression of inflammatory cascades . less clear however are the benefits of polyunsaturated oils in the presence of profound inflammation , because of the propensity to generate lipid peroxidation products . in an established model of cerebrovascular dysfunction induced by chronic ingestion of an sfa - enriched diet , provision of dha the data suggests that introduction of n3/n6 fatty acids in metabolic conditions that are characterized by heightened systemic inflammation needs to be carefully considered in the context of paradoxical detrimental effects that could occur . | chronic ingestion of saturated fatty acids ( sfas ) was previously shown to compromise blood - brain barrier integrity , leading to brain parenchymal extravasation of apolipoprotein b ( apo b ) lipoproteins enriched in amyloid beta .
in contrast , diets enriched in mono- or polyunsaturated ( pufa ) oils had no detrimental effect . rather , n3 and n6 oils generally confer protection via suppression of inflammation .
this study investigated in wild - type mice if a pufa diet enriched in docosahexanoic acid ( dha ) restored blood - brain barrier integrity and attenuated parenchymal apo b abundance induced by chronic ingestion of sfa .
cerebrovascular leakage of apo b was quantitated utilising immunofluorescent staining .
the plasma concentration of brain - derived s100 was measured as a marker of cerebrovascular inflammation . in mice fed sfa for 3 months ,
provision thereafter of a dha - enriched diet exacerbated parenchymal apo b retention , concomitant with a significant increase in plasma cholesterol .
in contrast , provision of a low - fat diet following chronic sfa feeding had no effect on sfa - induced parenchymal apo b. the findings suggest that in a heightened state of cerebrovascular inflammation , the provision of unsaturated fatty acids may be detrimental , possibly as a consequence of a greater susceptibility for oxidation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
improving informed decision making is essential for supportive end of life care [ 15 ] . cardiopulmonary resuscitation ( cpr ) preferences are the most common end of life discussion but occur infrequently and vary in content [ 1 , 2 ] . patients may not have the basic information needed and the timing for the discussion may be inappropriate [ 68 ] . patient decision support focuses on providing the patient and families with practical information and resources . cpr preferences may also be overlooked or set aside by practitioners because it is a value - sensitive decision or because it is not identified as a high priority discussion [ 1 , 3 , 6 , 9 ] . value - sensitive decisions would benefit from a patient decision aid , where the patient is recognized as an expert in judging his / her own values [ 1013 ] . patients who need to address cpr status would benefit from health care professionals comfortable and familiar with providing patient decision support . cpr status is one of the most important health decisions and requires careful consideration of all alternatives and the consequences . for seriously ill patients , cpr preferences are commonly set aside and communication between the patient , family , and health care team is lacking information and followup . this project took place at the ottawa hospital , acute monitor area ( ama ) unit . this six - bed unit specializes in acute care , managing patients with a variety of complex medical conditions such as chronic obstructive pulmonary disease , congestive heart failure , pneumonia , and multisystem failure disorders . the goal of this project was to implement a publically available patient decision aid for cpr status and to identify any factors which limit or encourage its use . the objectives were to identify nursing perceptions regarding patient decision support before and after using a patient decision aid regarding cpr , clarify any barriers and facilitators influencing the provision of a patient decision aid regarding cpr , and determine whether nursing perceptions of patient decision support can be positively influenced with a brief , theory - based , skill building educational intervention . this pilot project has focused on the efficacy of providing nursing specific patient decision support . a literature review was conducted to identify scholarly english publications pertaining to cardiopulmonary resuscitation preferences , end of life treatment , patient decision support , decision making , and patient decision aids in pubmed , psycinfo , cinahl , proquest nursing and allied health , and the cochrane database of systematic reviews . grey literature searches were also conducted through the registered nurses ' association of ontario ( rnao ) , college of nurses of ontario ( cno ) , and the ottawa hospital research institute ( ohri ) websites . it has been identified by heyland and colleagues through the canadian health care evaluation project ( canhelp ) that better planning for end of life care including enhanced relationships with physicians and improving communication and decision making needs to be addressed in many canadian hospitals . reliable information regarding the patient 's condition , understandable explanations for their situation , and addressing patients psychosocial feelings were also rated as high priorities . the cno practice guideline , guiding decisions about end - of - life care indicates that clear communication between the patient , nurse , and the interprofessional team facilitates implementation of patient 's wishes regarding end of life treatment . it is evidenced that a comprehensive and consistent way to address cpr status for seriously ill patients should be established and facilitated in the canadian hospitals . it has been determined that seriously ill patients have poor knowledge about what cpr entails and their role in the decision making process regarding their cpr status [ 6 , 15 ] . participants in any decision may not have all the necessary information to make an informed choice and the timing of the discussion may be inappropriate [ 6 , 8 ] . cpr in particular is a sensitive subject in which all involved in the discussion can appraise differently , even the health care team . the literature on patient decision support has increased a great deal since o'connor and colleagues published their work in 1998 . patients want to be educated about their treatments and have an autonomous role in their care [ 5 , 16 ] . there is a stress on the importance of knowing options and being able to provide that information to patients [ 16 , 17 ] . nurses have a unique relationship with patients ; they can provide valuable support when they are faced with difficult decisions . decisional conflict means that there is uncertainty about which course of action to take [ 10 , 18 ] . many issues contribute to decisional conflict and patients are likely to experience uncertainty to some degree when a decision is difficult to weigh . when one needs to consider risk , loss , or a challenge to their personal values conflict can arise . improving informed decision making is essential for supportive end of life care where the patient 's goals of care are clear and communicated , thus reducing uncertainty [ 1 , 35 , 20 ] . patient decision aids reduce uncertainty , improve knowledge , generate realistic expectations , and clarify personal values . these are evidence - based tools that can include outcome statistics and patient experiences for a variety of disease specific issues . they help people in making difficult decisions that are consistent with their personal values [ 12 , 22 ] . however , shared decision making has not been embraced by all health professionals and barriers have been identified which limit the use of patient decision aids . an evaluation of nurses ' perceptions with the use of a cpr patient decision aid can clarify issues with its use and can lead to sustainable utilization of the aid [ 13 , 24 , 25 ] . the ottawa decision support framework odsf ( 1998 ) developed by annette o'connor and this concrete , midrange theory focuses on decisional needs , decision quality , and decision support . it can guide gaining decision support skills through a practical and structured approach [ 10 , 18 , 26 ] . it uses a three - step process to assess client and practitioner determinants of decisions to identify decision support needs , provide decision support tailored to client needs , and evaluate the decision making process and outcomes . the theoretical underpinnings of the odsf include decision theories in economics , psychology , social psychology , decisional conflict , and social support [ 32 , 33 ] . the main assumption of the odsf is that patients will likely select the choice that they believe is their best alternative which aligns with their personal values [ 10 , 26 ] . access to all the necessary resources to realize their choice through clear information when the issues are discussed is also a part of the main assumption [ 10 , 26 ] . personal ( patient ) and practitioner characteristics influence the decision making process as well , but knowledge is a key . providing information for patient options include specific information on benefits and harms , clarification of values associated with each option , ways to manage the views or pressures of others involved in the decision making process , and skills on implementing decisions . decision aids clarify values and address unmet decisional needs or conflict by asking individuals to identify personal importance of issues and evaluate each risk and benefit that influences their decision [ 18 , 34 ] . specifically , patient decision aids need to include the following elements : ( 1 ) information tailored to the patients health condition , ( 2 ) a value clarification exercise , ( 3 ) examples from other patients in similar circumstances , ( 4 ) guidance toward shared decision making , and ( 5 ) a medium such as a paper tool or interactive computer guide to present the information [ 12 , 22 ] . patient decision aids can guide tailored decision support which focuses on patient 's needs . decision support is provided until decisional conflict is resolved and a quality decision is reached . then aiding implementation and monitoring of the decision occur [ 4 , 10 ] . during the evaluation stage of the odsf , an understanding of the quality of decision making and outcomes informed decisions , ones that are consistent with personal values and that are determined by the patient to be the best alternative , are the result [ 10 , 26 ] . in theory , the patient completing this process as intended will lead to overall satisfaction with their choice , quality of life , and adherence with their decision because it is informed by their values and resources [ 4 , 34 ] . quality decisions are informed by the best available evidence and are based on the values of the patient [ 22 , 35 ] . specifically , the odsf guided this project to address unmet decisional needs or decisional conflict where uncertainty regarding the best choice for cpr status was identified in seriously ill patients . realistic expectations were discussed , evidenced - based information was reviewed , support and resources were appraised , and patient values were considered [ 5 , 10 ] . appraising and articulating a patient 's cpr wishes through clear communication and implementation are congruent with this framework . the criteria involved in the odsf are appropriate to the established project goal and objectives and thus are a straightforward justification for the choice of framework used . through the provision of decision support using a cpr decision aid in combination with decision coaching and counselling , the intervention design involved three steps including ( 1 ) conducting a pretest , ( 2 ) educating the nurses on patient decision support and the cpr decision aid , and ( 3 ) conducting a posttest . it was identified during discussions with nurses who work in the ama and their nurse educator ( the project advisor ) that frequently a patient 's cpr status is not addressed in a timely manner . it was repeatedly suggested that an improvement needs to be made to address the patient 's information and communication needs regarding cpr status . the discussions lead to an intervention focused on influencing nursing knowledge of patient decision support , uptake of a cpr decision aid , and identifying facilitators and barriers to its use [ 13 , 23 , 26 , 36 , 37 ] . graham and colleagues found that most health care practitioners are willing to use patient decision aids , given that adequate education and support are provided . all registered nurses who work in the ama unit were approached to participate in the education session . due to time constraints and that there were other quality improvement initiatives being implemented concurrently , it was decided that only a brief and basic education session would be offered . the education session consisted of an introduction to why the project was being implemented , what patient decision support is , and an overview of the cpr patient decision aid . taking approximately 510 minutes , nurses were guided individually or in small groups through part one of the ottawa decision support tutorial , odst , and the decision support aid . after having received the education , the nurses were requested to provide patient decision support for cpr preference using the patient decision aid based on clinical opportunities and appropriateness [ 17 , 26 , 37 ] . basic knowledge regarding patient decision support is needed to work effectively with patient decision aids [ 13 , 23 ] . with background knowledge of patient decision support , the participants needed to identify using their clinical judgment if a patient would benefit from the cpr decision aid . promotion of the patient decision aid was accomplished by going to the ama unit frequently to check on uptake and being available to answer questions . two posters were also strategically placed on the unit , acting as a reminder . each ottawa hospital form for code status was affixed with the cpr decision aid to prompt each nurse to its use . nurses were advised that if a cpr decision aid was initiated and/or completed they were to write in the interprofessional progress notes in the patient 's medical record of this . it was also asked that this information should be communicated to other team members in the patient 's daily care plan . both qualitative and quantitative measures were used to collect information . before and after intervention questionnaires were the primary means of information collection . consequently , the questionnaires developed were influenced by a study conducted by stacey and colleagues to determine factors influencing decision support by call center nurses . for this project , the number of questions was reduced due to the project scope and objectives and was modified to fit the clinical setting . the questionnaire 's design reflects the current literature on health care professionals ' perceptions of patient decision support and decision aids [ 12 , 23 ] . the questionnaires were designed to be clear and concise using a five - point likert scale to encourage the participation in attaining data . the questionnaires also have a section to generate nurses ' views using an open - ended question format [ 40 , 41 ] . questionnaires were used because of their ability to gather data easily and for their capacity to examine notable differences in responses after the initiated intervention [ 42 , 43 ] . specifically responses were grouped into one of two categories , facilitators or barriers , and were grouped after each batch of questionnaires was received . qualitative reports were used to gather data on the impacts on practice and participant 's views on the project which may not be captured with the questionnaires . open - ended questions were directed to the ama nurses as appropriate , such as what do you think of patient decision support ? and what has been your experience with patient decision support ? questionnaires were given to all ama nurses who signed consent and agreed to participate in the project immediately before each education session . all nurses had an average of five weeks or more to use the patient decision aid . all participants who agreed to complete the post questionnaire were entered into a draw for two gift baskets . descriptive statistic methods were used to analyze questionnaire responses and content analysis was used in reviewing the qualitative reports . there are currently 26 nurses who are trained to work in the ama . of those nurses , 3 were on maternity leave , 2 declined to participate and 21 agreed to take part in the educational session and before intervention questionnaire ( n = 21 ) . the age range of participants was 2552 years and the average age of participants was 37.8 years . not all nurses who initially agreed to take part in the project continued their participation . sixteen agreed to participate in the after intervention questionnaire ( n = 16/21 ) . age range was 2752 years , average age was 37.8 years , 19% were male , and the average amount of nursing experience was 11.3 years . to participate in the after intervention questionnaire participants were asked to rate how strongly they agree or disagree with certain statements . the results indicate that most respondents agree or strongly agree that using a patient decision aid would be beneficial to the patient and that more education should be directed toward nurses to provide decision support . the results were negatively skewed when asked if they felt confident in providing patient decision support . most nurses responded that they agree or strongly agree that decision aids for cpr was / is useful . the following points were recognized in the questionnaire and field note results for facilitators / benefits to patient decision support and aids : a team understanding of the patient condition and status , better communication , a standardized way to present information and a knowledge tool for nurses , supported by the literature , evidenced - based information , clear understanding of what cpr is and the risks / benefits , support for when patient is not able to make their own decision ( family involved ) . a team understanding of the patient condition and status , better communication , a standardized way to present information and a knowledge tool for nurses , supported by the literature , evidenced - based information , clear understanding of what cpr is and the risks / benefits , support for when patient is not able to make their own decision ( family involved ) . the following points were recognized in the questionnaire and field notes results for barriers / limitations to patient decision support and aids : language barriers , cultural difference , not appropriate for all , family conflict , their lack of understanding or misconceptions , available time to discuss with patient and family , patient not emotionally ready for discussions , patient decision aid was too condition specific ; too rigid , patients / families not accepting nursing support on this ( not their role ) . language barriers , cultural difference , not appropriate for all , family conflict , their lack of understanding or misconceptions , available time to discuss with patient and family , patient not emotionally ready for discussions , patient decision aid was too condition specific ; too rigid , patients / families not accepting nursing support on this ( not their role ) . many nurses commented that they had limited opportunities to use the patient decision aid for cpr , but did identify that they used patient decision support for other issues . a few nurses stated that cpr status should be determined on admission to hospital and be completed routinely for all patients . there were varied views regarding evaluating cpr status on admission versus at a time of health crisis . some said it should be addressed for every patient , despite health status , and some indicated that only when death may be imminent it should be discussed . some nurses stated that they did not see this as a part of their role or something that they wish to partake in . others thought that this was completely within the nursing realm and were eager to support patients with making an informed cpr choice . most nurses agreed with the components of a shared decision making model . after reviewing the data collected it was evident that most nurses were willing to use the patient decision aid because they see it as helping the patient make informed , value - based decisions . when nurses feel they have the knowledge and skill to provide decision support they do so because they believe that they are helping the patient toward a better realization of their condition . the education session and patient decision aid intervention did not seem to significantly influence questionnaire scores , but it was observed with qualitative observations that the nurses felt more knowledgeable and confident with providing patient decision support . specific barriers to providing patient decision support were identified as cultural or language influences , time constraints , rigid application , patient 's emotional adversity , and physician preference for this role . these mirror what has been found in the literature [ 13 , 23 , 36 ] . specific facilitators identified included communication enhancement , clear and understandable knowledge base , and the ability to include family in the decision making process . there is a limited amount of literature that describes patient decision support facilitators and even less focus on family involvement . data were collected from self - report and observations , not from a validated tool ; thus obvious sources of bias were present . the information collected was helpful in this specific clinical setting but can not be generalized to others . there were only six weeks where the patient decision aid was implemented and the opportunity for its use did not come readily . most nurses welcomed this intervention but some were obviously stressed at the fact that they were approached to participate as evidenced by their body language and facial expressions . this project may have been better received during a less demanding time for nurse involvement . this project identified that cpr status specifically can be appraised by a nurse to be a difficult topic , too patient specific to use a patient decision aid , or confident that this would be used as a guide to improve patients ' knowledge of options and the provision of support . cpr status is value - sensitive topic , but it is not beyond what normally would be encountered by a practicing nurse . addressing unclear values , information needs , and resources effectively will reduce nursing contributing factors to clouding difficult decisions [ 5 , 11 ] . patient decision aids are designed to be evidenced based and patient focused and are intended to be used as a guide . daily nursing practice should reflect a therapeutic relationship between the patient and nurse toward helping the patient make informed and supported decisions through the provision of patient decision support . based on this quality improvement project , a practice change towards supporting patients to be more educated and involved in their decision making is a priority . since nurses work in close proximity with the patient and their families and spend much time involved in their care , they are the most appropriate professionals to discuss cpr preferences using a shared - decision making model [ 23 , 36 , 44 ] . further education on when to implement a patient decision aid for values sensitive topics would be appropriate . strategically educating certain nurses on patient decision support may create an effective role for its implementation . over time challenging traditional health care roles will allow nurses to support the patient effectively through the provision of patient decision support . challenging the barriers to implementing patient decision support and enhancing the facilitating factors will eventually disclose the benefits of its use . this project identified some of those factors within the acute monitor area at the ottawa hospital . dedication and commitment to supporting patient decision support and the cardiopulmonary resuscitation decision aid will help to support patients facing these difficult situations . | the decision whether to receive cardiopulmonary resuscitation ( cpr ) is a decision in which the personal values of the patient must be considered along with information about the risks and benefits of the treatment .
a decision aid can be used to provide patient decision support to a patient who is seriously ill and needs to consider cpr options .
the goal of this project was to identify the barriers and facilitators to using a cpr decision aid , through evaluating nursing perceptions on providing patient decision support . using a needs assessment , it was determined that implementing a patient decision aid for cpr status in the acute monitor area ( ama ) of the ottawa hospital would be an excellent quality improvement project . the nurses who chose to participate were given an education session regarding patient decision support .
questionnaires were distributed to evaluate their views of patient decision support and decision aids before and after the education session and implementation of the cpr decision aid .
questionnaire results did not indicate a significant change between before or after education session and decision aid implementation .
qualitative reports did indicate that nurses generally have positive attitudes toward patient decision support and decision aids .
the nurses identified specific barriers and facilitators in their commentaries .
this clinically relevant data supports the idea that patient decision support should be integrated into daily nursing practice . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
materials . all reactants and solvents for synthesis were purchased from sigma aldrich and used without further purification . spectroscopic grade ( uvasol ) acetone and tetrahydrofuran ( thf ) were purchased from merck ; ferrocene and triflic acid were purchased from aldrich ; tetrabutylammonium hexafluorophosphate ( tbapf6 ) and phosphazene base ntertbutyln,n,n,n,n,nhexamethylphosphorimidic triamide ( p1tbu ) were purchased from fluka . p1tbu and triflic acid were added in the electrochemical cell or in the cuvette from a concentrated solution ( typically 4 mm ) : p1tbu was dissolved in acetone , whereas triflic acid was dissolved in thf immediately prior to use to avoid solvent polymerization .
synthesis . the unloaded rotaxane [ 1h](pf6)3 , its dumbbellshaped and ring components , and the ru complex [ 2ch3cn](pf6)2 were prepared according to published procedures , with modifications . a complete description of the synthetic methodologies and the characterization data ( mass spectrometry and h and c nmr ) are reported in the supporting information . cyclic voltammetric ( cv ) and differential pulse voltammetric ( dpv ) experiments were carried out at room temperature in arpurged acetone ( uvasol ) with an autolab 30 multipurpose instrument interfaced to a pc . a glassy carbon working electrode , a pt wire counterelectrode , and an ag wire pseudoreference electrode were employed ; ferrocene was present as an internal standard . the concentration of the compounds under examination comprised between 210 and 410
m ; tbapf6 ( 0.04 m ) was the supporting electrolyte . cyclic voltammograms were obtained at sweep rates varying typically from 0.02 to 1 v s ; dpvs were performed with a scan rate of 20 mv s , a pulse height of 75 mv , and a duration of 40 ms . absorption spectra were recorded with a varian cary 50bio , agilent technologies cary 300 , and perkinelmer lambda45 spectrophotometers , on airequilibrated acetone solutions at rt ( 20 c ) , with concentrations ranging from 1.010 to 2.510
m. solutions were examined in 1 cm or 1 mm spectrofluorimetric quartz cells . 20 c ) using a 150 w tungsten halogen lamp equipped with a cutoff filter ( =388 nm ) . further nmr and uv / vis spectra and voltammetric results of switching experiments carried out on both the unloaded and loaded molecular transporters are reported in the supporting information . as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be reorganized for online delivery , but are not copyedited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors . | abstractthe transport of substrates is one of the main tasks of biomolecular machines in living organisms .
we report a synthetic smallmolecule system designed to catch , displace , and release molecular cargo in solution under external control .
the system consists of a bistable rotaxane that behaves as an acid base controlled molecular shuttle , whose ring component bears a tether ending with a nitrile group .
the latter can be coordinated to a ruthenium complex that acts as the load , and dissociated upon irradiation with visible light .
the cargo loading / unloading and ring transfer / return processes are reversible and can be controlled independently .
the robust coordination bond ensures that the cargo remains attached to the device while the transport takes place . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
glioblastoma ( astrocytomas , who grade iv ) is the most aggressive primary brain tumor . with an incidence of 3.5 per 100,000 people per year glioblastomas can either present themselves as primary glioblastomas ( 95% ) , which manifest de novo and lack precursor tumors , or secondary glioblastomas . surgery is the initial intervention when a patient has been diagnosed with a brain tumor . this is needed to obtain a histological diagnosis and reduces the space - occupying effect of the tumor . however , in glioblastoma , surgery is of limited therapeutic value , as complete resection is impossible due to the extensive invasive , and migratory behavior of glioblastoma cells . the understanding of molecular alterations in signaling pathways and the consequent pathology in glioblastoma has greatly increased in the last years due to the availability of new techniques , such as genome - wide sequencing . one of the pathways that are frequently affected in glioblastoma includes channels involved in transport of sodium , potassium , and calcium ions . the present paper provides an overview of the current evidence of the involvement of these ion channels in glioblastoma in terms of gliomagenesis , glioma progression , and their effect on prognosis . because of the progression of lower - grade glioma to glioblastoma , the involvement of ion channels in high - grade glioma is discussed as well . finally , the application of these insights is discussed in the light of future prospects for experimental and clinical practice . a survey of the coding sequence of 20,661 genes in glioblastoma genomes has implicated many new gene alterations . of the 555 genes involved in potassium , sodium , chloride , calcium and other ion transport , 55 mutations were detected to affect 90% of the glioblastoma samples studied . ion channels are thought to facilitate progression through cell cycle checkpoints and thereby are required for cell proliferation . for example , progression through the g1/s checkpoint is correlated with increased potassium k channel activity and momentary hyperpolarization . to illustrate this , iberiotoxin , a pharmacological inhibitor of big conductance k channels , arrests glioma cells in s phase of the cell cycle . on the other hand , transient depolarization facilitated by cl channels it is for these reasons that uncontrolled ion channel activity can contribute to oncogenesis . as stated before , the prognosis of glioblastoma is abysmal due to its invasive migration , which renders surgical resection ineffective . they influence shape and volume of cancer cells by affecting ion and water transport over the plasma membrane . ion channels thereby facilitate invasive migration through the sinuous extracellular space of brain tissue [ 813 ] ( figure 1 ) . in addition , ion channels may be functionally involved in proliferation [ 7 , 14 , 15 ] . it is for these reasons that ion channels may contribute to the malignant behavior of glioblastoma cells . ca - activated k channels facilitate outwardly rectifying potassium currents and respond to ca concentrations . increases in the intracellular [ ca ] shift the voltage dependence of ca - activated k channels to more negative potentials . one of these channels , big conductance k channels or bk channels , is widely expressed in excitable and non - excitable cells . specific overexpression of bk channels has been observed in biopsies of patients with malignant gliomas , compared with nonmalignant human cortical tissues . lastly , bk currents in glioma cells are more sensitive to intracellular [ ca ] compared to bk channels in healthy glial cells [ 17 , 18 ] . bk channels can express a variety of electrophysiological properties , which is due to alternative splicing of their -subunits . the increased sensitivity to intracellular [ ca ] is found in a novel splice isoform of hslo , the gene that encodes the -subunits . in addition , glioma most likely only expresses this new isoform , as the classical bk channel has not been found in gliomas yet . these findings led to the term glioma bk ( gbk ) channel ( figure 1 ) . gbk channels have been suggested as a candidate channel for providing the electrochemical driving force for ion movement needed for the release of cytoplasmic water and cell shrinkage which in turn facilitates the extensive migrating behavior of glioblastoma cells . first of all , the effect of menthol was studied , an agonist of transient receptor potential melastatin 8 ( tprm8 ) ion channels , which increases intracellular [ ca ] , which in turn activates gbk channels . in addition , administration of paxilline and tetraethylammonium , both gbk channel inhibitors , inhibited migration [ 11 , 12 ] . these findings make a role of gbk channels in the migration of glioblastoma cells probable . however , the effect of gbk channel knockdown has yet to be investigated , leaving room for doubt . in contrast to the better studied role that gbk channels have in glioblastoma cell invasive migration , there is discussion whether or not gbk channels contribute to proliferation . glioblastoma cells were exposed to pharmacological inhibitors of gbk channels , such as iberiotoxin , paxilline , tetraethylammonium , and penitrem a. after 3 to 5 days , growth inhibition and even tumor shrinkage were observed in vitro [ 7 , 14 , 15 ] . in contrast , more recent literature contradicts these findings and suggests that gbk channels are not required for proliferation or even have antitumorigenic properties . it has been found that pharmacological inhibitors suppress glioblastoma cell growth at concentrations far higher than concentrations that were sufficient to inhibit gbk channel activity . low concentrations that were sufficient to inhibit these channels did not affect glioblastoma cell growth in vitro . in addition , downregulation of gbk channels using gene - specific sirnas reduced k current densities , but caused no changes in proliferation . inositol 1,4,5-triphosphate receptors ( ip3rs ) may provide ca for gbk channels ( figure 1 ) . these receptors are localized close to and are linked with gbk channels in dedicated plasma membrane domains called lipid rafts . disruption of these lipid rafts with methyl--cyclodextrin disturbs the connection between gbk channels and ca . this disturbance was restored by inclusion of ca in the pipette solution during the whole cell patch - clamp experiments . this suggests that the disturbance was not caused by destruction or calcium desensitization of the gbk channels . glioma cells both in vitro and in situ are characterized by depolarized resting membrane potentials of about 20 to 40 mv . this contrasts the very negative resting membrane ( 80 to 90 mv ) and large inwardly rectifying k currents that characterize normal glial cells . these findings have led to the assumption that glioma cells express a decreased density of inwardly rectifying k channels ( kir ) compared to normal brain tissue . however , western blot analysis of d54 glioblastoma cell lines showed only slightly lowered expression of kir2.1 , normal expression of kir4.1 , and increased expression of kir2.3 and kir3.1 as compared to normal astrocytes , while electrophysiological recording found no kir current . immunostaining of kir2.3 and kir4.1 predominantly labeled the nucleus of glioblastoma cells ( figure 1 ) , while expression in normal astrocytes was diffuse over the plasma membrane . the intracellular localization of kir channels may explain why glioblastoma cells express a depolarized resting membrane potential and decreased inwardly rectifying k current . kir channels in glial cells are specifically known for two functions : buffering of extracellular k and establishment of a very negative resting potential . glial cells perform k uptake from the extracellular space and redistribute k ions toward areas where the extracellular [ k ] is lower . this k buffering by glial cells is essential for neuronal homeostasis , as elevated extracellular [ k ] would depolarize neurons , preventing them from firing action potentials . kir channels in healthy glial cells seem to be fitted very well for this task , as they have a large open probability at resting potential . this means that at resting potential , a relatively high number of kir channels are open . in addition , with increasing extracellular [ k ] their conductance increases as well , which makes them perfectly suited for the task of correcting an excess of k in the extracellular space . mislocalization of kir channels in glioblastoma cells ( figure 1 ) renders these cells insufficient for these tasks , resulting in accumulation of k in the extracellular space . this accumulation occurs in concurrence with epileptic seizures , although the underlying mechanism is not entirely clear . peritumoral epileptic seizures are often seen in glioblastoma patients , perhaps facilitated by mislocalization of kir channels . on the other hand , it is likely that very few to no neurons survive around glioblastoma cells due to their invasive behavior . these arguments , supported by the excitotoxic properties of high glutamate concentrations to neurons , render high glutamate release a more logical suspect of causing epileptical seizures than high [ k ] in the extracellular space . on the other hand , mislocalized kir channels can contribute indirectly to epileptic seizures as they fail in their function of establishing a very negative resting potential . at the depolarized resting potentials of 20 to 40 mv that characterize glioma cells , the na gradient across the plasma membrane is diminished . as a consequence , na - dependent glutamate transporters become inactive , increasing the extracellular glutamate concentration and thereby possibly causing epileptic seizures . other candidate channels possibly responsible for the depolarized resting membrane potential in glioblastoma cells are the ether go - go 1 ( eag1 ) and ether go - go related 1 ( erg1 ) channels . depolarized resting membrane potential allows large hyperpolarizations , which provide a driving force for ca entry . ca is necessary for cell - cycle progression . in this way , eag1 and erg1 channels can contribute to gliomagenesis . several studies have described expression levels of heag1 and herg1 in glioblastoma , which encodes eag1 and erg1 channels , respectively . however , the results are contradictory . patt et al . reported low expression of heag1 and herg1 in 5 glioblastoma samples compared to healthy brain tissue . in contrast , masi et al . found elevated expression of herg1 in 26 glioblastoma samples , supporting the hypothesis above . the observation by masi et al . is supported by other literature , reporting increased erg1 mrna expression , elevated protein levels and high densities of erg1 channels in other tumors , such as colorectal cancer , endometrial adenocarcinoma , and myeloid leukemia . erg1 activity has also been reported to be correlated with induction of vascular endothelial growth factor ( vegf ) secretion , thereby contributing to angiogenesis . besides the gbk channel discussed earlier , the clc-3 chloride channel is another important candidate channel to facilitate migrating behavior of glioblastoma cells . clc-3 channel expression was , together with that of clc-2 and clc-5 , indeed high in glioblastoma cell lines and biopsy tissue compared to healthy glial cells . whole cell patch - clamp recordings in combination with channel - specific antisense oligonucleotides showed that clc-3 channels facilitated outwardly rectifying current . on the other hand , clc-2 channels facilitated inwardly rectifying currents . as a result of the relative overexpression of clc-3 as compared to clc-2 , the outwardly rectifying current may prevail over the inwardly rectifying current . as a consequence the glioblastoma cell depolarizes , which is needed to pass the g2/m checkpoint in the cell cycle . in addition , the overexpression of both channels equips glioblastoma cells with an improved ability to transport cl . this may facilitate rapid changes in cell size and shape as glioblastoma cells invade through sinuous extracellular brain spaces . inhibition of clc-3 channels using chlorotoxin indeed markedly but not completely inhibited glioblastoma cell invasion in vitro . the same effect was accomplished using clc-3 sirna knockdown . in addition , the nonspecific clc - blocker 5-nitro-2-(3-phenylpropylamino ) benzoic acid ( nppb ) completely inhibited glioblastoma cell invasion . limitations of this study include the possibility that the glioblastoma cell was overdosed with nppb and invasion was stopped by cytotoxic levels of nppb . secondly , nppb has also been reported to be a ca - activated k - channel inhibitor . clc-3 is regulated through phosphorylation via ca / calmodulin - dependent protein kinase ii ( camkii ) . camkii was infused intracellularly to d54 glioblastoma cells via a patch - clamp pipette , increasing cl currents 3-fold . in addition , administration of autocamtide-2 , a camkii - specific inhibitor , inhibited this current . to confirm the relation between clc-3 and camkii , clc-3 was shown to be knocked down after camkii modulation of cl currents interestingly , inhibition of camkii in clc-3-expressing cells reduced glioblastoma cell invasion to the same extent as direct inhibition of clc-3 . these findings suggest that camkii is a molecular link between intracellular [ ca ] changes and clc-3 conductance required for cell movement during invasive migration in glioblastoma . oscillatory changes in intracellular [ ca ] that correlate with cell invasion and migration have been observed . it has been hypothesized that these changes in intracellular [ ca ] activate clc-3 channels through camkii . glioblastoma cells express ca permeable alpha - amino-3-hydroxy-5-methyl-4-isoxazolepropionate ( ampa ) glutamate receptors ( figure 1 ) . these glutamate receptors have become ca permeable due to the lack of the glur2 subunit as they have been assembled entirely of glur1 and/or glur4 subunits . ampa receptors containing glur2 subunits show little ca permeability , while those lacking glur2 subunits exhibit high ca permeability due to a deformed pore with an aberrant size and polarity . adenovirus - mediated transfer of the glur2 cdna decreased intracellular [ ca ] , inhibited cell migration and induced apoptosis . however , overexpression of ca permeable ampa receptors increased migration and proliferation of glioblastoma cells in vitro . these findings implicate ca - permeable ampa receptors in proliferation , migration and invasion of glioblastoma . it can be hypothesized that this is due to increased intracellular [ ca ] , which in turn facilitates increased activity of gbk and clc-3 channels . the same theory applies to a study in which inhibition of ip3r subtype 3 ( ip3r3 ) was achieved using caffeine . in addition , an increase of mean survival was observed after caffeine was administered to a mouse xenograft model of glioblastoma . this is approximately the same concentration in people that drink two to five cups of coffee a day . . it would be interesting to investigate whether large cohort studies can associate coffee consumption with a lower incidence of glioblastoma or prolonged survival . however , such information is not available yet . with a yearly glioblastoma incidence of 3.5 per 100,000 people , study sizes the effect of caffeine on the survival of glioblastoma mouse models is interesting as caffeine is regarded as not classifiable as to its carcinogenicity to humans by the who , meaning that there is contradictory evidence about its carcinogenic hazard . the ca - permeable transient receptor potential canonical channel protein 6 ( trpc6 ) has been implicated in glioma proliferation . trpc6 is overexpressed in human glioma cells , and inhibition suppressed intracellular [ ca ] and cell growth and induced cell cycle arrest at the g2/m phase . in mouse models with xenografted human tumors , inhibition of trpc6 reduced tumor volume and increased mean survival . in contrast to mutations found in potassium and calcium ion channels , sodium channel mutations correlated with shorter survival in a univariate analysis . the authors reported that all samples with idh1 mutations did not have any sodium channel mutations . . this may be due to the small sample size of the study ( 21 patients ) . mutations in idh1 have been identified to be associated with a specific subgroup of glioblastoma patients who are younger and have a prolonged survival [ 4 , 40 ] . after correction for idh1 , the difference in survival between patients with mutated and unmutated sodium channels dropped to nonsignificant levels . further research is needed to investigate the association between mutations in idh1 and sodium channels and whether the effect of sodium channel mutations on survival is independent of idh1 mutation status . furthermore , among the patients with mutations in sodium channels , the mutations were scattered over the different genes . all 14 sodium channel genes were mutated only once among the 21 patients except for scn9a , which was mutated twice . in addition , of the 12 patients with sodium channel mutations , only 2 had mutations in more than one gene . this is supported by the fact that of the 14 studied genes , 12 genes were from the scn or slc subset classes with 5 and 7 genes , respectively . a similar scattering among the studied genes and clustering in gene families was observed in potassium and calcium channel mutation analyses . these findings are supported by the fact that the antiproliferative effect in cancer of cardiac glycosides is well known [ 41 , 42 ] . the underlying mechanism of these side effects has not been clarified yet , although inhibition of sodium channels in brain tissue could be the cause of this . another study observed an inward , amiloride - sensitive na current in glioblastoma cell lines and tumor samples . currently , brain na channels ( bnacs ) are the only amiloride - sensitive na channels identified in the brain . finally , the effect of psalmotoxin 1 , an inhibitor of cation currents mediated by acid - sensing ion channels , was studied using the whole - cell patch - clamp technique . this toxin inhibited na currents in glioblastoma cell lines and human glioblastoma samples , but not in normal human astrocytes . since this effect can only be measured using electrophysiological experiments , the diagnostic value seems low . however , if the na current facilitated by acid - sensing ion channels proves essential for glioblastoma cells in vivo , inhibition of psalmotoxin may serve as a possible future therapy . given the important role that gbk and clc-3 channels are thought to have in glioma invasion and migration , these channels may render a promising therapeutic target to render glioblastoma less aggressive . however , even if in vivo inhibition of gbk and clc-3 channels can inhibit glioblastoma invasion and migration , these future therapies probably have to be administered at an early stage in order to make a difference in the treatability by resection and radiotherapy . taken the central role of intracellular [ ca ] in clc-3 and gbk channel activity into account , influencing glioblastoma ca homeostasis may be a target of future therapies . this can be accomplished by inhibition of ca - permeable ampa receptors , for example by adenovirus - mediated transfer of glur2 cdna . however , the carcinogenic hazard of caffeine is not clear yet . on the other hand , ca coupling to clc-3 and gbk channels can be disturbed by inhibiting camkii or lipid rafts , respectively . in addition , inhibition of trpc6 has shown promising results both in vitro and in vivo in mouse models . the finding that glioma cells ' depolarized resting membrane potential and their inability to maintain k , na and glutamate homeostasis are caused by mislocalization of kir channels suggests that these channels function at a crossroads of cellular homeostasis and basic electrophysiological functions in glioma cells . correction of this mislocalization could therefore serve as a possible therapeutic target . however , the underlying mechanism of this mislocalization is currently unknown , making therapy uncertain in the near future . recently , the antiproliferative effect of cardiac glycosides on glioblastoma cell growth in vitro was studied . however , concentrations that provide an anticancer effect are high and induce severe cardiovascular side effects . chemical modification is needed to increase affinity for tumor sodium channels and decrease affinity for cardiac sodium channels . furthermore , it exacerbates radiation - induced cell - cycle perturbation , thereby inducing apoptosis and radiosensitization in glioblastoma cells . these capabilities render it a possible useful therapy to treat glioblastomas , especially combined with radiotherapy or other chemotherapeutic agents . the combination of classical cytotoxic , apoptotic , radiosensitization and antiangiogenic effects with inhibition of gbk channels is promising . furthermore , tetrandrines ' large arsenal of possible therapeutic targets in gliomas may impede to find an optimal dosage . the blood - brain tumor barrier is an important hurdle to overcome in glioblastoma treatment . temozolomide , a chemotherapeutic agent that was discussed earlier , is currently , together with radiotherapy , the golden standard in glioblastoma treatment . however , temozolomide crosses the blood - brain tumor barrier insufficiently to have a significant impact on patient survival . the same accounts for trastuzumab , which may be especially effective in a distinct glioblastoma subgroup ( neural , as discussed by verhaak et al . therefore , both drugs were coinfused with minoxidil sulfate , an atp - sensitive potassium channel ( katp ) activator . in mice , the underlying mechanism is not completely understood , but it involves formation of brain vascular endothelial transcytotic vesicles to facilitate absorption of the drug . currently , most research in the field of ion channels in glioma is conducted on glioma cell lines . however , several experiments have shown that established glioblastoma cell lines resemble glioblastomas in patients very poorly when compared at the level of dna alterations or gene expression profiles . with this in mind , results from experiments conducted with cell lines should always be put into the right context . in vitro studies in human glioblastoma samples or in vivo studies in animal xenograft models remain needed . at this moment , we have increased our understanding of the molecular mechanisms involving ion channels underlying the invasive migration of glioblastoma . however , in contrast to many other forms of cancer and considering the genetic research in glioblastoma , consequences for treatment are lagging behind . under the shadow of the large and extensive research on genetic alterations and its effects on therapy responses in glioblastoma , our current understanding of ion channels in glioblastoma will most probably lead to drugs that can be given concomitantly with chemotherapeutic agents to increase their effectivity , such as the discussed coinfusion with minoxidil sulfate . in addition , the current knowledge of the involvement of bk channels , clc-3 channels and intracellular [ ca ] homeostasis in glioblastoma invasion and migration would justify the first steps in drug development targeting these aspects . | glioblastoma is the most common primary brain tumor with the most dismal prognosis .
it is characterized by extensive invasion , migration , and angiogenesis .
median survival is only 15 months due to this behavior , rendering focal surgical resection ineffective and adequate radiotherapy impossible .
at this moment , several ion channels have been implicated in glioblastoma proliferation , migration , and invasion .
this paper summarizes studies on potassium , sodium , chloride , and calcium channels of glioblastoma .
it provides an up - to - date overview of the literature that could ultimately lead to new therapeutic targets . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
although fluorescein angiography remains fundamental in determining the presence of choroidal neovascularization ( cnv ) , many recent studies include optical coherence tomography ( oct ) to investigate the severity of exudative macular pathologies , to evaluate the possibility of retreatment , and to monitor the response to anti vegf therapy during follow up.13 in recent years the development of high - speed detection techniques ( such as spectral domain [ sd ] oct ) has led to a significant improvement in oct imaging performance , providing more detailed information on intraretinal morphology with respect to the first generation time domain ( td ) oct.49 the aim of this study was to assess the agreement between sd oct and td oct in evaluating the cnv - related alterations in wet age - related macular degeneration ( amd ) . this retrospective observational study was performed on 77 eyes of 77 patients ( 34 men , 43 women , mean age 74.3 9.7 years ) affected by wet amd attending our department between june and december 2009 . all patients signed a written consent to permit the use of the images for this study . in order to qualify for the study , exclusion criteria were other types of cnv and the coexistence of any other macular diseases . all patients underwent oct examination using two oct devices : td oct ( stratus oct 4.0.1 , carl zeiss meditec inc , dublin , ca ) and sd oct ( oct / slo opko/ oti , ophthalmic technologies inc , toronto , canada ) . td oct uses a near - infrared frequency light of 820 nm , with an axial resolution of 10 m and speed of 400 a - scans / sec . the light source of the sd oct / slo oti is a modified super luminescent diode at a wavelength of 840 nm . the speed is set at 28000 a - scan / sec ; every b - scan is composed of 512 a - scans . a single experienced examiner performed the oct examinations with a standard protocol for the two tools on the same day . using the td oct and the sd oct every eye in this study underwent the radial lines acquisition protocol after centering the scans on the fovea . if doubt about the presence or the nature of a lesion aroused , a single radial scan was used by the examiner to move the scan and investigate the lesion itself . the images were then recorded on the oct computer and subsequently observed and analyzed using display intrinsic to td oct and sd oct by two independent experienced examiners unaware of the purpose of the research who evaluated the presence of intraretinal edema ( ire ) , serous pigment epithelium detachment ( ped ) , neurosensory serous retinal detachment ( nsrd ) , epiretinal membrane ( em ) , inner limiting membrane thickening ( ilmt ) , and hard exudate deposition ( he ) . possible disagreement was resolved after discussion , so that investigators agreed on all the images . ped was characterized as a dome - shaped lesion of the retinal pigment epithelium layer . nsrd showed up as a hyporeflective area between the retinal pigment epithelium and all the superior retina layers , and em was consistent with a high reflective line on the inner layer of the retina . ilmt was viewed as a high reflective band between the vitreous and the retinal layers . he was revealed as high reflective round or oval intraretinal lesions . the extent of the match between the two evaluations was quantified by the kappa measure of agreement . ire was detected by td oct in 28 eyes ( 36.3% ) and by sd oct in 60 eyes ( 77.9% ) . ped was discovered by td oct in 44 eyes ( 57.1% ) and by sd oct in 66 eyes ( 85.7% ) . nsrd was shown by td oct in 30 eyes ( 38.9% ) and by sd oct in 41 eyes ( 53.2% ) . em was evidenced by td oct in 8 eyes ( 10.5% ) and by sd oct in 20 eyes ( 26.3% ) . ilmt was visualized by td oct in 3 eyes ( 3.8% ) and by sd oct in 25 eyes ( 32.4% ) . he was identified by td oct in 5 eyes ( 6.4% ) and by sd oct in 42 eyes ( 54.5% ) . more specifically , the presence of ped : kappa value 0.15 ; presence of nsrd : kappa value 0.61 ; presence of ire : kappa value 0.18 ; presence of em : kappa value 0.41 ; presence of ilmt : kappa value 0.02 ; presence of he : kappa value 0.06 . the recent advent of sd oct has increased the hope to obtain a more reliable tool in an attempt to define the changes in cnv activity5,1014 and , consequently , the possible retreatment.3 also , oct can provide quantitative and qualitative information regarding cnv - related features , and the introduction of sd technology has led to a remarkable improvement in lesion imaging due to improved definition of the scanned images.5,1014 the two generations of oct , td and sd , have been largely investigated in order to evaluate repeatability and reproducibility of the examinations in many macular diseases , but the varying patterns of exudation secondary to amd make oct examination difficult to compare when performed with the same or more instruments . in fact some authors compared td and sd macular thickness measurements findings obtained in different sessions and questioned the repeatability of the results.1518 it has also been demonstrated by giani et al that retinal thickness measurements obtained by various oct devices such as stratus and cirrus ( carl zeiss meditech inc ) , spectralis ( heidelberg engineering inc , heidelberg , germany ) and 3d - oct-1000 ( topcon corporation , tokyo , japan ) are different due to the analysis algorithms used to set retinal inner and outer boundaries.18 nevertheless , eriksson et al recently suggested the use of software for manual correction of foveal position when using cirrus sd oct ( carl zeiss meditech inc ) to reduce the variability of the measurements.19 as a consequence , we decided not to compare the macular thickness findings but to evaluate the presence/ absence of amd - related typical lesions when investigated by different generations of oct . so far , to our knowledge , only sayanagi et al compared the ability to delineate patterns of cnv activity using stratus oct and four different sd oct devices , concluding that all sd oct were statistically superior to delineate ire presence.20 therefore , it is not surprising that our study found that ire was undetected by td oct in 32 patients ( 41% ) . this is of great relevance as ire is considered the key factor in treatment and retreatment decisions,3 and most of the authors assess the lesions persistent activity if intraretinal fluid is present . no other studies investigated the relative sensitivity of td and sd oct in identifying the single lesions typically related to cnv presence , and overall our results reveal a poor agreement . indeed , some concordance between the two instruments can be found only in the identification of nsrd ( kappa value 0.61 ) and em ( kappa value 0.41 ) , but concordance was poor in the evaluation of ire , ped , ilmt , and he , where kappa value was always less than 0.2 . these results may hint that the smaller lesions are more clearly identified by sd oct ( figure 1 ) . in fact sd oct , due to its improved resolution and scan acquisition , enables the smaller structures in all the retinal layers to be visualized , in particular the internal and external limiting membrane , the inner segment / outer segment of the photoreceptors , and in some cases the bruch s membrane.1113 a good match between the two tools has been registered only with respect to nsrd , probably because the fluid between the retinal pigment epithelium and the neuroretina is clearly serous and hyporeflective , and consequently can be easily detectable by both techniques . the moderate and slight agreement in detecting em and ilm thickening , respectively , suggests that sd oct more reliably detects these alterations , because of more sensitivity in visualizing the vitreomacular interface alterations , as already highlighted by some authors.2123 this aspect could lead to better interpret the specific role of vitreomacular adhesions in the development of cnv , which has been postulated to have an active role by some authors24 but , more recently not by others.25 our findings , that evidenced 26% to 32% of eyes presenting with em or ilm , respectively , at sd oct , overall resemble the data reported by mojana et al that included a series of 170 eyes of which 27.8% had vitreomacular adhesion.26 in that study some patients underwent macular peeling and they concluded that tractional forces may antagonize the effect of anti - vegf treatment , and cause pharmacological resistance in a subpopulation of patients . consequently we think the possibility of detecting initial thickening of vitreoretinal interface could also have some prognostic relevance . a surprising assumption of our study is that hard exudates were visible in 54.5% of eyes when investigated by sd oct versus only 6.4% by td oct . this great difference is evidently due to the greater sensitivity of sd technology , but could also lead to misdiagnosis as hyperreflective points could correspond to retinal vessels or punctate hemorrhages not visible by td oct . tomographic characteristics must assist the clinician in proper diagnosis ; this could prove difficult in some circumstances such as the interpretation of small pseudocysts that can masquerade as outer retina tubulation caused by photoreceptors arrangement during late stages of exudative amd.27 it appears evident that better diagnostic capabilities allowed by sd oct require better operator abilities , as the detection of fine morphological aspects expand the spectrum of the corresponding retinal details identification . in conclusion , our findings suggest that sd oct can better disclose a large number of retinal lesions of various types , indicating a clear advantage in the detection of tiny abnormalities of the retinal morphology . the agreement in the evaluation of macular lesions between the two techniques is poor and depends on the lesion considered . sd oct allows better detection of the alterations typically related to cnv such as ire , ped , ilm thickening , and he . | backgroundthe aim of this study was to compare the agreement between spectral domain optical coherence tomography ( sd oct ) and time domain stratus oct ( td oct ) in evaluating macular morphology alterations in wet age - related macular degeneration ( amd).methodsthis retrospective study was performed on 77 eyes of 77 patients with primary or recurring subfoveal choroidal neovascularization secondary to amd .
all patients underwent oct examination using zeiss stratus oct 3 ( carl zeiss meditec inc , dublin , ca ) and opko oti spectral slo / oct ( ophthalmic technologies inc , toronto , canada ) . in all radial line scans , the presence of intraretinal edema ( ire ) , serous pigment epithelium detachment ( sped ) , neurosensory serous retinal detachment ( nsrd ) , epiretinal membrane ( em ) , inner limiting membrane thickening ( ilmt ) , and hard exudates ( he ) were evaluated .
the degree of matching was quantified by kappa measure of agreement.resultsthe percentage distribution of td oct findings versus sd oct findings was : ire 36.3% versus 77.9% , sped 57.1% versus 85.7% , nsrd 38.9% versus 53.2% , em 10.5% versus 26.3% , ilmt 3.8% versus 32.4% , and he 6.4% versus 54.5% .
the agreement was as follows : sped : kappa value 0.15 ; nsrd : kappa value 0.61 ; ire : kappa value 0.18 ; em : kappa value 0.41 ; ilmt : kappa value 0.02 ; he : kappa value 0.06.conclusionthe agreement in the evaluation of macular lesions between the two techniques is poor and depends on the lesion considered .
sd oct allows better detection of the alterations typically related to choroidal neovascularization such as ire , ped , ilm thickening , and he .
consequently its use should be strongly considered in patients with wet amd . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
natural killer ( nk ) cells are derived from bone marrow - derived lymphocytes and belong to the innate immune system . in contrast to t and b cells , activation of nk cells is controlled by germ line - encoded receptors that do not undergo somatic dna recombination and mutation . nk cells can provide early immune defense against virus - infected and transformed cells . upon activation , nk cells eliminate target cells by polarized exocytosis of cytotoxic granules containing perforin , granzymes as well as fas ligand ( 1 ) . they also control immune responses by secretion of cytokines and chemokines including tumor necrosis factor- ( tnf- ) and interferon- ( ifn- ) . nk cells via these effector functions play important roles in innate resistance to viral pathogens , tumor surveillance , shaping adaptive immunity , graft - versus - leukemia activity , antibody - independent natural cytotoxicity and antibodydependent cellular cytotoxicity ( adcc ) against igg - coated target cells . the important role of nk cells in human health has been underscored by a wide spectrum of disease associations with nk cell dysfunction . patients with leukocyte adhesion disorder ( lad ) , a syndrome due to the deficiency of 2 integrin subunit , display attenuated adcc and natural cytotoxicity by nk cells ( 2,3 ) and suffer severe recurrent infections of bacteria , infections of herpes simplex virus ( hsv ) , and impaired immunity ( 4 - 6 ) . nk cells from patients with hypohidrotic ectodermal dysplasia with immune deficiency ( hed - id ) have defective natural cytotoxicity but not adcc ( 6 ) . in nk cells from patients with x - linked lymphoproliferative disease ( xlp ) , activating receptors such as the signaling lymphocyte activation molecule ( slam ) family member 2b4 ( cd244 ) and ntb - a induce inhibitory rather than activating signals as essential signaling adaptor sap is deficient . thus , 2b4 or ntb - a - mediated autologous killing of epstein - barr virus - infected b cells is abolished in xlp patients ( 7,8 ) . recently , nk cells have gained increasing attention and are now being considered as promising therapeutic tools for cancer immunotherapy due to their intrinsic ability to rapidly recognize and kill cancer cells , while sparing normal healthy cells . allogeneic nk cells exhibit potent anti - tumor activities that are beneficial in the setting of hematopoietic stem cell transplantation into patients with acute myeloid leukemia ( 9 ) . moreover , kir - hla - incompatible nk cells were shown to lyse melanoma and renal cell carcinoma cells in vitro ( 10 ) . moreover , administration of rituximab ( anti - cd20 ) to patients with large - cell non - hodgkin 's lymphoma induced nk cell cytotoxicity in vivo via adcc ( 11 ) . despite significant progress made on the role of nk cells as a pivotal sentinel in virus and tumor surveillance , the molecular mechanisms that regulate nk cell responses nk cells possess a combinatorial array of activating and inhibitory receptors instead of a dominant single antigen receptor to sense their target cells . whether nk cells are activated toward target cells or maintain tolerance to self is determined by the signal balance between activating and inhibitory receptors ( 12 - 14 ) . thus , understanding how signals from discrete activating receptors cooperate to control nk cell activation and how signals from inhibitory receptor antagonize such activation may provide strategies for harnessing nk cells in various clinical settings . a large array of nk cell activating receptors that are structurally distinct has been characterized ( 15,16 ) . in contrast to inhibitory receptors that display variegated expression on nk cells , activating receptors are uniformly expressed on most nk cells . furthermore , activating receptors trigger diverse and discrete signaling cascades , whereas inhibitory receptors induce a common signaling mechanism where their cytoplasmic immunoreceptor tyrosine - based inhibition motif ( itim ) recruits the phosphatase src homology 2 domain - containing phosphatase 1 ( shp-1 ) to dephosphorylate signaling molecules in the activation of nk cells ( 17,18 ) . among activating receptors containing immunoreceptor tyrosine - based activation motif ( itam ) or associated with itam - carrying adapters are the low - affinity fc receptor fcriiia ( cd16 ) , natural cytotoxicity receptors ( ncrs ) such as nkp30 ( cd337 ) , nkp44 ( cd336 ) , and nkp46 ( cd335 ) , activating kirs including kir2ds and kir3ds , and cd94/nkg2c ( cd94/159c ) heterodimer ( 16 ) . upon engagement , these itam - associated receptors are tyrosine - phosphorylated by src family kinases , and the phosphorylated itam - bearing subunits recruit syk and zap-70 tyrosine kinases . thereafter , these kinases phosphorylate linker for activation of t cells ( lat ) and non - t - cell activation linker ( ntal ) leading to activation of pi3k , plc-1 , 2 and vav 2 , 3 ( 19 - 23 ) . non - itam receptors include c - type lectin - like family member nkg2d ( cd314 ) , cd2 , 2b4 , cracc ( cd319 ) , ntb - a , and the immunoglobulin - like type i transmembrane glycoprotein dnam-1 ( cd226 ) . upon stimulation , nkg2d associates with the adaptor protein dnax - activating protein of 10 kd ( dap10 ) through its transmembrane region ( 24 ) . the cytoplasmic tail of dap10 carries a tyrosine - based signaling motif ( yinm ) . this yinm , after phosphorylation by src family kinases , recruits either a p85 subunit of pi3k or the small adaptor protein grb2 . both interactions can activate vav1 and plc-2 and thus are essential for the activation of ca mobilization and cytotoxicity toward target cells ( 25 ) . unlike itam - associated receptors , nkg2d signaling is independent of syk , zap70 , lat and ntal ( 26 - 28 ) . slam family receptors including 2b4 , ntb - a , and cracc are also phosphorylated by src family kinases at immunoreceptor tyrosine - based switch motifs ( itsm ) in their cytoplasmic domain ( 29 ) . this itsm , after phosphorylation , recruits small adaptor proteins such as sap , eat-2 , and ert ( 30 - 33 ) . sap then binds src family kinase fyn and this sap - fyn interaction is indispensable for 2b4-mediated nk cell activation ( 34,35 ) . vav1 , plc-2 , and c - cbl are phosphorylated by 2b4 stimulation and implicated in such activation ( 31,36 ) . cytoplasmic tail of dnam-1 can be phosphorylated by src - family kinases and protein kinase c , and recruit actin - binding proteins ( 37,38 ) . although various signaling molecules implicated in nk cell activation have been uncovered , it has been difficult to identify critical molecules essential for nk cell activation because nk cells use diverse kinases , adaptors , and signaling modules depending on the engagement of different activating receptors . however , intersection of signals from discrete activating receptors by a single class of itim - associated inhibitory receptors implies that there exist critical control elements in the signaling pathway of nk cell activation . such examples include plc- and vav proteins that play a non - redundant role in nk cell activation by multiple activating receptors , and their deficiency is manifested by functional defects of nk cells ( 20,39,40 ) . src family kinases that include lck , fyn , src , lyn , yes , and fgr are important for nk cell activation as most of the activating receptors on nk cells are dependent on their activities for activation . however , no single src family kinase is indispensable because their function is highly redundant for nk cell activation ( 41,42 ) . plc- activation that induces ca mobilization from endoplasmic reticulum is critical for exocytosis of lytic granules and cytokine production . although plc-1 and plc-2 are redundant in itam - dependent signaling , nkg2d / dap10 and 2b4 signaling are highly dependent on plc-2 ( 36,40 ) . vav has three isoforms , vav1 , vav2 , and vav3 , and nk cells express all of these isoforms ( 20 ) . vav acts as a guanine nucleotide exchange factor ( gef ) that activates small gtpase proteins of the rho family and as an adaptor protein through c - terminal sh2 and sh3 domains ( 43 - 45 ) . it has an important role in the actin cytoskeleton dynamics for the co - activation receptor clustering and the lytic granule polarization , as well as in the lymphocyte receptor signaling including plc- activation ( 45,46 ) . vav1 is essential for dap10 signaling , and vav2 and vav3 are required for itam - associated receptors ( 20,47,48 ) . thus , the identification of critical signaling molecules that function as essential checkpoints for nk cell activation provides clues for understanding the mechanism of cooperative interplay by multiple co - activation receptors . activation of nk cells is tightly controlled by the requirement for the engagement of multiple co - activation receptors on nk cells upon encounter with target cells ( 16,49 ) . the combined signals from specific pairs of nk cell receptors , such as nkg2d and 2b4 , can operate in synergy to induce potent cytotoxicity toward sensitive target cells ( 16,50 ) , while other combinations can result in different outcomes : no enhancement over each activating signal or simple additive effect . the mechanisms how distinct signals from different co - activation receptors are integrated to achieve proper functional activity are still unclear and difficult to study because each co - activation receptors use distinct signaling modules . among the combinations of activating receptors , nkg2d and 2b4 as well as 2b4 and dnam-1 are able to provide synergistic activation in resting nk cells , whereas nkg2d and dnam-1 do not synergize . even though nk cells are activated by synergistic signals from multiple co - activation receptors , inhibitory signals from a single class of itim - containing receptors , such as kirs and cd94-nkg2a , this suggests that there are central common checkpoints where signals from multiple co - activation receptors are converged and integrated but inhibitory signals intersect . a study with nkg2d and 2b4 synergy advocates such an example of checkpoint and an elaborate mechanism for regulating synergistic activation ( 36 ) . the central role of vav1 in the signaling pathway for nk cell activation is emphasized by its identification as an essential target of shp-1 recruited to mhc class i - specific inhibitory receptors ( 51,52 ) . the vav1 is phosphorylated by the engagement of nkg2d , 2b4 and dnam-1 on nk cells and functions as an essential component in signaling from such activating receptors . synergistic activation of nk cells via nkg2d and 2b4 combination results in synergistic phosphorylation of plc-2 , ca mobilization and cytotoxic degranulation , which are completely dependent on vav1 . signals from single receptor activation can also induce vav1 phosphorylation , but not the subsequent events such as the phosphorylation of plc-2 , ca mobilization , degranulation and cytokine secretion . such dichotomy of nk cell activation can be explained by the finding that single receptor signal is unable to overcome activation threshold shaped by the e3 ubiquitin ligase c - cbl mediating the inhibition of vav1-dependent activation . such threshold can be overcome by the convergence of signals from nkg2d and 2b4 to achieve optimal activation of vav1 ( fig . 1 ) . this mechanism supports the presence of a central checkpoint for nk cell activation where vav1-mediated activation and c - cbl - mediated inhibition compete with each other . consecutive study of synergy between nkg2d and 2b4 revealed another interesting mechanism for synergy ( 53 ) . the phosphorylation of vav1 by nkg2d and 2b4 synergy is equivalent to the sum of the extent of phosphorylation induced by each receptor alone . in contrast , phosphorylation of vav1 was not augmented by inactive receptor combination although each receptor induced vav1 phosphorylation independently . thus , synergy involves the integration of different activation signals for optimal activation of vav1 , but such requires combination of specific receptor pairs , suggesting the presence of an upstream regulatory element to control vav1 activation . the adaptor proteins sh2 domain - containing leukocyte phosphoprotein of 76 kd ( slp-76 ) and lat are known to contribute to vav1 signaling and are essential components of forming signaling complexes in t cells ( 54,55 ) . furthermore , the activation of plc- , which is required for synergistic activation of nk cells ( 36 ) , is dependent on both slp-76 and lat in t cells ( 56 - 58 ) . in nk cells , the synergistic signaling pathway induced by co - engagement of nkg2d and 2b4 is largely dependent on slp-76 , but not lat . signal from nkg2d induces preferential phosphorylation at tyrosine ( tyr)128 of slp-76 , whereas signal from 2b4 induces phosphorylation of slp-76 at tyr113 ( fig . both tyrosine phosphorylations at tyr113 and tyr128 of slp-76 are required for the synergistic activation of nk cells ( 53 ) . the slp-76 phosphorylation in nk cells is differentially regulated compared to tcr signaling in t cells because the single tcr engagement is sufficient for phosphorylation of both tyrosine residues in slp-76 ( 54 ) . moreover , complementary phosphorylation of slp-76 at n - terminal tyrosine residues is a property of synergizing receptors that induce natural cytotoxicity because the engagement of the fc receptor cd16 also induces slp-76 phosphorylation at both tyrosines . selective phosphorylation of slp-76 at tyr113 or tyr128 each enabled the binding of slp-76 to vav1 to promote vav1 phosphorylation . thus , slp-76 may serve to integrate signals from synergizing co - activation receptors by recruiting vav1 to its phosphorylated tyrosine residues . this suggests that permissive activation of nk cells is kept in check by the requirement for the complementary phosphorylation of slp-76 during synergy among receptors that stimulate natural cytotoxicity . nk cell activation upon encounter with target cells is a result from dynamic process of signaling cascades triggered by combination of multiple receptors on nk cells . thus , diverse mechanisms may control each step of nk cell activation depending on the signaling pathways originated from not only a single receptor but also a cooperation of co - activation receptors . in this review , the requirement for complementary phosphorylation of slp-76 by synergizing receptors for optimal activation of vav1 and thereby to overcome inhibition by c - cbl is introduced as recently discovered mechanism regulating synergistic activation of nk cells . a challenge for future study is to find different checkpoints and signaling mechanisms that control synergistic activation of nk cells . this information will provide innovative and applicable strategies for exploiting nk cells in clinical immunotherapy . | natural killer ( nk ) cells play a pivotal role in early surveillance against virus infection and cellular transformation , and are also implicated in the control of inflammatory response through their effector functions of direct lysis of target cells and cytokine secretion .
nk cell activation toward target cell is determined by the net balance of signals transmitted from diverse activating and inhibitory receptors .
a distinct feature of nk cell activation is that stimulation of resting nk cells with single activating receptor on its own can not mount natural cytotoxicity . instead
, specific pairs of co - activation receptors are required to unleash nk cell activation via synergy - dependent mechanism . because each co - activation receptor uses distinct signaling modules , nk cell synergy relies on the integration of such disparate signals .
this explains why the study of the mechanism underlying nk cell synergy is important and necessary .
recent studies revealed that nk cell synergy depends on the integration of complementary signals converged at a critical checkpoint element but not on simple amplification of the individual signaling to overcome intrinsic activation threshold .
this review focuses on the signaling events during nk cells activation and recent advances in the study of nk cell synergy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
substantial surgical skills are required to perform an arthroscopic procedure without risking iatrogenic injury of articular cartilage and within the routine time scheduled for the operation [ 16 , 17 , 20 , 23 ] . learning arthroscopic skills takes considerable time and implicates an increased risk of surgical errors during the early stages of the learning curve when operating on patients [ 4 , 17 , 24 ] . the traditional learning model where the trainee is supervised continuously by the surgeon attempts to minimize these surgical errors . however , as the training time for acquiring arthroscopic skills is being reduced [ 8 , 12 ] and demands from society for high - quality healthcare increase , initiatives have been taken to train basic skills away from the operating room [ 8 , 12 ] . training arthroscopic surgical skills preferably is performed with actual instrument handling . the theory that states skilled motor behavior relies on accurate predictive models of our body and the environment we interact with ( eg , instruments ) supports this approach [ 5 , 14 , 28 , 33 , 34 ] . these predictive models are stored in our central nervous system . to do a certain task , a key feature in this theory is that these predictive models are tuned , updated , and learned by providing feedback from our sensory organs ( vision and proprioception ) . traditionally , cadaveric material has been used as a substitute for live patients [ 10 , 20 ] . its importance is evident ; however , disadvantages are the availability of cadaveric material and preparation time . two types of simulators have been introduced to overcome the disadvantages of cadaveric material : anatomic bench models [ 25 , 32 ] and virtual reality systems [ 4 , 15 , 17 , 26 , 35 ] . however , it is unclear if these simulators qualify as suitable training means for arthroscopic skills . we therefore addressed the following questions : ( 1 ) do commercial simulators have construct ( times to perform tasks ) and face validity ( realism ) , and ( 2 ) is the perception of usefulness ( educational value and user - friendliness ) related to level of experience ? on february 18 , 2009 , we performed a systematic search with the google and yahoo ! search engines as these contain the largest set of web pages [ 1 , 7 ] . combinations of search terms were used : arthroscopy , simulator , orthopaedic , models , simulation , and trainer . companies were sent an invitation with the request to provide the simulator for 2 weeks at our institute . two companies agreed to participate : toltech knee arthroscopy simulator ( touch of life technologies , aurora , co , usa ) and insightarthrovr arthroscopy simulator ( gmv , madrid , spain ) . the other companies [ 6 , 9 , 19 , 21 , 25 , 29 , 30 ] refrained for various reasons unrelated to financial issues . the toltech knee arthroscopy simulator ( simulator a ) is a virtual reality simulator for arthroscopic knee surgery with two handles that give haptic feedback ( fig . 1 ) ( appendix 1 ) . the insightarthrovr arthroscopy simulator ( simulator b ) is a virtual reality simulator for arthroscopic knee and shoulder surgery with a multitool that gives haptic feedback ( fig . 2 ) ( appendix 1).fig . 2a photograph shows a participant performing tasks on simulator b. a photograph shows a participant performing tasks on simulator a. a photograph shows a participant performing tasks on simulator b. we recruited 37 participants , including ( 1 ) all staff members practicing arthroscopy routinely and present at the time of testing ( except the main researcher gmmjk ) , ( 2 ) all residents present at the time of testing , and ( 3 ) medical students and researchers of our orthopaedic department . the participants were divided into three groups having different levels of arthroscopic experience : novices who had never performed an arthroscopic procedure , intermediates who had performed up to 59 arthroscopies , and experts who had performed more than 60 arthroscopies . this boundary level of 60 arthroscopies was based on the average opinion of fellowship directors who were asked to estimate the number of operations that should be performed to allow a trainee to perform unsupervised meniscectomies . simulator a was evaluated by 22 participants in april 2009 and simulator b by 22 participants in october 2009 ( fig . subgroups were made on arthroscopic experience at three levels based on the number of arthroscopies performed : novices ( 0 ) , intermediates ( 159 ) , and experts ( > 60 ) . the age in years and the number of attended arthroscopies ( observation ) are expressed as median with range in parentheses . the number of participants who previously had used a simulator ( simulator ) or had experience in playing computer games ( games ) is shown . subgroups were made on arthroscopic experience at three levels based on the number of arthroscopies performed : novices ( 0 ) , intermediates ( 159 ) , and experts ( > 60 ) . the age in years and the number of attended arthroscopies ( observation ) are expressed as median with range in parentheses . the number of participants who previously had used a simulator ( simulator ) or had experience in playing computer games ( games ) is shown . the researcher showed the selection of exercises and performance of the calibration protocol and tasks for the test . the assessment of construct validity ( time to perform a task ) was based on one basic navigation task . as the simulators were unlikely to offer a navigation task that was the same , one navigation task was prescribed that can and could be performed on all simulators for comparison . with the arthroscope placed in the anterolateral portal and the probe in the anteromedial portal , nine anatomic landmarks had to be probed sequentially : medial femoral condyle , medial tibial plateau , posterior horn of the medial meniscus , midsection of the medial meniscus , acl , lateral femoral condyle , lateral tibial plateau , posterior horn of the lateral meniscus , and midsection of the lateral meniscus . the participants were asked to repeat this navigation task up to five times in a limit of 10 minutes . the navigation task time was defined as described previously and determined with a separate video recording of the simulator monitor in which the virtual intraarticular joint is presented . we recorded the median time per experience group for each of five repetitions of the navigation task . face validity ( realism ) , educational value , and user - friendliness were determined by giving the participants a second task in which exercise(s ) had to be performed that were characteristic for that particular simulator and by asking them to fill out a questionnaire afterward . the exercises were selected by the faculty surgeon ( gmmjk ) and the company to be sure that they best represented the capability of the simulator . assistance in performing these exercise(s ) was given only if a participant failed to continue for a period of 2 minutes . the characteristic exercise chosen for simulator a was inspection of the suprapatellar pouch with only the 30 arthroscope . this exercise is set up in three stages : watching an instruction video of the exercise , performing the exercise once guided by example hint - images in a stepwise sequence , and performing the complete exercise once again without guidance . the exercise chosen for simulator b was threefold : microfracture technique to treat a cartilage lesion in the femoral condyle , visual exploration and probing of a superior labrum anterior superior lesion , and placement of three suture anchors repairing a bankart lesion ( shoulder instability ) . 3 ) ; face validity of the outer appearance of the simulator , the intraarticular virtual joint , and the virtual instruments ( table 1 ) ; educational value ; and user - friendliness ( table 2 ) . questions were answered using a 10-point numerical rating scale ( nrs ) ( eg , 0 = completely unrealistic and 10 = completely realistic ) or dichotomous requiring a yes / no answer . a 10-point nrs was chosen as all participants were dutch and this grading system is used at all educational institutions . thus , we expected the grading to be performed based on uniform interpretation of the nrs . some questions featured a not applicable ( n / a ) answer option , which could be used solely by novices , as these questions required prior knowledge of the real - life arthroscopic situation . for the same reason , only the answers from the expert and intermediate groups were used on simulator realism and educational value . only answers from the novice and intermediate groups were used on user-friendliness.table 1questions addressing face validityface validity aspectquestionouter appearancewhat is your opinion of the outer appearance of this simulator?is it clear in which joint you will be operating?is it clear which portals are being used?intraarticular jointhow realistic is the intraarticular anatomy?how realistic is the texture of the structures?how realistic is the color of the structures?how realistic is the size of the structures?how realistic is the size of the intraarticular joint space?how realistic is the arthroscopic image?instrumentshow realistic do the instruments look?how realistic is the motion of your instruments?how realistic does the tissue feel when you are probing?all questions were answered on a 10-point numerical rating scale.table 2questions addressing educational value and user - friendlinessparameterquestioneducational value ithe simulator allows training of joint inspection*the simulator allows training of therapeutic intervention*the simulator allows training of joint irrigation*the variation of exercises offered by the simulator is adequate*difference in required skill level between exercises is adequate*educational value iithe simulator is a good way to prepare for a real - life arthroscopic operation*user - friendliness ihow clear are the instructions to start an exercise on the simulator?how clear is the presentation of your performance by the simulator?is it clear how you can improve your performance?how motivating is the way the results are presented to improve your performance?user - friendliness iii felt the need to read a manual before operating the simulator * * questions requiring a dichotomous yes / no answer ; all other questions were answered on a 10-point numerical rating scale . questions addressing educational value and user - friendliness * questions requiring a dichotomous yes / no answer ; all other questions were answered on a 10-point numerical rating scale . the presence of normal distributions of task times was assessed by kolmogorov - smirnov tests . owing to small sample sizes and skewed distributions , the task times were analyzed nonparametrically . construct validity was determined for each simulator independently by using kruskal - wallis tests to calculate the overall presence of differences in task times between the three experience groups for each of the five task repetitions . the significance level was adjusted for multiple comparisons with the bonferroni - holm procedure ( alpha = 0.05 ) ; when we detect significant differences we performed pair - wise comparisons between the experience groups separately using mann - whitney u tests . the scores of the three separate aspects of face validity of the simulators ( table 1 ) and user - friendliness i ( table 2 ) were expressed as mean summary scores of the corresponding questions . educational value i ( table 2 ) was expressed as a sum score of five dichotomous questions and ranged from 0 to 5 . the mean summary scores ( face validity and user - friendliness i ) were verified for normality by kolmogorov - smirnov tests , expressed as mean and sd , and assessed for differences between both simulators with student s t tests . the ordinal scale of educational value i was presented as medians with ranges and analyzed using a mann - whitney u test . the dichotomous questions ( educational value ii and user - friendliness ii ) expressed as categorical yes / no answers were presented as frequencies and percentages ( % ) and analyzed by chi square tests or fisher s exact test ( in case one or more cells had expected counts less than five ) . the significance level was adjusted for multiple comparisons with the bonferroni - holm procedure ( alpha = 0.05 ) . with the exception of two participants , the novice group completed only the first repetition of the navigation task or none at all on simulator a within the time limit ( fig . the novices were slower ( p = 0.001 ) in completing the first repetition . post hoc analysis showed the navigation task times of the experts ( median , 125 seconds ; range , 68245 seconds ) and the intermediates ( median , 129 seconds ; range , 60311 seconds ) were faster ( p < 0.001 and p = 0.01 , respectively ) than those of the novices ( median , 447 seconds ; range , 181600 seconds ) ( fig . the task times of the intermediates and the experts were similar ( p = 0.93 ) . no differences were observed between the experience groups for the other repetitions . for simulator b , we observed slower task completion of the novices for the second and third repetitions ( p = 0.005 and p = 0.008 , respectively ) . the navigation task times of the first repetition of the experts ( median , 90 seconds ; range , 65177 seconds ) were not faster than those of the novices ( median , 165 seconds ; range , 109605 seconds ) ( p = 0.019 ) and those of the intermediates ( median , 105 seconds ; range , 75204 seconds ) ( p = 0.503 ) ( fig . 4 ) . post hoc comparisons of the second and third repetitions showed faster ( p = 0.001 and p = 0.002 , respectively ) task times of the experts compared with those of the novices ( fig . 4 ) . the task times of the intermediates were not different compared with those of the experts or novices for these repetitions.fig . 4a bthe graphs show the results of the navigation repetitions for ( a ) simulator a and ( b ) simulator b. the results are presented as medians with ranges . construct validity was observed for the first repetition of simulator a and the second and third repetitions of simulator b. the graphs show the results of the navigation repetitions for ( a ) simulator a and ( b ) simulator b. the results are presented as medians with ranges . construct validity was observed for the first repetition of simulator a and the second and third repetitions of simulator b. the mean face validity scores of the outer appearance and simulated intraarticular joint were 7.3 ( sd , 1.4 ) and 6.4 ( sd , 1.4 ) for simulator a and 8.4 ( sd , 0.6 ) and 6.1 ( sd , 0.9 ) for simulator b , respectively . the mean face validity score of the simulated instruments was 4.9 ( sd , 1.5 ) for simulator a and 5.7 ( sd , 1.2 ) for simulator b. thus , the face validity of the simulated instruments was judged barely sufficient for both simulators ( fig . 5 ) . the median sum score for educational value i was 3 ( range , 15 ) for simulator a and 5 ( range , 25 ) for simulator b ( p = 0.009 ) . simulator a was judged suitable for real - life surgery ( educational value ii ) by 10 of 11 participants ( 91% ) , as was simulator b by all 13 participants ( 100% ) ( p = 0.46 ) . the mean score of 8.3 ( sd , 1.0 ) for user - friendliness i of simulator b was greater ( p < 0.001 ) than that for simulator a ( 6.5 [ sd , 1.3 ] ) ( fig . ( p = 0.002 ) respondents felt the need to read the manual ( user - friendliness ii ) before operating simulator a ( 11 of 15 , 73.3% ) than before operating simulator b ( two of 13 , 15.4%).fig . 5a graph shows the results of the normalized sum scores for face validity and user - friendliness i. the values are expressed as means with sds . user - friendliness i is the combined opinion of the intermediates and novices ; the other columns are the combined opinions of the experts and the intermediates . the mean score for user - friendliness i of simulator b was greater ( p < 0.001 ) than that for simulator a. a graph shows the results of the normalized sum scores for face validity and user - friendliness i. the values are expressed as means with sds . user - friendliness i is the combined opinion of the intermediates and novices ; the other columns are the combined opinions of the experts and the intermediates . differences were not observed for any aspect of face validity between the simulators . the mean score for user - friendliness i of simulator b was greater ( p < 0.001 ) than that for simulator a. as arthroscopic simulators gain maturity and become commercially available , it is unclear whether they are suitable for use in training . we therefore addressed the following questions : ( 1 ) do commercial simulators have construct ( times to perform tasks ) and face validity ( realism ) , and ( 2 ) is the perception of usefulness ( educational value and user - friendliness ) related to level of experience ? we note limitations to our study . first is the relatively small number of participants in each experience group , which could have led to nonsignificant results and the skewed distribution of task times . the groups could not be enlarged owing to logistic limitations ; however , care was taken to include all experts and intermediates present at the time of testing to prevent selection bias . other evaluation studies with simulators have experienced similar problems in recruiting participants [ 3 , 17 , 22 , 32 ] . second is the absence of transfer or predictive validation , which was not feasible in the time frame . studies performed with similar arthroscopy simulators [ 9 , 12 ] do show training on these systems decreases the operative learning curve . these findings are in line with the opinion of all participants that training on either simulator will be good preparation before performing real - life arthroscopy . third , our study is limited to two arthroscopic simulators , which were , in principle , not that distinctive as they are both virtual reality systems with haptic feedback devices . if other types of simulators would have been included , such as anatomic bench models , a wider palette of alternatives could have been described and differences would be more pronounced . the choice of this task is in line with tasks evaluated in other studies [ 12 , 17 , 22 , 32 ] and is indicated as an important arthroscopic skill to master before operating in the theater . fifth , only a few tasks were used to determine face validity , educational value , and user - friendliness . these tasks were chosen carefully and reflected the way exercises are built up and feedback on performance is given by each simulator . therefore , we assumed the participants were given a good impression of the learning environment of each simulator . sixth , the choice of expert level was somewhat arbitrary , especially for the novice versus intermediate groups . this could have influenced the demonstration of construct validity as the experience level might have been insufficiently distinctive . 4 ) because the task times were substantially similar for all repetitions between the novices and experts , and similar between intermediates and experts . these findings are comparable to those in the study by srivastava et al . , who used a similar division in experience levels and found no substantial differences between the groups . they speculated the results may be influenced by the fact that experts knew what to expect and novices were very motivated . a more detailed comparison with other studies can not be made as the criteria to qualify as expert , intermediate , or novice differ among studies [ 17 , 26 , 32 ] , or a different acceptable significance level was chosen . it is recommended to set uniform experience levels when performing this type of study . by using the study of oneill et al . , task time was chosen as an outcome measure , as it is widely used and validated in assessing surgical skills learning , it can be measured using all commercially available arthroscopy simulators , and it makes overall objective comparison possible . face validity was observed for both simulators , although there is room for improvement . the presence of tactile feedback in an arthroscopy simulator is considered essential to imitate clinical practice adequately and train safe manipulation [ 22 , 36 ] . intermediates and experts indicated tissue probing was unrealistic on both simulators ( fig . 5 ) . training skills without receiving natural feedback could lead to an offset in the internal models stored in our central nervous system . this might increase errors in the operating room . performing realistic force feedback for cutting or shaving is another challenge to implement in these simulators . the intraarticular joint space of simulator b was considered large . additionally , as both simulators present virtual reality images , they leave an artificial impression . these face validity results are comparable to results of other studies , in which imitation of the real - life situation generally is sufficient , but none is given a perfect score [ 2 , 17 , 18 , 31 , 32 ] . an explanation could be that simulators that do not resemble a human joint are graded more mildly as it is so obvious that they do not resemble reality , whereas simulators that come close to the real - life representation are scrutinized more thoroughly for small deviations . this subjective opinion is supported by issenberg et al . , who identified a top 10 list of most important educational criteria for medical simulators . both simulators fulfill seven of 10 criteria , including the most important ones : give feedback on performance , allow repetitive practice , and allow integration into the curriculum . unfortunately , they do not offer training of precise portal placement , which is another important skill to be mastered before starting to operate on patients . overall , simulator b was considered more user - friendly than simulator a , although simulator a was graded satisfactory ( fig . the feedback given by simulator b resembles the way mainstream computer games do this . for both simulators simulator b offers a larger variety of exercises , and is more user - friendly , whereas simulator a showed a more distinct difference in task time between experts and novices . subsequently , the user interfaces guide the trainees through a calibration protocol , after which each of the simulators guide the trainee through the range of exercises in a self - learning curriculum . simulator a has a dell pc [ dell , round rock , tx , usa ] with a quad core processor and high - end video card , two monitors , and two handles . the left monitor displays a virtual mentor , and the right monitor displays the simulated arthroscopic view ( fig . 1 ) . both handles incorporate haptic feedback ( phantom ; sensable technologies , woburn , ma , usa ) . simulator a provides a complete self - learning curriculum for training of diagnostic knee arthroscopy with 10 assorted meniscal tears that can be inspected and probed . after an exercise , an overall score ( 0%100% ) is provided consisting of a combination of metrics : camera and scope angle , limb flexion , varus / valgus force , position of the tip of the arthroscope or probe , task time , and whether a particular structure has been probed . at the lowest difficulty level , its purchase price is $ 85,000 and comes with an optional annual service agreement of $ 15,000 , which covers hardware and software updates . simulator b has a dell pc with a quad core processor and a high - end video card and software version v.5.0.2 , interchangeable models representing knee and shoulder anatomy , and one monitor with touch screen displays the simulated arthroscopic view or the curriculum ( fig . 2 ) . a simulated 30 arthroscopic camera and multipurpose tool are provided with haptic feedback ( phantom omni ; sensable technologies ) . the multipurpose tool represents graspers , a power shaver , a probe , or a chondropick depending on the exercise . simulator b provides a complete self - learning curriculum that guides the trainee through the tasks to train basic diagnostic and therapeutic skills ( eg , microfracturing or meniscectomy ) in the knee and shoulder : seven meniscal tears and three subacromial and four glenohumeral disorders . after an exercise , simulator b offers a selection of metrics to provide feedback in a graphic presentation : score between 0 and 10 , score related to task completion dependent on the task , task time , covered distance of camera and instrument , roughness of camera and instrument motion , instrument collisions , and covered distance . during the exercise , textual hints are given on how to proceed . its purchase price is $ 91,283 , including the shoulder and knee modules , and comes with an optional annual service agreement of $ 10,945 , which covers hardware and software . | backgroundsome commercial simulators are available for training basic arthroscopic skills .
however , it is unclear if these simulators allow training for their intended purposes and whether the perception of usefulness relates to level of experience.questions/purposeswe addressed the following questions : ( 1 ) do commercial simulators have construct ( times to perform tasks ) and face validity ( realism ) , and ( 2 ) is the perception of usefulness ( educational value and user - friendliness ) related to level of experience?methodswe evaluated two commercially available virtual reality simulators ( simulators a and b ) and recruited 11 and nine novices ( no arthroscopies ) , four and four intermediates ( one to 59 arthroscopies ) , and seven and nine experts ( > 60 arthroscopies ) to test the devices .
to assess construct validity , we recorded the median time per experience group for each of five repetitions of one identical navigation task . to assess face validity , we used a questionnaire to judge up to three simulator characteristic tasks ; the questionnaire asked about the realism , perception of educational value , and perception of user-friendliness.resultswe observed partial construct validity for simulators a and b and considered face validity satisfactory for both simulators for simulating the outer appearance and human joint , but barely satisfactory for the instruments .
simulators a and b had equal educational value according to the participants .
user - friendliness was judged better for simulator b although both were graded satisfactory .
the perception of usefulness did not differ with level of experience.conclusionsour observations suggest training on either simulator is reasonable preparation for real - life arthroscopy , although there is room for improvement for both simulators.clinical relevancethese simulators provide training in surgical skills without compromising patient safety . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the korean public is highly concerned about the risk of occupation cancer as a result of exposure to carcinogens in the workplace . an increase in the incidence of occupational cancer among workers based in industries manufacturing goods such as asbestos textiles , semiconductors , and tires , as well as those working in the refinery / petrochemical sector has raised public concern ( 1,2,3,4 ) . cancer is the most common cause of death in the korean population and because of the costs incurred and the impact it has on the loss of workforce , it is of major concern for employers or policymakers ( 5 ) . occupational cancer is defined as cancer resulting from occupational exposure to carcinogens or an increased risk of cancer incidence during the performance of a specific task ( 6 ) . usually , the evidence indicating if a worker was occupationally exposed to a carcinogen or not is insufficient and the measurement of the past carcinogen exposure level or the cumulative exposure level is very difficult . the general ambiguity regarding past exposure makes the decision for the work - relatedness a controversial subject ( 7 ) . article 34 on the enforcement decree of the industrial accident compensation insurance ( iaci ) act defines the criteria for the recognition of work - related disease . the second is to determine the cumulative exposure level and latent period , which is the period between the first exposure to causative agent and the diagnosis of cancer . occupational lung cancer is covered by 2 acts under korean law . according to the ordinance of the ministry of employment and labor , workers dealing with soil , rocks , or minerals who are exposed to dust that might cause pneumoconiosis and who have confirmed pneumoconiosis by chest radiography ( profusion of 1/0 or greater according to the international labor organization [ ilo ] classification ) can be compensated according to the act on the prevention of pneumoconiosis and protection , etc . the occupational safety and health research institute of the korean occupational safety and health agency and the occupational lung disease institute of the workers ' compensation and welfare service ( comwel ) investigate individual cancer cases to make a scientific decision on the work - relatedness . this process involves thorough occupational history taking , a work environment survey , and a review of epidemiologic literature and medical records . the comwel usually request this epidemiologic investigation for the majority of claims . the criteria determining whether or not an employee is entitled to compensation as a result of occupational cancer are a major issue because the criteria is the only legal standard adapted all processes of compensation for occupational disease from comwel to the administrative court . workers ' compensation and approval rates of individual countries are very closely related to social contexts such as social recognition for the occupational disease , the health insurance system , or the social security system ( 10 ) . owing to the increase in public concern in korea , the opinion that the criteria for occupational cancer should be reviewed and amended on the basis of up - to - date scientific evidence was presented . the aim of this study was to review the history of compensated occupational cancer in korea and to clarify and update the criteria for awarding occupational cancer compensation in korea . this paper will assist clinicians in understanding the issue of occupational cancer for a more informed decision regarding whether compensation should be awarded or not . a review of the published literature was undertaken to determine the strength of the causal association between cancer risks and the workplace environment . literature included data published by the international agency for research on cancer ( iarc ) ( 11,12,13,14,15,16,17,18 ) and related peer - reviewed articles . the occupational cancer lists of international organizations such as the ilo ( 19 ) and the european union ( eu ) and their member countries were also investigated ( 20 ) . an analysis of each individual occupational cancer case awarded compensation in korea between 1992 and 2012 was conducted to decide the validity of including specific causative agents and types of cancer to the criteria list . based on these results , we suggested the list of the carcinogens and its target cancers to include recent amendments of the scope and criteria . the first officially reported case of occupational cancer in korea was a case of mesothelioma at an asbestos thread factory in 1993 . a 56-yr - old non - smoking woman employed at the factory for 18 yr was officially approved by the comwel and was compensated by the iaci ( 21 ) . after the first reported compensation case , between 1992 and 1999 , out of 379 claims for occupational cancer , only 22 cases were confirmed as occupational disease by the occupational safety and health research institute ( table 1 ) ( 22 ) . the 31 lung cancer cases associated with pneumoconiosis reported until 1999 that were compensated according to the pppw act are not included in table 1 , which only included cases to be conduct professional and specific examination for the work - relatedness by occupational physician and occupational hygienist of oshri . however , table 2 included all cases to be decided based on pppw act , the result of special examination for the work - relatedness , or the self process of comwel . from 2000 to 2009 , out of 1933 claims , the comwel approved 253 cases as occupational cancer ( 23 ) . sixty - one of these were compensated according to the pppw act . from january 2010 to october 2012 , out of 544 claims , the comwel approved 266 cases as occupational cancer ( table 2 ) . especially after 2010 , the number of compensated cancers also increased because the social awareness for occupational cancers or carcinogens such as asbestos or benzene improved and the claims from various high risk jobs such as miners , masons , construction workers , painters , welders , and so on , which would be influenced by social issue for the occupational cancer in semiconductor industry or communal claims by metal union . respiratory cancers , especially lung cancer , were the most common cancers compensated for by the iaci . between 2000 and 2009 , occupational cancer types included respiratory ( n=107 ) , lymphohematopoietic ( lhp ) ( n=35 ) , malignant mesothelioma ( n=28 ) , and digestive tract cancer ( n=74 ) ( 23 ) . between january 2010 and october 2012 , occupational cancer types included respiratory ( n=226 ) , lhp ( n=5 ) , malignant mesothelioma ( n=19 ) , and digestive tract cancer ( n=2 ) . cancers originating from digestive tract cancer abruptly decreased after the late 2000s , because hepatocellular carcinoma related to workload or stress in healthy hepatitis b virus carriers were rejected in court , and the specific criteria for recognition of liver disease was amended in 2003 ( 24 ) . between 1999 and 2005 , lung cancer related to asbestos exposure ( 62.3% , 33 out of 53 cases ) and lhp cancer related to benzene ( 84.4% , 43 out of 50 cases ) was the most common cause of occupational cancers ( 5 , 25 , 26 ) . between 2000 and 2009 , construction ( n=15 ) was most common industry among compensated cancers , followed by shipbuilding ( n=11 ) , and other metal product manufacturing ( n=10 ) . the most common occupation among compensated cancers was metal molders , welders , and related trades workers ( n=16 ) , followed by miners , shot firers , stone cutters , and carvers ( n=14 ) ( table 3 ) ( 23 ) . after the early 1990s , the number of claims and compensations has increased , but the origin of cancers awarded compensation is still limited to 2 organs , namely the lung and lhp system . the most probable carcinogens were asbestos ( 45% ) , hexavalent chromium ( 30% ) , and crystalline silica ( 19% ) ( 27 ) . in case of lhp malignancies , the most probable carcinogens were pure benzene ( 27.5% ) , impurity of benzene in a mixture ( 56.9% ) , and ionizing radiation ( 8.0% ) ( 26 ) . with these data in mind , the existing criteria and scope for occupational cancer required amendment with respect to the causative carcinogens and the target cancer type . the prior korean criteria included only 10 agents and were very outdated compared with the ilo occupational disease list or the iarc list of group 1 carcinogens . mesothelioma due to asbestos was included in the occupational disease list in convention 121 in 1980 . on recommendation no . 194 in 2002 , the ilo added 15 carcinogens to the list including asbestos ; benzidine and its salts ; bis - chloromethyl ether ; chromium vi ; coal tars and coal tar pitches ; beta - naphthylamine ; vinyl chloride ; benzene ; toxic nitro and amino derivatives of benzene or its homolog ; ionizing radiation ; tar , pitch , bitumen , mineral oil , anthracene , or related compounds ; coke oven emissions ; nickel ; wood dust ; and other carcinogens . at this time , an association between specific occupational cancers caused by specific carcinogens was not included . in 2010 , arsenic , beryllium , cadmium , erionite , ethylene oxide , and hepatitis b and c viruses were included on the ilo occupational cancer list ( 8) . the iarc reviewed the entire group i carcinogenic agents list between 2006 and 2010 , and 113 agents were included as group i carcinogens . since these agents cover both occupational and environmental exposure , siemiatycki et al . ( 28 ) proposed 28 agents and 12 occupations or industries as definite occupational risk factors and we listed other additional occupational carcinogens updated after the review of iarc . in the european occupational cancer lists including those of austria , belgium , denmark , germany , finland , france , italy , luxemburg , portugal , spain , swiss , and the eu . finland included the fewest agents ( n=17 ) and germany , denmark , and luxemburg included > 40 agents . lung cancer due to chromate , asbestos , or nickel and malignant mesothelioma due to asbestos were included in the list of occupational cancers in all countries . the prior criteria for recognition of occupational cancer according to the enforcement decree of the iaci act included only 11 agents , for example soot , tar , pitch , asphalt , mineral oil , paraffin , vinyl chloride , chrome or its compounds , benzene , asbestos , and hepatitis virus . except for hepatocellular carcinoma due to occupational exposure to hepatitis b or c virus , which was included in the criteria in 2003 , other carcinogens and their target cancers have not ever been amended after since the 1980s ' . table 4 shows the presented agents on the occupational cancer lists of the ilo , and european countries , those suggested by siemiatycki et al . or us based on the iarc list , and the korean criteria of occupational carcinogens before 2013 . originally , cancer caused by soot , tar , pitch , asphalt , mineral oil , or paraffin was incorrectly identified as epithelial cancer , but needed to be amended as skin cancer . in addition , myelodysplastic syndrome is not cancer , but is a hematologic malignancy , and the epidemiologic evidence for larynx cancer caused by chrome exposure was insufficient . vinyl chloride exposure as a cause of human hepatocellular carcinoma had sufficient evidence . in case of ionizing radiation , as a definite cause of cancer was not included in prior criteria , which only included acute radiation injury - related diseases . first , the number of covered agents was smaller than those of the international lists . third , a reconsideration of exposure duration or cumulative exposure level was needed ; however , this was not included in the current amendment because this would require a national consensus across professional review boards considering various situations of exposure in korea . the main points of this amendment were as follows : first , the type and number of carcinogens should match those of international levels , considering the lists of the ilo , eu , and iarc , with the occupational cancer list of the ilo taking first priority . second , the priority order of the list should be decided by the carcinogen exposure possibility in korea . third , the criteria should include matches between specific carcinogens and target cancers , as evidenced by clinical data from the iarc . we , who suggested the list of carcinogens and its target cancers for recent amendment and directly participated in the policy making process of amendments to the scope and criteria , selected 28 agents and 11 industries to extend the criteria of occupational cancer according to the results the previously described review of the occupational cancer list of the ilo , the eu , and the iarc classification , and the exposure possibility in korea to identified risk factors . aflatoxins , 4-aminobiphenyl , arsenics , ultraviolet - emitting tanning devices , benzidine , beryllium , beta - naphthylamine , 1,3-butadiene , cadmium , crystalline silica , diesel engine exhaust , erionite , ethylene oxide , formaldehyde , leather dust , nickel compounds , passive smoking , polyaromatic hydrocarbons ( pahs ) , radon , shale oil , solar radiation , strong inorganic acid , 2,3,7,8-tetrachlorodibenzo - para - dioxin , trichloroethylene , ortho - toluidine , wood dust , anti - cancer drugs or immunosuppressants , and sulfur mustard were included in reviewed list of agents . occupations or industries included the rubber industry , painting magenta production , coal gasification , aluminum production , auramine production , isopropyl alcohol manufacture using strong acids , underground hematite mining , iron and steel founding , coke production , and coal - tar distillation . coal gasification , coke production , and coal - tar distillation were reviewed with respect to pahs . these industries could be matched to causative agents in a korean - based exposure situation . occupational cancer risk of the rubber industry could be explained by exposure to aromatic amines or solvents . the magenta , aluminum , auramine , isopropyl alcohol , or hematite production industries are rare in korea . pahs , crystalline silica , and strong inorganic acid could explain the occupational cancer risks of the iron and steel founding industry . as a result , it was not possible to determine the exposure to passive smoking , solar radiation , ultraviolet - emitting tanning device , and solar radiation between environmental exposure and occupational exposure . in korea , exposure to aflatoxins , sulfur mustard , erionite , shale oil , and 2,3,7,8-tetrachlorodibenzo - para - dioxin is unlikely and was classified as low risk . measuring the exposure level of leather dust , strong inorganic acid mist , pahs , 4-aminobiphenyl , and diesel engine exhaust and trichloroethylene were recently upgraded by the iarc and information concerning exposure measurements , epidemiological evidence , or cases in korea was limited . anti - cancer drugs and immunosuppressant exposure are usually important to patients . in total , 13 agents and 1 occupation among 39 considerable agents and industries were assigned as priority add - ons to the amended scope and criteria specific for korea . we also suggest classifying the system of occupational cancer into an agent- and organ - oriented systems according to the specific criteria for the recognition of occupational diseases according to the enforcement decree of labor standard act ( lsa ) and the enforcement decree of iaci act . therefore , on the basis of the scope of occupational cancers of the lsa , on which all the agents were listed without target cancer , agents were listed with target cancers based on organ oriented system named cancer on the specific criteria of the iaci act . especially , regarding some agents such as benzene , asbestos , or chrome , the considerations related with exposure duration or level persisted unless there were definite evidences . as a result , 14 agents and occupation matched with 12 target cancers were added to the list including x - rays or -rays ; arsenic and its inorganic compounds ; nickel compounds ; cadmium and its compounds ; beryllium and its compounds ; wood dust ; benzidine ; beta - naphthylamine ; crystalline silica ; formaldehyde ; 1,3-butadiene ; radon-222 and its decay ; spray painting ; ethylene oxide . asphalt and paraffin were removed because of the ambiguity of chemical characteristics that could be masked by other agents . the descriptions for some agents were revised to enhance the clarity of the characteristics of the agent ; tar was revised to coal tar , pitch was revised to coal tar pitch , chrome was revised to hexavalent chrome , mineral oil was revised to untreated mineral oil , and hepatitis virus was revised to hepatitis b and c virus . target cancers , especially those related with ionizing radiation , such as cancers of the salivary glands , esophagus , stomach , colon , bone , breast , kidney , thyroid , ovary , nasopharynx , and bladder were incorporated . table 6 presents the scope of occupational cancers according to the enforcement decree of the lsa , july 2013 and the specific criteria for the recognition of occupational diseases according to the enforcement decree of the iaci act , july 2013 . the first officially reported case of occupational cancer in korea was a case of mesothelioma at an asbestos thread factory in 1993 . a 56-yr - old non - smoking woman employed at the factory for 18 yr was officially approved by the comwel and was compensated by the iaci ( 21 ) . after the first reported compensation case , between 1992 and 1999 , out of 379 claims for occupational cancer , only 22 cases were confirmed as occupational disease by the occupational safety and health research institute ( table 1 ) ( 22 ) . the 31 lung cancer cases associated with pneumoconiosis reported until 1999 that were compensated according to the pppw act are not included in table 1 , which only included cases to be conduct professional and specific examination for the work - relatedness by occupational physician and occupational hygienist of oshri . however , table 2 included all cases to be decided based on pppw act , the result of special examination for the work - relatedness , or the self process of comwel . from 2000 to 2009 , out of 1933 claims , the comwel approved 253 cases as occupational cancer ( 23 ) . sixty - one of these were compensated according to the pppw act . from january 2010 to october 2012 , out of 544 claims , the comwel approved 266 cases as occupational cancer ( table 2 ) . especially after 2010 , the number of compensated cancers also increased because the social awareness for occupational cancers or carcinogens such as asbestos or benzene improved and the claims from various high risk jobs such as miners , masons , construction workers , painters , welders , and so on , which would be influenced by social issue for the occupational cancer in semiconductor industry or communal claims by metal union . respiratory cancers , especially lung cancer , were the most common cancers compensated for by the iaci . between 2000 and 2009 , occupational cancer types included respiratory ( n=107 ) , lymphohematopoietic ( lhp ) ( n=35 ) , malignant mesothelioma ( n=28 ) , and digestive tract cancer ( n=74 ) ( 23 ) . between january 2010 and october 2012 , occupational cancer types included respiratory ( n=226 ) , lhp ( n=5 ) , malignant mesothelioma ( n=19 ) , and digestive tract cancer ( n=2 ) . cancers originating from digestive tract cancer abruptly decreased after the late 2000s , because hepatocellular carcinoma related to workload or stress in healthy hepatitis b virus carriers were rejected in court , and the specific criteria for recognition of liver disease was amended in 2003 ( 24 ) . between 1999 and 2005 , lung cancer related to asbestos exposure ( 62.3% , 33 out of 53 cases ) and lhp cancer related to benzene ( 84.4% , 43 out of 50 cases ) was the most common cause of occupational cancers ( 5 , 25 , 26 ) . between 2000 and 2009 , construction ( n=15 ) was most common industry among compensated cancers , followed by shipbuilding ( n=11 ) , and other metal product manufacturing ( n=10 ) . the most common occupation among compensated cancers was metal molders , welders , and related trades workers ( n=16 ) , followed by miners , shot firers , stone cutters , and carvers ( n=14 ) ( table 3 ) ( 23 ) . after the early 1990s , the number of claims and compensations has increased , but the origin of cancers awarded compensation is still limited to 2 organs , namely the lung and lhp system . the most probable carcinogens were asbestos ( 45% ) , hexavalent chromium ( 30% ) , and crystalline silica ( 19% ) ( 27 ) . in case of lhp malignancies , the most probable carcinogens were pure benzene ( 27.5% ) , impurity of benzene in a mixture ( 56.9% ) , and ionizing radiation ( 8.0% ) ( 26 ) . with these data in mind , the existing criteria and scope for occupational cancer required amendment with respect to the causative carcinogens and the target cancer type . the prior korean criteria included only 10 agents and were very outdated compared with the ilo occupational disease list or the iarc list of group 1 carcinogens . mesothelioma due to asbestos was included in the occupational disease list in convention 121 in 1980 . on recommendation no . 194 in 2002 , the ilo added 15 carcinogens to the list including asbestos ; benzidine and its salts ; bis - chloromethyl ether ; chromium vi ; coal tars and coal tar pitches ; beta - naphthylamine ; vinyl chloride ; benzene ; toxic nitro and amino derivatives of benzene or its homolog ; ionizing radiation ; tar , pitch , bitumen , mineral oil , anthracene , or related compounds ; coke oven emissions ; nickel ; wood dust ; and other carcinogens . at this time , an association between specific occupational cancers caused by specific carcinogens was not included . in 2010 , arsenic , beryllium , cadmium , erionite , ethylene oxide , and hepatitis b and c viruses were included on the ilo occupational cancer list ( 8) . the iarc reviewed the entire group i carcinogenic agents list between 2006 and 2010 , and 113 agents were included as group i carcinogens . since these agents cover both occupational and environmental exposure , siemiatycki et al . ( 28 ) proposed 28 agents and 12 occupations or industries as definite occupational risk factors and we listed other additional occupational carcinogens updated after the review of iarc . in the european occupational cancer lists including those of austria , belgium , denmark , germany , finland , france , italy , luxemburg , portugal , spain , swiss , and the eu . finland included the fewest agents ( n=17 ) and germany , denmark , and luxemburg included > 40 agents . lung cancer due to chromate , asbestos , or nickel and malignant mesothelioma due to asbestos were included in the list of occupational cancers in all countries . the prior criteria for recognition of occupational cancer according to the enforcement decree of the iaci act included only 11 agents , for example soot , tar , pitch , asphalt , mineral oil , paraffin , vinyl chloride , chrome or its compounds , benzene , asbestos , and hepatitis virus . except for hepatocellular carcinoma due to occupational exposure to hepatitis b or c virus , which was included in the criteria in 2003 , other carcinogens and their target cancers have not ever been amended after since the 1980s ' . table 4 shows the presented agents on the occupational cancer lists of the ilo , and european countries , those suggested by siemiatycki et al . or us based on the iarc list , and the korean criteria of occupational carcinogens before 2013 . originally , cancer caused by soot , tar , pitch , asphalt , mineral oil , or paraffin was incorrectly identified as epithelial cancer , but needed to be amended as skin cancer . in addition , myelodysplastic syndrome is not cancer , but is a hematologic malignancy , and the epidemiologic evidence for larynx cancer caused by chrome exposure was insufficient . vinyl chloride exposure as a cause of human hepatocellular carcinoma had sufficient evidence . in case of ionizing radiation , as a definite cause of cancer was not included in prior criteria , which only included acute radiation injury - related diseases . first , the number of covered agents was smaller than those of the international lists . third , a reconsideration of exposure duration or cumulative exposure level was needed ; however , this was not included in the current amendment because this would require a national consensus across professional review boards considering various situations of exposure in korea . the main points of this amendment were as follows : first , the type and number of carcinogens should match those of international levels , considering the lists of the ilo , eu , and iarc , with the occupational cancer list of the ilo taking first priority . second , the priority order of the list should be decided by the carcinogen exposure possibility in korea . third , the criteria should include matches between specific carcinogens and target cancers , as evidenced by clinical data from the iarc . we , who suggested the list of carcinogens and its target cancers for recent amendment and directly participated in the policy making process of amendments to the scope and criteria , selected 28 agents and 11 industries to extend the criteria of occupational cancer according to the results the previously described review of the occupational cancer list of the ilo , the eu , and the iarc classification , and the exposure possibility in korea to identified risk factors . aflatoxins , 4-aminobiphenyl , arsenics , ultraviolet - emitting tanning devices , benzidine , beryllium , beta - naphthylamine , 1,3-butadiene , cadmium , crystalline silica , diesel engine exhaust , erionite , ethylene oxide , formaldehyde , leather dust , nickel compounds , passive smoking , polyaromatic hydrocarbons ( pahs ) , radon , shale oil , solar radiation , strong inorganic acid , 2,3,7,8-tetrachlorodibenzo - para - dioxin , trichloroethylene , ortho - toluidine , wood dust , anti - cancer drugs or immunosuppressants , and sulfur mustard were included in reviewed list of agents . occupations or industries included the rubber industry , painting magenta production , coal gasification , aluminum production , auramine production , isopropyl alcohol manufacture using strong acids , underground hematite mining , iron and steel founding , coke production , and coal - tar distillation . coal gasification , coke production , and coal - tar distillation were reviewed with respect to pahs . these industries could be matched to causative agents in a korean - based exposure situation . occupational cancer risk of the rubber industry could be explained by exposure to aromatic amines or solvents . the magenta , aluminum , auramine , isopropyl alcohol , or hematite production industries are rare in korea . pahs , crystalline silica , and strong inorganic acid could explain the occupational cancer risks of the iron and steel founding industry . as a result , it was not possible to determine the exposure to passive smoking , solar radiation , ultraviolet - emitting tanning device , and solar radiation between environmental exposure and occupational exposure . in korea , exposure to aflatoxins , sulfur mustard , erionite , shale oil , and 2,3,7,8-tetrachlorodibenzo - para - dioxin is unlikely and was classified as low risk . measuring the exposure level of leather dust , strong inorganic acid mist , pahs , 4-aminobiphenyl , and ortho - toluidine was very difficult . diesel engine exhaust and trichloroethylene were recently upgraded by the iarc and information concerning exposure measurements , epidemiological evidence , or cases in korea was limited . anti - cancer drugs and immunosuppressant exposure are usually important to patients . in total , 13 agents and 1 occupation among 39 considerable agents and industries were assigned as priority add - ons to the amended scope and criteria specific for korea . we also suggest classifying the system of occupational cancer into an agent- and organ - oriented systems according to the specific criteria for the recognition of occupational diseases according to the enforcement decree of labor standard act ( lsa ) and the enforcement decree of iaci act . therefore , on the basis of the scope of occupational cancers of the lsa , on which all the agents were listed without target cancer , agents were listed with target cancers based on organ oriented system named cancer on the specific criteria of the iaci act . especially , regarding some agents such as benzene , asbestos , or chrome , the considerations related with exposure duration or level persisted unless there were definite evidences . as a result , 14 agents and occupation matched with 12 target cancers were added to the list including x - rays or -rays ; arsenic and its inorganic compounds ; nickel compounds ; cadmium and its compounds ; beryllium and its compounds ; wood dust ; benzidine ; beta - naphthylamine ; crystalline silica ; formaldehyde ; 1,3-butadiene ; radon-222 and its decay ; spray painting ; ethylene oxide . asphalt and paraffin were removed because of the ambiguity of chemical characteristics that could be masked by other agents . the descriptions for some agents were revised to enhance the clarity of the characteristics of the agent ; tar was revised to coal tar , pitch was revised to coal tar pitch , chrome was revised to hexavalent chrome , mineral oil was revised to untreated mineral oil , and hepatitis virus was revised to hepatitis b and c virus . target cancers , especially those related with ionizing radiation , such as cancers of the salivary glands , esophagus , stomach , colon , bone , breast , kidney , thyroid , ovary , nasopharynx , and bladder were incorporated . table 6 presents the scope of occupational cancers according to the enforcement decree of the lsa , july 2013 and the specific criteria for the recognition of occupational diseases according to the enforcement decree of the iaci act , july 2013 . occupational cancer underwent the widest changes in a recent amendment for tables of the enforcement of decree of the lsa and the iaci act . as a result of a review of the published literature including international occupational cancer lists , alongside an analysis of the carcinogen exposure situation in korea , and a review of cases compensated in korea , the carcinogen agents included in legal tables increased from 11 to 23 and the target cancers increased from 9 to 21 . various stakeholders such as representative organizations of employers , workers , insurers , and policymakers participated in this amendment process . as previously stated , it was not possible to further define the work - relatedness between agents and target cancers as a function of exposure level and duration or cumulative exposure . further investigation and discussion between researchers to form a social consensus among various stakeholders will be necessary to resolve criteria for rapid compensation for occupational cancer based on estimates of past exposure level and individual susceptibility . a difference in social security systems between countries is one of the main issues to consider , especially an understanding of the compensation criteria or scope of occupational cancer , because cancer usually develops post - exposure ( 5 ) . the determination of past exposure history or the level of carcinogens in the work environment is very difficult , because of environmental changes over time and the closure of workplaces deemed unfit in the past ( 7 ) . cancer is a chronic disease with a significant financial and health burden at both an individual and national level ( 29 ) . the financial difference between compensation coverage and wage compensation benefit for absenteeism from the workplace between the national health insurance and the iaci system can aggravate the burden of disease for the individual worker , and the outcome of whether a worker is compensated by iaci or not is a major issue for them and their families . the policy makers , professionals , and various stakeholders should carefully consider the fundamental issue in the korean welfare system by introducing sickness absence benefit for workers during the treatment and rehabilitation of occupational cancer . the continuous modification of compensation coverage by the iaci according to new evidence presented in the scientific literature and according to general consensus is essential until sickness absence benefit for workers is introduced by the national health insurance system . a continuous review system of the evidence of causal association is necessary to modify and update the criteria of occupational cancer to formulate guidelines to decide work - relatedness . many countries , such as the uk , germany , france , canada , or japan , operate this kind of regular review system with medical professionals based on legal background , which is not the case in korea . expanding the criteria and scope of occupational cancers is unlikely to lead to an increase in claims for the compensation for occupational cancers , because cancer is a rare disease and the added carcinogens and target cancers in this time have been compensated by decision of professional through out of list system . however , this amendment of the scope and criteria of occupational cancer could increase the public concerns for the compensation for occupational cancer . this situation could improve the very low frequency of claims due to lack of understanding on occupational cancers . | the legal scope and criteria for occupational cancer in korea was out of date .
the aim of this study was to review the current criteria for occupational cancer and amend the existent criteria on the basis of recent scientific evidence .
the scientific evidence and the legal list of occupational cancer were analyzed to identify the causes of occupational cancer on a global scale .
the relationship between compensated occupational cancer cases and carcinogen exposure in korea was examined .
the factors associated with specific causes and target cancers were determined to produce additional criteria .
five - hundred and nineteen cases of 2,468 were awarded compensation for occupational cancer including lung , malignant mesothelioma , lymphohematopoietic , and liver cancers from january 2000 to october 2012 . between 1996 and 2005 ,
benzene accounted for 84.4% of cases , and between 1999 and 2005 , asbestos was associated with 62.3% of cases .
fourteen novel causative agents and 12 additional target cancers were identified and the final guidelines were amended to include 23 causative agents and 21 target cancers .
this amendment of the criteria for occupational cancer represents the widest change in korean history and is expected to improve the understanding of occupational cancer by providing an up - to - date and accurate reference guide.graphical abstract |
You are an expert at summarizing long articles. Proceed to summarize the following text:
during 20052014 in south korea , local public health laboratories participating in the national surveillance network isolated 68 salmonella virchow strains from feces samples from patients with acute diarrhea . until 2010 , < 5 salmonella virchow strains were isolated per year , but this number gradually increased to 17 in 2014 ( figure ) . salmonella virchow consistently ranked among the top 10 serotypes in prevalence during each study year in south korea , accounting for 1.5%2% of salmonellosis cases . we used the broth microdilution method ( 10 ) to perform antimicrobial susceptibility testing of salmonella virchow ; results showed that 54 ( 79.4% ) of the 68 isolates were resistant to > 1 of the 15 antimicrobial agents tested ( table ; technical appendix figure ) . the highest resistance rates were noted for nalidixic acid ( 77.9% ) , followed by ampicillin ( 44.1% ) , cefotaxime ( 44.1% ) , tetracycline ( 42.6% ) , and gentamicin ( 23.5% ) . only 2 ( 2.9% ) isolates were resistant to ciprofloxacin , but 50 ( 73.5% ) had intermediate resistance . multidrug resistance , defined as resistance to at least 3 different classes of antimicrobial agents , was found in 30 ( 44.1% ) isolates ( table ) . * amc , amoxicillin / clavulanic acid ; amp , ampicillin ; cef , cephalothin ; ctx , cefotaxime ; fox , cefoxitin ; gen , gentamicin ; nal , nalidixic acid ; sam , ampicillin / sulbactam ; sxt , trimethoprim / sulfamethoxazole ; tcy , tetracycline ; , pansusceptible . all multidrug - resistant isolates showed resistance to third - generation cephalosporins . in south korea , cefotaxime - resistant strains were first isolated in 2011 . since then , 4 , 9 , and 14 isolates were collected in 2012 , 2013 , and 2014 , respectively ( figure ) . the rates of cefotaxime resistance in salmonella virchow have increased markedly , from 21.4% in 2011 to 82.3% in 2014 . this annual trend of increasing cefotaxime resistance in south korea is of interest because the rates were substantially higher than those reported in spain during 20022006 ( 15% ) ( 11 ) and belgium during 20092013 ( < 10% ) ( 12 ) . moreover , even in israel and switzerland , where the incidence of salmonella virchow was relatively higher than that in south korea , antimicrobial drug resistance to third - generation cephalosporins was rare ( 3,4 ) . among the 30 cefotaxime - resistant salmonella virchow pcr and sequencing of -lactamase genes ( 13 ) confirmed that these 28 isolates harbored a blactx - m-15 gene , whereas the other 2 contained a blacmy-2 gene . cefotaxime resistance was transferred by conjugation from 9 salmonella virchow isolates to escherichia coli j53 recipients , and the blactx - m-15 gene was identified in transconjugants . southern blotting and pcr - based replicon typing ( 14 ) showed that all plasmids in transconjugants were 215 kb in size and possessed an inchi2 plasmid , which was further assigned to sequence type ( st ) 2 by plasmid double locus sequence typing ( 15 ) . the analysis of the genetic environment surrounding the blactx - m-15 gene ( 13 ) in transconjugants showed that insertion sequences isecp1 and orf477 were detected 48 bp upstream and downstream of the blactx - m-15 gene , respectively . this isecp1-blactx - m-15open reading frame 477 transposable unit was also identified in other incompatibility groups of the plasmids in enterobacteriaceae . furthermore , it was identical to that of the st2-inchi2 plasmid of salmonella enteritidis isolated from humans and poultry meat in south korea ( j. kim , unpub . data ) , suggesting that the blactx - m-15 gene in salmonella virchow might have originated from isecp1-mediated transposition followed by interspecies spread through the inchi2-type plasmid studied here . all of the ctx - m-15producing strains had reduced ciprofloxacin susceptibility ( mics of 0.250.5 g / ml ) . all 10 randomly selected isolates harbored a single substitution within the quinolone resistance determining region of gyra at codon 83 ( serphe ) , which is the major mutation described in salmonella species ( 8) . because fluoroquinolones and third - generation cephalosporins are the drugs of choice for treating severe salmonella infections in humans , the reduced ciprofloxacin susceptibility in cefotaxime - resistant salmonella virchow the genetic relationship of the 68 salmonella virchow isolates was determined by using multilocus sequence typing ( http://mlst.warwick.ac.uk/mlst/dbs/senterica ) and pulsed - field gel electrophoresis ( pfge ) according to a standardized protocol . seven multilocus sequence typing loci displayed 4 different profiles , and most isolates belonged to sequence type ( st ) 16 ( n = 59 ) , followed by st197 ( n = 6 ) , st359 ( n = 2 ) , and st426 ( n = 1 ) . all of the 28 ctx - m-15producing strains were typed as st16 , but the cefotaxime - susceptible isolates were also assigned to this type . the pfge analysis yielded sufficient discriminatory power in typing salmonella virchow isolates ; 22 xbai and 21 blni pfge patterns were generated . although the isolates shared > 70% similarity , ctx - m-15producing strains clustered on the basis of a similarity value of 90% ( technical appendix figure ) , indicating the clonality of cefotaxime - resistant strains . for humans , the main route of salmonella infection is the consumption of contaminated food of animal origin , and salmonella virchow is one of the most prevalent serotypes identified in poultry and poultry products . the use of cephalosporins in animal production has led to emergence of antimicrobial drug resistant salmonella virchow clones among food animals ( 8) , posing a threat to public health because of the possible transmission of these bacteria through the food chain . in fact , the xbai pfge pattern identified among human isolates in this study was identical to that in 2 cefotaxime - resistant salmonella virchow strains isolated in 2012 from poultry meat in our collection ( technical appendix figure ) . furthermore , this pattern appeared similar to the patterns of salmonella virchow harboring the blactx - m-15 gene on an st2-inchi2 plasmid that was isolated from organically raised pigs in south korea ( 9 ) . resistant clinical strains were collected from 13 of 15 local public health laboratories in south korea during 20112014 ; thus , although the mode of the spread of salmonella virchow in humans is not established , it has been postulated that ctx - m-15producing salmonella virchow might have disseminated clonally through the nationwide distribution of contaminated food products rather than through independent emergence . we analyzed the antimicrobial drug susceptibility and genetic relatedness of salmonella virchow isolates from patients with diarrhea in south korea . of 68 isolates obtained during 20052014 , a total of 30 were resistant to third - generation cephalosporins . the prevalence rate of the resistant strains has dramatically increased since the isolation of cefotaxime - resistant strains in 2011 . these findings suggest that the cefotaxime - resistant isolates are genetically closely related and harbor a plasmid carrying the blactx - m-15 gene of the same compatibility group ( st2-inchi2 ) , representing clonal dissemination of ctx - m-15producing salmonella virchow in south korea and posing an urgent threat to public health . therefore , more comprehensive surveillance is required to prevent further spread of resistant clonal strains . composite dendrogram of the genetic relatedness among salmonella enterica serotype virchow isolates in republic of korea . | the prevalence of cefotaxime - resistant salmonella enterica serotype virchow has dramatically increased in south korea since the first isolation in 2011 .
of 68 isolates collected over 10 years , 28 cefotaxime - resistant isolates harbored the blactx - m-15 extended - spectrum -lactamase gene and were closely related genetically , demonstrating the clonal dissemination of ctx - m-15producing salmonella virchow in south korea . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
metalloproteins represent
a significant fraction of the human proteome ,
and many represent important therapeutic targets . with respect to the latter , a large number of metalloprotein
inhibitors have been developed , with clinically approved inhibitors
available for the zn - dependent histone deacetylases ( hdacs ) ,
angiotension converting enzyme ( ace ) , and carbonic anhydrase ( ca ) ,
among others . in the majority of these examples ,
the small molecule inhibitors possess functional groups that bind
to the active site metal ion of the enzyme ; a relatively small selection of such groups , including carboxylates ,
phosphates , and hydroxamic acids , are commonly employed as the metal - binding
groups ( mbgs ) of choice . recently , a number
of efforts have focused on the development of alternative mbgs to
these commonly employed groups , and indeed
some newer metalloprotein inhibitors , such as raltegravir and dolutegravir
that target hiv integrase ( hiv1 in , mg - dependent ) , employ
more sophisticated heterocyclic mbgs . these next - generation
mbgs have the potential to improve the potency , selectivity , and pharmacokinetics
of metalloprotein - targeted therapeutics . as is the case with
other forms of inhibitor and drug development ,
the use of structure - aided design can be invaluable to metalloprotein
inhibitor design . in previous efforts , inorganic model compounds have
been utilized to predict the binding of ligands to metalloprotein
active sites . although this approach can be effective , the constrained interactions
and nuances of a metalloprotein active site can not be readily recapitulated
in such model scaffolds . several examples of metalloprotein active
sites influencing metal ligand coordination have been reported .
specifically , changes in coordination caused by interactions with
the surrounding active site have been observed with inhibitors of
carboxypeptidase a based on the n - hydroxyurea mbg
as well as inhibitors of thermolysin that utilize an -mercaptoketone
mbg . in both cases , the changes in metal coordination
are the result of large aromatic groups on the inhibitor being positioned
to form significant interactions with hydrophobic regions of the active
site , and the coordination involved is relatively weak . despite
being a poor mbg for most metalloproteins , the arylsulfonamide
mbg ( acetazolamide , figure 1 ) dominates the
design of inhibitors of carbonic anhydrases ( cas ) . ca inhibitors are used in the treatment of glaucoma , epilepsy ,
and altitude sickness . mbg
interactions upon binding the catalytic zn ion ; the metal - bound
amine and one of the sulfonamide oxygen atoms both form strong hydrogen
bonds with nearby amino acid residues . in addition , the second sulfonamide
oxygen and the aromatic ring are positioned to occupy the substrate
binding pocket of the enzyme active site . in order to elucidate
the binding of mbgs to metalloproteins as compared to model compounds , this report describes the binding of
a series of closely related heterocyclic chelators to the active site
of human carbonic anhydrase ii ( hcaii ) and an inorganic model complex .
because it has many characteristics that make it a suitable model
system including its rigid structure and ease of crystallization ,
hcaii has been widely used to examine protein ligand interactions . in the present study , the mbgs of interest are o , s - donor ligands
based on a hydroxythiopyrone scaffold . specifically , the three ligands ,
5-hydroxy-2-methyl-4h - pyran-4-thione ( allothiomaltol ,
atm ) , 3-hydroxy-2-methyl-4h - pyran-4-thione ( thiomaltol ,
tm ) , and 3-hydroxy-4h - pyran-4-thione ( thiopyromeconic
acid , tpma ) , which differ only by the presence and/or position of
a single methyl group , are examined ( figure 1 ) . in model complexes based on a tris(pyrazolyl)borate ( tp ) platform ,
these chelators bind in an identical , bidentate manner . in contrast , in the active site of hcaii these
chelators display a variety of coordination modes with the active
site zn ion , including an unprecedented monodentate mode
of binding by thiomaltol . the results not only show the utility but
also the limitations of bioinorganic modeling while highlighting the
subtle influence of active site structure on metal ligand bonding .
such subtle effects on coordination chemistry are not readily predicted
by current paradigms in bioinorganic chemistry and , consequently ,
are not implemented in standard drug design efforts directed at metalloproteins .
taken together , the findings presented here demonstrate that metal
coordination by an exogenous ligand in a metalloprotein active site
is strongly influenced by the protein active site . existing drug design
protocols for metalloproteins will need to be adapted to account for
these perturbations . structures of atm , tm , tpma , and several previously reported
hcaii
inhibitors : acetazolamide , based on the arylsulfonamide mbg , 1,2-hopto ,
2-mercaptophenol ( 2-mp ) and its methylated analog thioguaiacol ( tg ) . mbgs and tpzn(atm ) ( tp = hydrotris(5,3-methylphenylpyrazolyl)borate )
were synthesized
using modified reported procedures . details can
be found in the supporting information . as previously reported , hcaii was expressed and purified , and a detailed
procedure can be found in the supporting information . assays were performed in 50 mm hepes ph 8.0 containing na2so4 to an ionic strength of 100 mm . enzyme ( 100 nm final
concentration ) was incubated with varying concentrations of inhibitor
for 10 min at room temperature before the addition of substrate ( p - nitrophenyl acetate , final concentration between 50 m
and 10 mm ) . initial reaction rates vs substrate concentration were
plotted for three concentrations of inhibitor , and the curves simultaneously
fit for ki using graphpad
prism . crystals of hcaii were obtained
by the sitting - drop or hanging - drop vapor diffusion method . the protein
solution consisted of 20 mg / ml hcaii and 1 mm p - chloromercuribenzoic
acid in 50 mm tris - so4 , ph 8.0 . the precipitant solution
contained 2.73.0 m ( nh4)2so4 in 50 mm tris - so4 ph 8.15 . drops consisted of 3 l
of protein solution plus 2.54.0 l of precipitant solution
and were equilibrated at 18 c against 750 l of precipitant
solution . crystals roughly 0.3 0.3 0.3 mm in size appeared
after 2 days to 3 weeks . once formed , crystals were transferred to
15 l of soak solutions containing inhibitor ( at saturation ,
1 mm ) , 1.5 m sodium citrate , 50 mm hepes ph 8.15 , 5% glycerol ,
and 25% dmso . due to potential interference from the high concentration
of dmso necessary for ligand solubility , cocrystallization of the
ligands with hcaii was not attempted . x - ray diffraction studies
on hcaii crystals were carried out at 100 k with a bruker d8 smart
6000 ccd detector and utilizing cu k radiation ( = 1.5478
) from a bruker - nonius fr-591 rotating anode generator . the data were phased by molecular replacement using
a previously reported hcaii structure ( pdb 3ks3 ) with water
molecules removed . models were built by alternating refinement using
refmac5 and manual visualization and
model building in coot . the structures have been deposited in the protein data bank ( pdb
ids 4mlx and 4mlt for atm and tm ,
respectively ) . mercury salts are commonly used in hcaii crystallization
to increase crystal quality and size . complete data collection
details and refinement statistics for the tpzn(atm )
and hcaii crystal structures can be found in the supporting information . samples for xas ( 2
mm in protein ) were prepared from lyophilized ca ( sigma aldrich ) ,
dissolved in 50 mm phosphate buffer ( ph 7.5 ) that was dialyzed overnight
against the same buffer to remove salts and adventitious metals . mbg
complexes were prepared by addition of a buffered solution of the
mbg to the hcaii solution to a final concentration of 6 mm ( 3-fold
molar excess ) . all samples contained 20% ( v / v ) glycerol as a glassing
agent and were loaded in lucite cuvettes with 6 m polypropylene
windows before being frozen rapidly in liquid nitrogen . x - ray absorption
spectra were measured at the national synchrotron light source ( nsls ) ,
beamline x3b , with a si ( 111 ) double - crystal monochromator ; harmonic
rejection was accomplished using a ni focusing mirror . fluorescence
excitation spectra for all samples were measured with a 31-element
solid - state ge detector array . all geometry optimizations
were performed using the gaussian 09 suite of programs , utilizing becke s three - parameter hybrid
method with the lee , yang , and parr correlation functional ( b3lyp ) with the 6 - 311+g(d , p ) basis set and cpcm solvation ( = 10 ) . the b3lyp functional has previously been used to successfully recapitulate
geometric parameters of model active sites for zn metalloproteins as well as free energies of water - chloride exchange
in zinc chloride complexes . linear transit calculations were performed with
the phenyl groups of tpzn omitted ; this modified system
is referred to as tpzn . previously reported data from screening
a library of mbgs against hcaii revealed tm and tpma as moderately
potent fragments . determination of ki values for atm , tm , and tpma
reveals inhibition constants consistent with these early reports ( table 1 ) . the effect of the inhibitors on the km curve of hcaii - catalyzed hydrolysis of p - nitrophenyl acetate is consistent with competitive inhibition ( figure s1 ) . while tm and tpma have similar ki values ( 1.4 0.2 and
1.1 0.2 mm , respectively ) , atm is roughly 2-fold more potent
( 0.65 0.06 mm ) . when the hydroxyl group of atm is methylated
( atm - ome , figure 1 ) , the molecule drops 10-fold
( ki = 6.9 1.0
mm ) in potency . in contrast , methylation of tm ( i.e. , tm - ome ) results
in a complete loss of inhibitory activity against hcaii ( ki 50 mm ) . in order to explain the variation
in inhibitory activity for this series of molecules , the x - ray crystal
structures of atm and tm bound to tpzn model compounds
and the hcaii active site were examined . the crystal structure of
tm bound to this model complex has been previously reported , and atm shows a very similar binding mode to the zn ion . the ligands bind in a bidentate fashion , resulting in trigonal
bipyramidal geometry around the zn ion ( figure s2 ) . the s zn and o zn distances of tpzn(atm ) ( 2.35 and 2.09 , respectively ) are similar
to those in the complex with tm ( 2.34 and 2.06 ) . in both cases ,
the oxygen donor atom occupies an axial coordination site , while the
sulfur atom is an equatorial donor . the two ligands coordinate the
zn with nearly ideal head - on binding ;
the plane formed by the ligand atoms is essentially normal to the
plane formed by the three pyrazole nitrogen donors . this angle ( ,
figure 2 ) will be quantified by the torsion
angle between the zn ion , the sulfur donor , the oxygen
donor , and the endocyclic carbon bound to the oxygen ; these angles
show absolute values of 166 and 174 for the tp complexes of atm and tm , respectively . given the similarity of the
tm and atm complexes , it is expected that the tpma structure would
show an identical coordination geometry . for atm , tm , and tpma , is defined as the zn s o - c dihedral
angle ( a , shown labeled on atm with
red arrows ) . s o and s o c atoms , representing
the tilt of the mbg . mbgs assume different binding modes in tpzn ( b , model ) and hcaii ( c , protein ) complexes . |model| ranges from 166
to 174 , while |protein| ranges from 90 to
143 depending on the mbg . in the active site of hcaii , atm adopts the expected bidentate
coordination mode to the zn ion of hcaii , resulting in
trigonal bipyramidal geometry around the metal ( figure 3 ) . the s zn ( 2.57 ) and o zn ( 2.28 )
bonds are both 0.2 longer than those in tpzn(atm ) . as predicted by the model complex , the oxygen donor occupies
an axial coordination site , while the sulfur is in an equatorial position . the hydroxyl group of the ligand , in addition to binding the zn ion , is in close proximity to the hydroxyl groups of thr199
( o o distance of 3.51 ) and thr200 ( o o distance
of 3.71 ) , and the methyl group is positioned to interact with
the side chains of val121 and phe131 of the hydrophobic region of
the active site . due to the steric restrictions of the hcaii active
site , the ligand can not bind in the ideal head - on fashion (
= 180 ) ; it is forced to tilt more than 20 relative to
that of the model complex ( figure 2 ,
= 143 ) . the
|fobs| electron density map ( gray ) is
shown contoured at 1.5 for protein residues , while the omit
|fobs a
schematic representation of the interactions between atm and hcaii
can be found in figure s12 . the crystal structure of tm bound in the active
site of hcaii reveals
an unconventional coordination mode : the ligand acts as a monodentate
donor through the sulfur atom with a bond length of 2.4 , resulting
in a distorted tetrahedral geometry around the zn ion . the ligand electron density is best fit as a combination of two binding
modes , both with 50% occupancy , in which the coordinated sulfur atoms
overlay ( figure 4 ) . in one orientation , the
exocyclic hydroxyl and methyl groups are oriented toward the hydrophobic
wall of the active site formed by val143 , leu141 , val121 , and phe131 .
in the second conformation , the ligand is flipped so that the hydroxyl
group is directed toward hydrophilic residues of the active site ,
allowing for a hydrogen bond with the side chain of thr200 ( o o
distance of 2.85 ) . in this conformation the ring of tm is positioned
1.1 closer to the to the side chains of val121 and
val143 , allowing for enhanced hydrophobic contacts with these groups . the average b factor of tm is significantly greater than that of atm
( 40.5 vs 21.5 ) , consistent with its lower affinity and disordered
binding . efforts to soak tpma into hcaii crystals repeatedly resulted
in poorly defined electron density for the mbg that could not be suitably
modeled . fcalc| , red ) are shown contoured
at 1.5. a diagram of the interactions between thm and hcaii
can be found in figure s12 . x - ray
absorption spectroscopy
( xas ) data suggest the binding modes observed in the crystal structures
are representative of those present in frozen solution . the data for
hcaii with and without the mbgs ( atm , tm , and tpma ) are shown in figure 5 . detailed fitting results for each data set are
given in figures s3s6 and tables s3s6 . comparison of the fourier transforms ( fts ) in figure 5a shows that each mbg ( bold lines ) leads to only minor overall
perturbations relative to the resting enzyme ( thin lines ) . atm provides
the most striking changes in the first shell , with both a shift to
higher r and narrowing of the main peak ( chiefly
zn n / o scattering ) , together with increased amplitude at r + 2.1 ( chiefly zn s ) . the
tm complex shows similar , although more subtle , changes in the first
shell scattering and substantial changes in the outer shell scattering
pattern . the tpma complex is most similar to the resting enzyme , with
only subtle changes in the first shell apparent in the extended x - ray
absorption fine structure ( exafs ) fts . however , examination of the k - space exafs data ( figure 5b ) reveals
that all three mbgs cause a similar shift in the third oscillation
of the exafs ( k 7 9 ) . s
interactions shows this is where the two patterns are most likely
to show visible divergence ( figure s7 ) ,
suggesting that all three mbg complexes include a zn each mbg causes a similar shift in the shape of the zn
x - ray absorption near edge structure ( xanes , figure
s8 ) , also consistent with s - coordination . fourier transforms ( a )
of the k - weighted
exafs ( b ) of hcaii with atm , tm , and tpma . in each case , the data
for the resting enzyme are shown as a thin line overlay . the curve fits are consistent with the qualitative
assessment given
above . the atm complex with hcaii appears 5-coordinate , with the sulfur
of the mbg directly coordinated ( fits that excluded the zn s
bond gave fit residuals that were 3-fold larger , figure s4 and table s4 ) . n / o distance is also
slightly longer than for the resting enzyme and the other two mbg
complexes , suggesting higher coordination in the atm complex , and
it is this xanes spectrum that shows that largest energy shift . in
contrast , fits to the tm complex data suggest that the total coordination
number remains at four with the mbg coordinated through only the sulfur
atom ( fits that excluded the zn s bond gave fit residuals that
were 2- to 3-fold larger , figure s5 and table
s5 ) . this is consistent with the change in the outer shells ,
where more linear mbg coordination could potentially amplify multiple - scattering
interactions , although a deeper analysis is outside the scope of the
present study . tm also produces a change in shape in the xanes but
a smaller energy shift than atm . the tpma complex is strikingly similar
to the resting enzyme with only the shift in principal frequency noted
above being readily apparent . fits to these data also suggest retention
of a total coordination of four in the tpma complex ( as observed for
tm ) , with the mbg s - bound ( fits that excluded the zn s bond
gave fit residuals that were approximately 2-fold larger , figure s6 and table s6 ) . this is supported by
the xanes , which clearly show a change in shape on addition of tpma . to assess one possible cause
for the switch to monodentate coordination of tm and tpma in the active
site of hcaii , linear transit computations employing density functional
theory ( dft ) were conducted along from 180 to 90
for tm complexed to the simplified tpzn scaffold . near = 180 ,
the plane formed by tm is perpendicular to the plane defined by the
three zn - coordinating pyrazole nitrogens . similar to
the tpzn(tm ) crystal structure , this computed structure
adopts a trigonal bipyramidal geometry with the hydroxyl group as
an axial donor and the sulfur donor coordinating equatorially . the
calculated o zn and s zn distances ( 2.08 and 2.45 ,
respectively ) are similar to those observed in the crystal structure
of tpzn(tm ) ( figure s9 ) . as tm is tilted along , the zn donor atom distances increase
gradually until reaches 120 , which is the last point
along the linear transit where the ligand coordination is bidentate
( figure 6 ) . for values of < 120 ,
no stationary states corresponding to bidentate coordination of the
zn ion are obtained ; monodentate coordination by the
thione becomes the favored binding mode . at these points , the o zn
distance is > 3.4 , while the s zn bond length , having
a value of 2.30 2.32 , more closely resembles a thiolate zn bond . similar trends in coordination
mode along the reaction coordinate are also present for tm
and tpma ( figure 6 ) . calculated o zn
distances ( top ) and relative binding energies
( bottom ) as a function of from linear transit computations . for all three mbgs , the lowest
energies are achieved at values
of near 180 , where the ligand assumes its ideal head - on
binding mode as observed in the model complexes . distorting the ligand
coordination from = 180 leads to an increase in energy
relative to the head - on binding geometry , and the energy of the complex
appears to follow a parabolic path up to the point where the coordination
mode shifts from bidentate to monodentate ( figure 6 ) . shifting to monodentate coordination of zn through the sulfur atom causes the relative energy of the complex
to level out at 1215 kcal / mol above the energy of
the head - on binding mode . aside
from being tilted away from ideal head - on
binding , the coordination of atm to the active site zn ion of hcaii is similar to that predicted by the tp model complex ( figure s2 ) . this bidentate
coordination mode has been previously reported for 2-mercaptopyridine - n - oxide ( 1,2-hopto ) , a similar mbg ( figure 7 ) . the previously reported ki of 1,2-hopto against hcaii ( 0.85 mm ) is close
to that of atm and coincides with the similar binding mode . although the interaction between atm and the
zn ion appears to be bidentate , the residual inhibitory
activity of atm - ome suggests that the electrostatic interaction between
the oxygen donor and the zn ion is not essential for
binding . although the donor atoms are positioned similarly
( left ) , a view along the plane of the ligands ( right ) reveals that
atm is 10 closer to ideal head - on binding . the coordination mode of tm to
the active site zn ion
of hcaii demonstrates that a protein environment can strongly perturb
mbg coordination . the inhibitory activity of atm - ome suggests that
the interaction between the hydroxyl group and the zn ion is not essential for activity , and the monodentate binding of
tm further supports this . while the methyl group of atm is ideally
positioned for hydrophobic interactions when the ligand adopts bidentate
coordination , this is not the case for tm . it appears that in order
to maximize other protein ligand interactions , the o the conformation in which the hydroxyl
and methyl groups are oriented toward the hydrophobic wall of the
active site is very similar to a previously reported structure of
2-mercaptophenol ( 2-mp ) bound to hcaii ( figure 8) . although both tm and 2-mp are monodentate
ligands in hcaii , only the tp model complex of 2-mp
recapitulates this monodentate binding mode . in contrast , the tpzn(tm ) complex shows strong bidentate
coordination from both the sulfur and oxygen donor atoms . this suggests
that while the monodentate binding of 2-mp to hcaii is driven largely
by the properties of the ligand itself , the monodentate binding mode
of tm is a direct result of interactions with the hcaii active site
environment . in contrast to tm , which loses all inhibitory activity
when methylated
( tm - ome ) , when the hydroxyl group of 2-mp is methylated ( tg , figure 1 ) , the activity against hcaii is unaffected ( ki = 3.2 0.3 m
for tg vs 3.0 0.7 m for 2-mp ) . this suggests that the binding mode of tm that is relevant to inhibition
is the conformation in which the hydroxyl and methyl groups are oriented
toward the hydrophilic residues of the active site . the loss in potency
for tm - ome is consistent with this binding mode , as the interaction
between tm and thr200 would be diminished and the methoxy group would
likely have a steric clash with either neighboring protein residues
or well - ordered active site water molecules . with the hydroxyl group
oriented toward the hydrophilic side of the pocket , a hypothetical
bidentate coordination mode would position the methyl group of tm
very close to the hydrophilic side of the active site , where well - ordered
water molecules interact with protein residues . consequently , tm rotates
toward a monodentate coordination of zn to preserve the
preexisting interactions in the pocket . the microscopic pka values of tm in the active site of hcaii are computed
to be 4.1 and 7.2 when the hydroxyl group is oriented toward the hydrophilic
and hydrophobic pockets , respectively ( figure
s11 ) . coupling these data with
the observation of the two conformations in a 1:1 ratio in
the crystal structure determined at ph 8 suggest that at low ph , the
predominant species of tm is protonated and oriented toward the hydrophobic
pocket ( attempts to verify this crystallographically were unsuccessful ) ;
at high ph ( ph > 7.2 ) , the deprotonated form of tm is dominant
with
the ligand hydroxyl group oriented in the hydrophilic pocket , which
is likely the conformation responsible for the observed inhibitory
activity . overlay of the crystal structure of tm and inhibitors that show
similar binding modes . left : the conformation with
the hydroxyl group of tm facing the hydrophobic pocket occupies a
space similar to that of 2-mercaptophenol ( pdb 2osm , shown in green ) . right : when the hydroxyl group of tm is oriented toward the hydrophilic
side of the active site , the ring nearly overlays with that of 2-mercaptophenol . from the structural data acquired
for tm , particularly when compared
to the analogous o , s - donor atm , it is evident that the zn mbg interaction is not the sole dictator of ligand binding . ligand acidity is likely not a major driving force in the change in
coordination , as atm and tm have relatively close acidities ( pka = 7.64 and 8.06 , respectively ) . the dft - derived geometric and energetic analyses
of tpzn(mbg ) complexes show that over the ligand orientations available
to mbgs in hcaii ( || = 90143 ) , there can be a
very small energy difference between monodentate and bidentate coordination
of zn . for example , between = 125115 ,
bidentate and monodentate coordination modes for the ligands considered
in this study differ in energy by < 5 kcal / mol . from this observation , it is reasonable that the orientation of tm can , in some circumstances ,
be altered by interactions with the active site of hcaii . this finding
implies that de novo or fragment - based approaches to inhibitor development
must take care to elucidate circumstances where protein effects alter
the coordination mode of an mbg . the
rational design of metalloprotein inhibitors requires knowledge
as to how those inhibitors coordinate the active site metal ion . while
small molecule model complexes have been used as proxies for coordination
in enzyme active sites , the results presented here demonstrate that
the active site environment can have a significant effect on the metal ligand
interaction ; in cases where structural data is not available , care
must be taken in the assumptions made about metal - inhibitor interaction .
in the case of hcaii , the steric restrictions of the active site force
ligands to bind in conformations far from ideal head - on binding , drastically
decreasing the strength of metal coordination . other interactions ,
including hydrogen bonding and hydrophobic contacts , can influence
the binding mode of the mbg , leading to coordination modes not observed
in conventional coordination chemistry . studies are underway to further
understand the role of metal coordination in the binding of metalloprotein
inhibitors and how binding is influenced by other interactions within
the active site . | the
binding of three closely related chelators : 5-hydroxy-2-methyl-4h - pyran-4-thione ( allothiomaltol , atm ) , 3-hydroxy-2-methyl-4h - pyran-4-thione ( thiomaltol , tm ) , and 3-hydroxy-4h - pyran-4-thione ( thiopyromeconic acid , tpma ) to the active
site of human carbonic anhydrase ii ( hcaii ) has been investigated .
two of these ligands display a monodentate mode of coordination to
the active site zn2 + ion in hcaii that is not recapitulated
in model complexes of the enzyme active site .
this unprecedented binding
mode in the hcaii - thiomaltol complex has been characterized by both
x - ray crystallography and x - ray spectroscopy .
in addition , the steric
restrictions of the active site force the ligands into a flattened
mode of coordination compared with inorganic model complexes .
this
change in geometry has been shown by density functional computations
to significantly decrease the strength of the metal
ligand
binding .
collectively , these data demonstrate that the mode of binding
by small metal - binding groups can be significantly influenced by the
protein active site . diminishing the strength of the metal
ligand
bond results in unconventional modes of metal coordination not found
in typical coordination compounds or even carefully engineered active
site models , and understanding these effects is critical to the rational
design of inhibitors that target clinically relevant metalloproteins . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we included nine patients ( five men and four women ) with type 1 diabetes on stable continuous subcutaneous insulin pump therapy . diagnostic criteria for type 1 diabetes were past or present positive antibodies against gad or islet cells and plasma free c - peptide levels < 0.3 nmol / l . their weight had been stable for at least 3 months prior to participation in this study . a1c levels had been below 8.5% during the year prior to the start of the study . kg / m , clinical signs of autonomic neuropathy , known sleep disorders , habitual sleep duration of less than 6 h or more than 9 h , psychiatric disorders , and use of sleep medication , -blocking agents , or prokinetic drugs . all patients had normal blood pressure and serum creatinine levels and urinary microalbumin excretion rates below 30 mg/24 h. the study was approved by the medical ethical committee of the leiden university medical center , and written informed consent was obtained from all subjects prior to the study . the subjects were studied on 3 days , separated by intervals of at least 3 weeks . subjects kept a detailed diary of their diet and physical activity for 3 days prior to each study day and were asked to maintain a standardized schedule of bedtimes and mealtimes in accordance with their usual habits . actigraphy ( actiwatch aw7 ; cambridge neurotechnology , cambridge , u.k . ) was performed to objectively assess patterns of habitual active and inactive ( sleep ) periods for 7 days prior to the actual study , including one weekend . in addition , self - reported sleep duration and sleep quality were assessed using validated questionnaires ( pittsburgh sleep quality index , epworth sleepiness scale , and berlin questionnaire ) ( 810 ) . subjects were admitted to our clinical research center the night preceding each study day and spent 8.5 h in bed from 2300 h to 0730 h on all three occasions . the first study day served to let subjects become accustomed to sleep conditions in a research setting . the optimal overnight infusion rate of insulin was determined in each subject prior to the start of the study . subjects were randomly assigned to partial sleep deprivation on either the second ( n = 4 ) or third ( n = 5 ) study occasion . during the night of sleep restriction , subjects also spent 8.5 h in bed but were only allowed to sleep from 0100 h to 0500 h. they were allowed to read or watch movies in an upward position , and their wakefulness was monitored and assured if necessary . sleep was visually scored for each of the three nights according to the guidelines of the american association of sleep medicine ( aasm ) ( 11 ) . in short , scoring of sleep stages depends on electroencephalography , eye movements , and submental muscle activity . to detect possible sleep disorders that might affect the study , respiratory movements were recorded by measurement of changes in nasal pressures and of truncal respiratory movements . recordings were made using a portable polysomnography ( psg ) recorder ( titanium ; embla systems , broomfield , co ) . sleep and wake stages were visually scored in consecutive epochs of 30 s , resulting in a list of epochs spent in wake , stages i ( drowsiness ) , ii , iii , and rapid eye movement ( rem ) dream sleep . the times at which subjects went to bed and turned out the lights as well as times of getting out of bed were noted . the lists of stages were used to calculate the duration of time spent each night in the above - mentioned sleep and wake stages . these durations were also expressed as percentages of total sleep duration , defined as the summed duration of sleep stages i , ii , iii , and rem . hyperinsulinemic euglycemic clamp studies were performed the day after the second and third study occasions . after an overnight fast , a catheter was inserted into an antecubital vein for infusion of isotopes , glucose , and insulin , and a sampling catheter was inserted into a dorsal hand vein of the contra lateral arm . for all blood samples , the heated hand technique was used to obtain arterialized blood ( 12 ) . a primed ( 17.6 mol / kg ) continuous ( 0.22 mol kg min ) infusion of [ 6,6-h2]glucose ( cambridge isotope laboratory , andover , ma ) was started at 0830 h , after basal blood samples had been taken for determination of background glucose enrichment . labeled glucose was infused by a pilot c syringe pump ( fresenius vial , brezins , france ) . blood samples were obtained after 160 , 170 , and 180 min of [ 6,6-h2]glucose infusion for assessment of glucose kinetics in the basal state and concentrations of glucose and plasma nonesterified fatty acids ( nefas ) . subsequently , administration of subcutaneous insulin was stopped and infusion of intravenous insulin was started , using the method of defronzo et al . briefly , this consisted of a primed ( 80 mu m min for 5 min and subsequently 40 mu m min for 5 min ) , followed by continuous ( 20 mu m min ) infusion of insulin ( actrapid , novo nordisk , alphen a / day rijn , the netherlands ) , dissolved in sterile nacl 0.9% , using a pilot c syringe pump . a variable infusion of glucose 20% enriched with 3% plasma glucose concentrations were measured in intervals of 5 min with a bedside calibrated glucose analyzer ( accu - chek ; roche , mannheim , germany ) , and the infusion rate of glucose 20% was adjusted in order to keep the plasma glucose levels constant at 5.0 blood samples were obtained after 150 , 160 , 170 , and 180 min of combined insulin and [ 6,6-h2]glucose infusion for assessment of glucose kinetics and of concentrations of glucose , insulin , and plasma nefa . serum concentrations of glucose were measured using a fully automated modular p 800 analyzer ( roche / hitachi ; mannheim , germany ) with intra - assay variations of 1% . serum insulin concentrations were measured by enzyme labeled chemiluminescent immunometric assay ( immulite 2500 ; siemens , bad nauheim , germany ) with an intra - assay coefficient of variation ( cv ) of 4% . nefa levels were determined spectrophotometrically by enzymatic colorimetric acyl - coa synthase / acyl - coa oxidase assay ( wako chemicals , neuss , germany ) with intra - assay cv of 2.7% . enrichment of plasma [ 6,6-h2]glucose was determined in a single analytical run , using gas chromatography coupled to mass spectrometry , as described previously ( 14 ) . all isotope enrichments were measured on a gas chromatograph mass spectrometer ( model 6890/5973 ; hewlett - packard , palo alto , ca ) . isotopic steady state was achieved during the final 30 min of the basal period and the final 30 min of the hyperinsulinemic clamp study . therefore , the rates of appearance ( ra ) and disappearance ( rd ) of glucose were calculated as the tracer infusion rates divided by the tracer - to - tracee ratios . endogenous glucose production ( egp ) during the basal steady state is equal to ra of glucose , whereas egp during the hyperinsulinemic clamp study was calculated as the difference between ra and the glucose infusion rates . differences between the effects of the night of normal sleep duration and the night of partial sleep restriction were analyzed by the wilcoxon signed rank test for paired samples . all analyses were performed using spss for windows , version 16.0 ( spss , chicago , il ) . sleep was visually scored for each of the three nights according to the guidelines of the american association of sleep medicine ( aasm ) ( 11 ) . in short , scoring of sleep stages depends on electroencephalography , eye movements , and submental muscle activity . to detect possible sleep disorders that might affect the study , respiratory movements were recorded by measurement of changes in nasal pressures and of truncal respiratory movements . recordings were made using a portable polysomnography ( psg ) recorder ( titanium ; embla systems , broomfield , co ) . sleep and wake stages were visually scored in consecutive epochs of 30 s , resulting in a list of epochs spent in wake , stages i ( drowsiness ) , ii , iii , and rapid eye movement ( rem ) dream sleep . the times at which subjects went to bed and turned out the lights as well as times of getting out of bed were noted . the lists of stages were used to calculate the duration of time spent each night in the above - mentioned sleep and wake stages . these durations were also expressed as percentages of total sleep duration , defined as the summed duration of sleep stages i , ii , iii , and rem . hyperinsulinemic euglycemic clamp studies were performed the day after the second and third study occasions . after an overnight fast , a catheter was inserted into an antecubital vein for infusion of isotopes , glucose , and insulin , and a sampling catheter was inserted into a dorsal hand vein of the contra lateral arm . for all blood samples , the heated hand technique was used to obtain arterialized blood ( 12 ) . a primed ( 17.6 mol / kg ) continuous ( 0.22 mol kg min ) infusion of [ 6,6-h2]glucose ( cambridge isotope laboratory , andover , ma ) was started at 0830 h , after basal blood samples had been taken for determination of background glucose enrichment . labeled glucose was infused by a pilot c syringe pump ( fresenius vial , brezins , france ) . blood samples were obtained after 160 , 170 , and 180 min of [ 6,6-h2]glucose infusion for assessment of glucose kinetics in the basal state and concentrations of glucose and plasma nonesterified fatty acids ( nefas ) . subsequently , administration of subcutaneous insulin was stopped and infusion of intravenous insulin was started , using the method of defronzo et al . briefly , this consisted of a primed ( 80 mu m min for 5 min and subsequently 40 mu m min for 5 min ) , followed by continuous ( 20 mu m min ) infusion of insulin ( actrapid , novo nordisk , alphen a / day rijn , the netherlands ) , dissolved in sterile nacl 0.9% , using a pilot c syringe pump . a variable infusion of glucose 20% enriched with 3% [ 6,6-h2]glucose was started 4 min after the start of insulin infusion . plasma glucose concentrations were measured in intervals of 5 min with a bedside calibrated glucose analyzer ( accu - chek ; roche , mannheim , germany ) , and the infusion rate of glucose 20% was adjusted in order to keep the plasma glucose levels constant at 5.0 blood samples were obtained after 150 , 160 , 170 , and 180 min of combined insulin and [ 6,6-h2]glucose infusion for assessment of glucose kinetics and of concentrations of glucose , insulin , and plasma nefa . serum concentrations of glucose were measured using a fully automated modular p 800 analyzer ( roche / hitachi ; mannheim , germany ) with intra - assay variations of 1% . serum insulin concentrations were measured by enzyme labeled chemiluminescent immunometric assay ( immulite 2500 ; siemens , bad nauheim , germany ) with an intra - assay coefficient of variation ( cv ) of 4% . nefa levels were determined spectrophotometrically by enzymatic colorimetric acyl - coa synthase / acyl - coa oxidase assay ( wako chemicals , neuss , germany ) with intra - assay cv of 2.7% . enrichment of plasma [ 6,6-h2]glucose was determined in a single analytical run , using gas chromatography coupled to mass spectrometry , as described previously ( 14 ) . all isotope enrichments were measured on a gas chromatograph mass spectrometer ( model 6890/5973 ; hewlett - packard , palo alto , ca ) . isotopic steady state was achieved during the final 30 min of the basal period and the final 30 min of the hyperinsulinemic clamp study . therefore , the rates of appearance ( ra ) and disappearance ( rd ) of glucose were calculated as the tracer infusion rates divided by the tracer - to - tracee ratios . endogenous glucose production ( egp ) during the basal steady state is equal to ra of glucose , whereas egp during the hyperinsulinemic clamp study was calculated as the difference between ra and the glucose infusion rates . differences between the effects of the night of normal sleep duration and the night of partial sleep restriction were analyzed by the wilcoxon signed rank test for paired samples . all analyses were performed using spss for windows , version 16.0 ( spss , chicago , il ) . the results of two of the nine patients were excluded because of nocturnal hypoglycemia and subsequent nocturnal hyperglycemia during the study ( n = 1 ) , and because of the presence of a previously undetected sleep apnea syndrome ( n = 1 ) . therefore , the analyses included the data of seven patients ( three men ) for analysis . mean age of these seven subjects was 44.3 6.6 years , mean weight 72.0 4.0 kg , mean height 175 3 cm , and mean bmi 23.5 0.9 kg / m . mean a1c of the patients was 7.6 0.3% , and mean duration of diabetes was 23 3.5 years . self - reported sleep duration and recorded habitual sleep duration by actigraphy were not different ( 475 8 vs. 490 7 min , p = 0.12 ) . sleep duration was considerably shorter in the night with partial sleep restriction , compared with the night with normal sleep duration ( p = 0.02 ) ( table 1 ) . sleep in the sleep - deprived night showed a higher proportion of stage iii sleep ( p = 0.02 ) and a lower proportion of rem sleep ( p = 0.04 ) . the effects of a night of normal sleep duration versus a night of sleep duration restricted to 4 h on sleep parameters assessed by psg , basal and insulin - stimulated glucose , and fatty acid metabolism in seven patients with type 1 diabetes data are means sem . lbm , lean body mass ; tst , total sleep time . the mean overnight rate of subcutaneous infusion of insulin was 0.7 ie / h and was identical in both conditions ( table 1 ) . compared with normal sleep duration , partial sleep deprivation did not alter basal levels of glucose or nefa measured the following morning . in addition , partial sleep restriction did not affect basal egp assessed by primed , continuous infusion of [ 6,6-h2]glucose . steady state glucose and insulin levels did not differ between the two clamp studies ( table 1 and fig . sleep restriction did not affect egp during the clamp conditions . however , sleep restriction decreased the rate of glucose disposal ( rd ) during the clamp by 14% ( p = 0.04 ) . accordingly , the rate of infusion of glucose necessary to maintain constant plasma glucose levels during the hyperinsulinemic clamp study was 21% lower after the night of reduced sleep duration than after the night of normal sleep duration ( p = 0.04 ) , reflecting decreased peripheral insulin sensitivity . individual values obtained during steady state of the hyperinsulinemic euglycemic clamp studies of nefas ( a ) , egp ( b ) , glucose disposal rate ( c ) , and the glucose infusion rate ( d ) after a night of normal sleep duration versus after a night of partial sleep deprivation in patients with type 1 diabetes ( n = 7 ) . the results of two of the nine patients were excluded because of nocturnal hypoglycemia and subsequent nocturnal hyperglycemia during the study ( n = 1 ) , and because of the presence of a previously undetected sleep apnea syndrome ( n = 1 ) . therefore , the analyses included the data of seven patients ( three men ) for analysis . mean age of these seven subjects was 44.3 6.6 years , mean weight 72.0 4.0 kg , mean height 175 3 cm , and mean bmi 23.5 0.9 kg / m . mean a1c of the patients was 7.6 0.3% , and mean duration of diabetes was 23 3.5 years . self - reported sleep duration and recorded habitual sleep duration by actigraphy were not different ( 475 8 vs. 490 7 min , p = 0.12 ) . sleep duration was considerably shorter in the night with partial sleep restriction , compared with the night with normal sleep duration ( p = 0.02 ) ( table 1 ) . sleep in the sleep - deprived night showed a higher proportion of stage iii sleep ( p = 0.02 ) and a lower proportion of rem sleep ( p = 0.04 ) . the effects of a night of normal sleep duration versus a night of sleep duration restricted to 4 h on sleep parameters assessed by psg , basal and insulin - stimulated glucose , and fatty acid metabolism in seven patients with type 1 diabetes data are means sem . the mean overnight rate of subcutaneous infusion of insulin was 0.7 ie / h and was identical in both conditions ( table 1 ) . compared with normal sleep duration , partial sleep deprivation did not alter basal levels of glucose or nefa measured the following morning . in addition , partial sleep restriction did not affect basal egp assessed by primed , continuous infusion of [ 6,6-h2]glucose . steady state glucose and insulin levels did not differ between the two clamp studies ( table 1 and fig . sleep restriction did not affect egp during the clamp conditions . however , sleep restriction decreased the rate of glucose disposal ( rd ) during the clamp by 14% ( p = 0.04 ) . accordingly , the rate of infusion of glucose necessary to maintain constant plasma glucose levels during the hyperinsulinemic clamp study was 21% lower after the night of reduced sleep duration than after the night of normal sleep duration ( p = 0.04 ) , reflecting decreased peripheral insulin sensitivity . individual values obtained during steady state of the hyperinsulinemic euglycemic clamp studies of nefas ( a ) , egp ( b ) , glucose disposal rate ( c ) , and the glucose infusion rate ( d ) after a night of normal sleep duration versus after a night of partial sleep deprivation in patients with type 1 diabetes ( n = 7 ) . in this study , we assessed the effects of a single night of partial sleep restriction on insulin sensitivity in patients with type 1 diabetes . the results indicate that a single night of partial sleep restriction reduces insulin sensitivity of insulin - stimulated glucose uptake by 1421% . we conclude that sleep duration is a determinant of peripheral insulin sensitivity in patients with type 1 diabetes . in the current study we included the data of only seven patients with type 1 diabetes . the strictly controlled design of this pathophysiological study in combination with the fact that each subject served as his / her own control enabled us to establish subtle effects of partial sleep deprivation on parameters of insulin sensitivity . nonetheless , larger numbers of subjects are required to assess the involvement of relevant patient characteristics such as sex , age , and antecedent glucoregulation on the effects of sleep restriction on insulin sensitivity . this is the first study that documents an adverse effect of partial sleep restriction on insulin sensitivity in patients with type 1 diabetes . in healthy subjects , , it can be expected that sleep restriction increases postprandial glucose levels in patients with type 1 diabetes in the absence of concurrent adaptations of the dose of exogenous insulin . several epidemiological studies documented an association between chronic partial sleep restriction and development of insulin resistance and type 2 diabetes ( 5,16,17 ) . therefore , exposure to chronic sleep restriction might contribute to insulin resistance in patients with type 1 diabetes . in turn , insulin resistance is associated with an increased risk for microvascular and macrovascular complications in type 1 diabetes ( 18 ) . unfortunately , the current study was not designed to elucidate the mechanisms involved in the induction of insulin resistance by partial sleep deprivation . a single night of partial sleep restriction to 4.5 h does not cause endocrine changes that simply explain the induction of insulin resistance ( 19 ) . subsequent nights of partial sleep deprivation induce subtle changes in cortisol and catecholamine secretion ( 7,15,20 ) . however , the relations between these effects of sleep deprivation on endocrine homeostasis and glucose tolerance are uncertain . partial sleep deprivation for a single and subsequent nights increased the sympathetic tone based on recordings of heart rate variability after sleep deprivation ( 21,22 ) . however , the relationship between elevated sympathovagal balance at the level of the heart and the sympathetic outflow to liver , muscles , and adipose tissue is uncertain ( 21 ) . interestingly , in addition to sleep duration , the composition of sleep in terms of sleep stages is also a determinant of insulin sensitivity . selective suppression of slow - wave sleep , without a change in total sleep duration , decreased glucose tolerance in healthy subjects ( 23 ) . the differential effects of altered sleep composition versus decreased total sleep duration on insulin sensitivity awaits further study . data on sleep physiology and sleep disturbances in patients with type 1 diabetes are rare . jauch - chara et al . ( 24 ) reported alterations in neuroendocrine sleep architecture and a trend toward less slow - wave sleep in 14 patients with type 1 diabetes . children with type 1 diabetes have a more disrupted sleep than healthy children ( 25 ) . if type 1 diabetes indeed causes disruption of sleep patterns , this may in turn impair glucose regulation , creating a vicious circle . in conclusion , the present study indicates that partial sleep restriction decreases insulin sensitivity of insulin - mediated glucose uptake in patients with type 1 diabetes . it is important to further assess the relationship between sleep physiology and glucoregulation in patients with type 1 diabetes . | objectivesleep restriction results in decreased insulin sensitivity and glucose tolerance in healthy subjects .
we hypothesized that sleep duration is also a determinant of insulin sensitivity in patients with type 1 diabetes.research design and methodswe studied seven patients ( three men , four women ) with type 1 diabetes : mean age 44 7 years , bmi 23.5 0.9 kg / m2 , and a1c 7.6 0.3% .
they were studied once after a night of normal sleep duration and once after a night of only 4 h of sleep .
sleep characteristics were assessed by polysomnography .
insulin sensitivity was measured by hyperinsulinemic euglycemic clamp studies with an infusion of [ 6,6 - 2h2]glucose.resultssleep duration was shorter in the night with sleep restriction than in the unrestricted night ( 469 8.5 vs. 222 7.1 min , p = 0.02 ) .
sleep restriction did not affect basal levels of glucose , nonesterified fatty acids ( nefas ) , or endogenous glucose production .
endogenous glucose production during the hyperinsulinemic clamp was not altered during the night of sleep restriction compared with the night of unrestricted sleep ( 6.2 0.8 vs. 6.9 0.6 mol kg lean body mass1 min1 , ns ) .
in contrast , sleep restriction decreased the glucose disposal rate during the clamp ( 25.5 2.6 vs. 22.0 2.1 mol kg lean body mass1 min1 , p = 0.04 ) , reflecting decreased peripheral insulin sensitivity .
accordingly , sleep restriction decreased the rate of glucose infusion by 21% ( p = 0.04 ) .
sleep restriction did not alter plasma nefa levels during the clamp ( 143 29 vs. 133 29 mol / l , ns).conclusionspartial sleep deprivation during a single night induces peripheral insulin resistance in these seven patients with type 1 diabetes .
therefore , sleep duration is a determinant of insulin sensitivity in patients with type 1 diabetes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tinnitus is the perception of sound when an external stimulus is absent , and can be classified as either objective or subjective , depending on patient history and physical examination . objective tinnitus can be triggered by vascular abnormalities , a patulous eustachian tube , abnormalities of the palatine or middle ear muscles , or defects in other structures . tinnitus caused by middle - ear myoclonus is rare , and is usually assumed to develop secondarily to abnormal movement of the stapedius muscle or the tensor tympani . we present a rare case of myogenic tinnitus attributable to abnormal stapedius and/or tensor tympani muscle contraction , concomitant with eye blinking or eye closure . a 45-year - old female presented complaining of low - pitched unilateral left - ear tinnitus 2 months in duration , which commenced during descent of an aircraft in which she was travelling . the sound was present only when she blinked or closed her eyes , and occurred on every blink . the noise could not be easily characterized ; it was a " combination of a buzz and chewing gum - like sound " . no other ear symptom , such as otalgia , otorrhea , vertigo , or facial palsy , was evident . she had no history of any systemic illness , head trauma , or exposure of the ear to noise or any toxic drug . on otoendoscopic examination , the auricles , external auditory canals , and tympanic membranes of both ears were normal , but , whenever the patient blinked , to - and - fro movements of both tympanic membranes were evident , especially the posterior halves . interestingly , she did not complain of rightside tinnitus ; however , the right - side tympanic membrane also moved when she blinked ( fig . thus , we recorded left - side tinnitus that was not audible when a stethoscope was placed on the outer ear . neither direct examination nor fiber - optic nasopharyngoscopy revealed any sign of palatal myoclonus ( supplementary videos 1 and 2 in the online - only data supplement ) . both tympanograms were of type a ; the middle - ear pressure was normal when the patient did not blink ( fig . however , and interestingly , saw - tooth patterns associated with tympanic membrane movement were obtained during blinking ( fig . the tinnitus was considered to be attributable to stapedial muscle contraction , based on the reductive change in impedance audiometry compliance during blinking . temporal bone computed tomography ( ct ) revealed no abnormal lesion such as trauma , infection , or a vascular or neoplastic disease . initially , we explained the condition to the patient and reassured her over 2 weeks . one week later , the tympanic membrane mobility was markedly reduced and the tinnitus well - controlled . on a visual analog scale , the tinnitus intensity fell from three to one . occasionally , a causative lesion can be identified in the brainstem or cerebellum via magnetic resonance imaging ; however , most cases are idiopathic . middle - ear muscular tinnitus is highly variable in nature , being most commonly described as crackling , but also as clicking , tapping , thumping , pulsatile , " ( like a ) fluttering moth " , mechanical rumbling , buzzing , gushing , and whooping . stapedius muscle contraction is thought to produce a buzzing sound , and tensor tympani contraction a clicking . sound may also be caused by snapping or cracking of mucous membranes of the eustachian tube in response to peritubal muscle contraction , although the most frequent symptom is autophony . rock believed that the sounds were not intrusive in most subjects , being easily ignored ; awareness of sound was closely associated with individual sensitivity . in our patient , both tympanic membranes moved upon blinking , but she did not complain of right - side tinnitus . periodic movements of the tympanic membrane can often be seen upon otomicroscopy , and a rhythmic tremor of the soft palate may be noted upon flexible nasopharyngoscopic examination . the tremor may be recorded ( for later evaluation ) during conduct of acoustic reflex testing or impedance audiometry . no differential diagnosis of stapedius muscle contraction from tensor tympani contraction has yet been described , and , currently , no objective method exists by which the two conditions may be distinguished . definitive diagnosis requires tympanotomy with direct exploration of contraction of the stapedius tendon or tensor tympani . in our patient , the reductive change in impedance audiometry compliance during blinking was suggestive of stapedial muscle contraction . facial nerve impulses directed to the orbicularis oculi muscle are presumed to spread abnormally toward the stapedial muscle . several features of middle ear myogenic tinnitus suggest that the condition is of psychogenic origin . described tinnitus - masking devices and chan and palaniappan developed zygomatic pressure maneuvers that should be used before resorting to medication or tenotomy . medical management with carbamazepine ( up to 200 mg three times daily ) has been associated with variable degrees of success . close monitoring of potential side - effects such as bone marrow suppression , and development of liver and/or kidney abnormalities , is required . if conservative management is ineffective , botulinum toxin injections or surgical resection of the middle ear muscle tendon are possible . we describe an unusual form of unilateral middle - ear muscular tinnitus concomitant with eyelid blinking , but in the absence of facial nerve palsy . thorough history - taking , otoendoscopy , and stapedial reflex testing during eye closure , yielded important objective diagnostic data ( particularly the irregular perturbations evident upon reflex testing ) ; such workup is recommended when encountering this form of muscular tinnitus . | tinnitus is a common auditory phenomenon associated with many otological diseases , and is usually subjective .
objective tinnitus can be generated by para - auditory structures , usually derived from vascular or myogenic sources , or the eustachian tube .
we present a rare case of intermittent unilateral tinnitus associated with eye blinking .
otoendoscopic examination showed that the external auditory canals and tympanic membranes were normal ; however , rhythmic movements of both tympanic membranes , concomitant with the tinnitus , were evident whenever the patient blinked .
the tympanometry and stapedial reflexes measured via impedance audiometry exhibited saw - tooth patterns ; movement of the tympanic membrane was associated with eyelid blinking .
the patient was managed conservatively , with reassurance and medication , and the condition became well - controlled . here ,
we present this educational case and review the literature . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
traumatic neuropathies ( tn ) due to work accidents , sports injuries , and high - speed road accidents are a common cause of disability and quality of life impairment in the young adult population [ 1 , 2 ] . peripheral nerve damage can be classified as neurotmesis ( disruption of both axons and nerve sheath ) , axonotmesis ( disruption of axons with preserved integrity of endoneurium , perineurium , and epineurium ) , or neuroapraxia ( temporary damage of myelin sheath without damage of axons ) . open injuries with evidence of neurotmesis necessitate primary reconstructive surgery ( s - i ) , while secondary surgical exploration ( s - ii ) can be considered in closed lesions with poor clinical and electrodiagnostic ( edx ) spontaneous recovery in order to determine the extent of tn and perform the necessary microsurgical reconstruction . edx studies may be useful to evaluate distal muscle reinnervation , topography , and severity of tn . however , only few correlations have been currently reported with nerve regeneration processes and no consensus exists regarding the most appropriate measure of functional recovery [ 2 , 58 ] . the identification of neurophysiological markers with clinical prognostic value would be thus of the utmost relevance in the clinical and surgical management of tn . this large observational multicentre study reports the three years prospective data of 307 tn patients treated with surgery and/or conservative approaches in six italian specialized centres ( italian traumatic neuropathy network ) . our main aims were to identify predictors of clinical functional recovery and to evaluate the clinical prognostic role of edx studies in patients receiving medical treatment , primary and/or secondary surgery . patients referred to the italian traumatic neuropathy network between january 2010 and december 2011 were enrolled in the study after signing a written informed consent ( ethical committee approval prot . number 0023037 , number cei-227 ) and the evaluation of study inclusion criteria , namely , age 14 years - old , compliance with diagnostic tests , and no previous evidence of neuropathy . baseline ( t0 ) clinical / edx evaluations were performed after 3 months from surgery in the group of patients treated with s - i ( open lesions with evidence of neurotmesis ) and after 3 weeks from the tn event in the group of patients treated with nonsurgical ( ns ) approach or s - ii ( close lesions with poor spontaneous recovery after 46 months of follow - up ) . patients received regular clinical / edx assessments at t1 ( 46 months ) , t2 ( 12 months ) , t3 ( 24 months ) , and t4 ( 36 months ) , with the aim of evaluating signs of clinical and/or neurophysiological recovery ( figure 1 ) . patients were evaluated by means of the modified rankin scale ( mrs ) , at baseline and at different time - points ( figure 1 ) , considering a decrease of 1 point in the mrs as a follow - up clinical improvement . edx studies were performed in accordance with the protocols suggested by ferrante and wilbourn for bp injuries and by preston and shapiro for radiculopathy and mononeuropathies : needle electromyography ( emg ) included observation of any abnormal spontaneous activity , qualitative evaluation of motor unit action potentials ( muaps ) , and evaluation of maximal voluntary recruitment ( mvr ) , which was rated as ( a ) absent ( no muaps ) ; ( b ) discrete ( individual muaps ) ; ( c ) reduced ( decreased recruitment of muaps ) ; or ( d ) normal ( interference ) . nerve conduction studies were carried out using surface electrodes to measure compound muscle action potential ( cmap ) and sensory nerve action potential ( snap ) amplitudes . findings different by more than two standard deviations ( sd ) from each laboratory normative data were considered abnormal . follow - up edx improvement was defined as follows : ( a ) cmap and snap amplitudes = increase of at least 16% versus baseline values ; ( b ) mvr pattern = increase of mvr in at least 1 target muscle ; and ( c ) reinnervation muaps = evidence of 2 reinnervation muaps in at least 1 target muscle . skin temperature was measured with a digital thermometer and kept constantly above 32c with an infrared lamp . mann - whitney u , wilcoxon rank sum , and cramer 's v tests were used for comparison between and within groups , while a multiple logistic regression model was used to calculate the prognostic accuracy of each edx marker in the prediction of clinical recovery , considering mrs improvement as a dependent variable and edx outcome measures as predictive ( independent ) variables . associations were analyzed by crude evaluations and then specified ( reevaluated ) , considering the most important confounding factors ( i.e. , sex , age , site of injury , dominant hemisphere , and polytrauma surgery ) . all p values reported are two - tailed , considering 0.05 as statistical threshold . baseline clinical and edx data were available for 307 consecutive patients ( table 1 ) for a total of 444 tn ( table 2 ) . mechanisms of injury included contusion ( 36% ) , stretching ( 35% ) , transection ( 15% ) , ischemia ( 13% ) , and avulsion ( 1% ) , resulting in 117 plexopathies ( 72% axonotmesis ; 26% neurotmesis ; and 2% neuroapraxias ) , 75 root lesions ( 12% axonotmesis ; 76% neurotmesis ; and 12% neuroapraxias ) , and 252 nerve lesions ( 64% axonotmesis ; 32% neurotmesis ; and 4% neuroapraxias ) . complete clinical and edx follow - up data were available for 307 patients ( figure 1 ) at t0 , t1 , and t2 ; 29 patients dropped out at t3 and 36 patients dropped out at t4 : 91/307 patients received surgery ( 21 s - i and 70 s - ii ) and 216/307 were treated with conservative medical approach ( table 1 ) . indications to surgery included ( a ) double - level bp + root lesions ( 82% of cases received surgery ) ; ( b ) root avulsion ( 56% of cases received surgery ) ; ( c ) double - level bp + nerve lesions ( 44% of cases received surgery ) ; ( d ) bp lesions ( 29% of cases received surgery ) ; ( e ) and nerve lesions ( 24% of cases received surgery ) . according to the multiple regression analysis of clinical outcome ( table 3 ) , the increase of cmap amplitude correlated with mrs clinical improvement ( or 3.76 ; ci 1.618.76 ) , especially in the s group ( or 7.25 ; ci 1.243.87 ) and in patients with bp lesions ( or 9.65 ; ci 1.6456.75 ) . moreover , snap amplitude correlated with clinical improvement in the ns group ( or 4.35 ; ci 1.1416.69 ) . no correlations were found between age , gender , or dominant hemisphere and clinical functional outcome , while surgical treatment per se was associated with worse clinical outcome ( or 0.27 ; ci 0.120.61 ) , reflecting the more severe baseline clinical conditions ( table 1 ) . the improvement of at least one edx marker was associated with a more accurate prediction of clinical recovery in ns versus s groups ( p < 0.001 ) : 64% of patients in the ns group versus 31% of patients in the s group reported a clinical and edx improvement ( p < 0.001 ) , while 23% of patients in the ns group versus 53% in the s group reported only edx improvement ( p < 0.001 ) , 3% of patients in the ns group versus 5% in the s group reported only clinical improvement ( p = 0.3 ) , and 10% of patients in the ns group versus 11% in the s group reported no clinical or edx improvement ( p = 0.8 ) . this prospective multicentre study reports the 36-month follow - up data of 307 patients with tn , including plexopathies , root avulsions , and peripheral nerves lesions . the main objective was to evaluate the prognostic role of edx on nerve regeneration processes and identify prognostic neurophysiological markers of clinical recovery after surgical or conservative treatments . we found a correlation between the increase of snap amplitude and peripheral nerve spontaneous recovery and between cmap amplitude and clinical improvement in s - i and s - ii groups . no significant correlations were found between reinnervation muaps or changes in the mvr pattern and clinical outcomes . these data highlight the central role of nerve conduction studies in the assessment of the peripheral nerve regeneration processes , confirming the results of previous observational studies on traumatic radial nerve lesions and idiopathic / traumatic brachial plexopathies [ 14 , 15 ] . our data seem to suggest that the improvement of snaps might represent a precocious index of axonal regeneration , which could precede muscular reinnervation , strength recovery , and cmap improvement . however , our findings showed a different profile of clinical / edx functional recovery in patients treated with surgical or conservative treatments , with a higher prevalence of isolated edx amelioration in the surgical groups . the more severe baseline condition of patients who received surgery , characterized by neurotmesis and/or severe axonotmesis , and frequently involving multiple nerves could partially account for these results . however , these data may also confirm the importance of an appropriate surgical timing , especially in proximal lesions involving cervical roots and bp , which should reinnervate distal target muscles before irreversible changes occur . in conclusion , an individual clinical approach is required in tn patients , so that a correct diagnosis ( level and site ) is achieved , optimal therapy ( conservative versus surgical ) is planned and , in case of poor clinical recovery , the most appropriate timing for surgical procedures is decided . great importance should be given to the first edx evaluation , which might provide important information on the severity of damage , while serial edx assessments might be helpful in following the peripheral nerve recovery ; a gradual increase of snap amplitude may suggest a conservative treatment , while surgical exploration is recommended in patients with poor spontaneous recovery after 6 months . standardized clinical / edx protocols seem advisable : ( a ) patients with open lesions treated with peripheral nerves primary surgery require an accurate monitoring of cmap amplitude , which represents the most sensible indicator of clinical recovery ; ( b ) patients with closed trauma should be carefully evaluated with clinical / edx assessments , in order to identify the site and level of the nerve injury and monitor the cmap and snap amplitudes . the lack of improvement after 46 months is a negative prognostic factor suggesting secondary surgical exploration . | objectives . this prospective , observational , multicentre study aims to identify electrodiagnostic ( edx ) markers of clinical recovery in patients with traumatic neuropathy ( tn ) receiving surgical ( s ) and nonsurgical ( ns ) treatments
. methods .
subjects referred to the italian traumatic neuropathy network between 2010 and 2011 ( 307 patients , for a total of 444 tn ) were evaluated with serial clinical / edx evaluations at 6 , 12 , 24 , and 36 months of follow - up .
results .
primary surgery was performed in 21 subjects with open lesions and evidence of neurotmesis , while closed lesions were treated with either conservative medical approach ( 216 patients ) or secondary surgery ( 70 patients ) , according to the clinical spontaneous recovery at 46 months . clinical improvement correlated with the increase of the compound muscle action potential amplitude ( or 3.76
; ci 1.618.76 ) , particularly in the s group ( or 7.25 ; ci 1.243.87 ) , and with sensory nerve action potential amplitude in the ns group ( or 4.35 ; ci 1.1416.69 ) .
no correlations were found with needle electromyography qualitative evaluations , changes in maximal voluntary recruitment , age , and gender .
conclusions .
nerve conduction studies ( ncs ) represent the more accurate neurophysiological markers of clinical outcome in patients with tn . significance .
serial ncs assessments predict the functional recovery in tn , increasing the accuracy of peripheral nerves surgical decision - making process . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
there are various causes of wrist pain , such as osteoarthritis , de quervain s disease , carpal tunnel syndrome , wrist ulnar nerve compression , trigger finger , sudeck s atrophy , inflamatuar arthritis ganglion cysts . while there are many reasons causes of wrist pain , scaphoid stress fracture can also come to similar complaints rarely . the scaphoid is the most frequently fractured carpal bone , and approximately 1% of scaphoid fractures are bilateral . approximately 8895% of acute scaphoid fractures are said to heal with conservative treatment using cast immobilisation . in the case presented here , it was aimed to present an unusual cause of chronic wrist pain due to the bilateral stress fractures of the scaphoid bone . a 19-year - old boy presented with a 4-year history of mild pain and occasional swelling of both wrists especially after a physical activity . the patient had been working as an electrical technician , for the last 4 years and had been playing on a soccer team since the age of 15 years , usually practising for approximately 8 h per week . he played as a goalkeeper and he did not relate the onset of pain to any specific injury or blow . initially , pain was only present during forced dorsiflexion . thereafter , pain became almost continuous even without any movement . he presented at the orthopaedic polyclinic with complaints of pain in both wrists . the patient did not smoke . in the physical examination , anteroposterior ( ap ) , lateral and oblique radiographs were taken of both wrists . from the wrist radiographs , a diagnosis was made of herbert b2 waist - type fracture in both scaphoids . the diagnosis was confirmed by computerised tomography and magnetic resonance imaging ( mri ) ( fig . d ) . mri was performed on both wrists so as to rule out other pathologies and to define the onset of fracture type ( acute or chronic ) . the patient was called for follow - up examinations at 2-week intervals at which radiographs were taken . both scaphoid plaster casts were removed in the 12th week and 3-way radiographs were evaluated for fracture union and whether or not there was transverse trabeculation ( fig . these measurements are that the distance between the fracture fragments is less than between the carpal bones , there is less sclerosis in the ends of the fracture than the amount of subchondral sclerosis in the other carpal bones , there are no degenerative changes in the bone and the distance between the 2 fragments on the stress radiographs has not changed . one month of physical rehabilitation , the patient had regained full range of motion and grip strength in the wrists and returned to full pre - injury activities . after 28 months of treatment with plaster cast , the mayo clinic modified wrist evaluation scale was used for functional evaluation and the patient 's final score was 85 . this force causes an imbalance between the resorption and growth of bone , both of which go on all the time , the patient presented with a stress fracture of both scaphoid bones secondary to repetitive dorsiflexed movements . weber and chao showed that the scaphoid was fractured under the pressure accumulated on the radial - palmar side while the wrist was in extension . in the present case , the stress fracture of the scaphoid was due to the repetetive dorsiflexion forces of the wrist . non - surgical treatment is successful for scaphoid fractures in children and for those fractures which are non - displaced , stable , and where there is no damage to other bones or ligaments . in stable fractures , union is achieved within 812 weeks . however , long absence from work or sports with wrist stiffness , muscle weakness , that occurs with prolonged cast immobilisation , has led some authors to argue that even in undisplaced fractures , internal fixation is an efficient alternative especially in simultaneous bilateral cases . there are published studies which do not recommend conservative treatment for young and active patients . in the case presented here , both treatment methods were explained to the patient and surgical treatment was recommended . we had a successful result in the treatment of these stress fractures with long - arm thumb plaster cast . in a study by terkelsen and jepsen , the incidence of non - union was not found to be greater in patients with a removable short - arm plaster cast than in patients treated with a long - arm thumb plaster cast . in contrast , gellman et al . reported that in patients to whom a long - arm thumb plaster cast was applied for 6 weeks from the beginning , union time was 3 months early kaneshiro et al . showed a change of place of more than 3 mm of fracture fragments during pronation and supination in forearm short - arm thumb plaster casting in an experimental study where scaphoid fractures were created . long - arm thumb plaster casting was used for the case presented here . in a study by singh et al . , of 66 patients treated with below - the - elbow plaster cast for 812 weeks for scaphoid fracture , 22 cases of partial union and 14 cases of delayed union were reported from ct examination at 1218 weeks . in the case presented here , fracture union was observed on ct examination in the 12th week . in conclusion it can be said that bilateral stress fractures of the scaphoid can be considered for the wrist pain , especially for the patients that had repetetive minor wrist trauma , and in spite of developments in surgical techniques and materials used , treatment by plaster casting should still be considered initially for non - displaced , stable scaphoid stress fractures . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . the patient was under the care of fevzi saglam , deniz gulabi , and zeki tasdemir analayzed the data and infection markers . | highlightswe examine changes in the treatment of scaphoid fractures.in this case , the patient presented with what was considered to be a rare case of a stress fracture of both scaphoid bones secondary to repetitive dorsiflexed movements.it was aimed to present an unusual cause of chronic wrist pain due to the bilateral stress fractures of the scaphoid bone . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
staphylococcus aureus is one of the most important causative agents in both hospital- and community - acquired infections ( 1 ) . this bacterium can cause various types of infection , including sepsis , pneumonia , wound sepsis , endocarditis , catheter - related infections , and urinary tract infections ( utis ) ( 2 ) . methicillin - resistant staphylococcus aureus ( mrsa ) strains are resistant to a large group of antibiotics called beta - lactams , including penicillins and cephalosporins ( 3 ) . pbp2a has much lower affinity to beta - lactam antibiotics compared to pbp2 , which is the main physiological target of methicillin . because of the high distribution of mrsa , these bacteria are now resistant to certain other antibiotics , such as tetracyclines , aminoglycosides , and lincosamides . these drug - resistant strains have become more difficult to treat ( 5 , 6 ) . aminoglycosides are important antibiotics used to treat a variety of bacterial infections , particularly those caused by staphylococci ( 7 ) . aminoglycosides bind to the 30s ribosomal subunit of the bacterium and interrupt rna translation , leading to bacterial death ( 8) . this class of antibiotics are often used in combination with beta - lactams and glycopeptides to treat infections , such as bacterial endocarditis , caused by staphylococci and enterococci ( 9 ) . the three mechanisms of resistance to aminoglycosides are changes in the position of the ribosomal binding site for the drug , reduced permeability of the drug , and drug inactivation by enzymes . the enzymatic inactivation by aminoglycoside - modifying enzymes ( ames ) is an important mechanism of resistance in staphylococcal species . these enzymes are classified on the basis of modifying effects in three different categories : aminoglycoside acetyl transferases ( aacs ) , aminoglycoside phosphotransferases ( aphs ) , and aminoglycoside - nucleotidyltransferases ( ants ) . three enzymes , aac ( 6)/aph ( 2 ) , aph ( 3)-iii , and ant ( 4 ) , are encoded by aac ( 6)-ie / aph ( 2 ) , aph ( 3)-iiia , and ant ( 4)-ia genes , respectively . these are the most common modifying enzymes among staphylococcus species , and are clinically important ( 10 ) . high levels of resistance to methicillin , the continuing spread of mrsa strains , and the high resistance to aminoglycosides in these strains have been reported several times in iran ( 11 - 13 ) . with an emphasis on the role of combination therapy against staphylococcal infections , it is necessary to monitor the antibiotic susceptibility of s. aureus in order to identify and prevent the spread of resistant strains . the purpose of this study was to evaluate the drug - resistance profile of mrsa , as well as to detect aminoglycoside - resistant genes isolated from hospitalized patients in sari and tehran , iran . in this cross - sectional study , 174 clinical isolates of mrsa were collected from specimens such as wounds , blood , sputum , tracheal exudate , bronchus , pleura , catheter , and urine of inpatients at three hospitals , zare ( sari , iran ) and loghman and pars hospitals ( tehran , iran ) , during march - november 2014 . all isolates were cultured on mannitol salt agar medium ( merck , germany ) , and identification of s. aureus was done using gram staining and conventional biochemical tests , such as catalase , coagulase , and dnase ( merck , germany ) ( 14 ) . finally , the isolates were stored in tryptic soy broth ( tsb ) ( merck , germany ) containing 15% glycerol , and stored at -70c until future processing . the disk diffusion method was used for the phenotypic detection of mrsa . for this purpose , oxacillin ( ox ) and cefoxitin ( fox ) discs on mueller - hinton agar plates containing 4% nacl were used , as recommended by the clinical and laboratory standards institute ( clsi ) guidelines ( 15 ) . isolates with a zone of inhibition of < 21 for oxacillin and < 13 mm for cefoxitin were considered mrsa . staphylococcus aureus atcc700698 was used as the positive control for mrsa strains . to determine the antibiotic susceptibility pattern of mrsa strains , sensitivity to the following antibiotics was assessed : rifampin ( 5 g ) , trimethoprim + sulfamethoxazote ( 30 g ) , gentamycin ( 10 g ) , erythromycin ( 15 g ) , ciprofloxacin ( 5 g ) , clindamycin ( 2 g ) , cefazolin ( 30 g ) , doxycycline ( 30 g ) , and cefoxitin ( 30 g ) ( mast , uk ) . antibiotic susceptibility testing was performed according to the kirby - bauer disk diffusion method and the results were interpreted with respect to clsi guidelines ( 15 ) . in addition , the minimum inhibitory concentration ( mic ) of vancomycin was determined with the standardized micro - dilution broth method according to the clsi . genomic dna was extracted using a commercially available dna extraction kit ( qiaamp dna mini kit ) according to the manufacturer s instructions . for confirmation of mrsa , the meca gene was detected by pcr with the specific primers listed in table 1 ( 16 ) . staphylococcus aureus atcc700698 was used as the positive control for meca gene detection ( 17 ) . for detection of the aac ( 6)-ie / aph ( 2 ) , aph ( 3)-iiia , and ant ( 4 ) genes , which are the most common aminoglycoside - modifying enzymes among the staphylococci , the pcr method was performed with specific primers ( table 1 ) ( 18 ) . all pcr mixtures were prepared in a 25 l volume containing 12.5 l of pcr master mix ( amplicon , denmark ) , 1 mmol of each primer , 3 l of dna template , and 7.5 l of deionized water . the mixtures were placed in a thermocycler ( pio intellectica , canada ) , and the pcr products were then visualized by electrophoresis in agarose gel , stained with ethidium bromide , and examined under uv illumination . all data were analyzed with spss version 22 . for compression of the presence of drug - resistance patterns of mrsa isolates in each area , the chi - square test was used . a p value of < 0.05 was accepted as statistically significant . in this cross - sectional study , 174 clinical isolates of mrsa were collected from specimens such as wounds , blood , sputum , tracheal exudate , bronchus , pleura , catheter , and urine of inpatients at three hospitals , zare ( sari , iran ) and loghman and pars hospitals ( tehran , iran ) , during march - november 2014 . all isolates were cultured on mannitol salt agar medium ( merck , germany ) , and identification of s. aureus was done using gram staining and conventional biochemical tests , such as catalase , coagulase , and dnase ( merck , germany ) ( 14 ) . finally , the isolates were stored in tryptic soy broth ( tsb ) ( merck , germany ) containing 15% glycerol , and stored at -70c until future processing . the disk diffusion method was used for the phenotypic detection of mrsa . for this purpose , oxacillin ( ox ) and cefoxitin ( fox ) discs on mueller - hinton agar plates containing 4% nacl were used , as recommended by the clinical and laboratory standards institute ( clsi ) guidelines ( 15 ) . isolates with a zone of inhibition of < 21 for oxacillin and < to determine the antibiotic susceptibility pattern of mrsa strains , sensitivity to the following antibiotics was assessed : rifampin ( 5 g ) , trimethoprim + sulfamethoxazote ( 30 g ) , gentamycin ( 10 g ) , erythromycin ( 15 g ) , ciprofloxacin ( 5 g ) , clindamycin ( 2 g ) , cefazolin ( 30 g ) , doxycycline ( 30 g ) , and cefoxitin ( 30 g ) ( mast , uk ) . antibiotic susceptibility testing was performed according to the kirby - bauer disk diffusion method and the results were interpreted with respect to clsi guidelines ( 15 ) . in addition , the minimum inhibitory concentration ( mic ) of vancomycin was determined with the standardized micro - dilution broth method according to the clsi . genomic dna was extracted using a commercially available dna extraction kit ( qiaamp dna mini kit ) according to the manufacturer s instructions . for confirmation of mrsa , the meca gene was detected by pcr with the specific primers listed in table 1 ( 16 ) . staphylococcus aureus atcc700698 was used as the positive control for meca gene detection ( 17 ) . for detection of the aac ( 6)-ie / aph ( 2 ) , aph ( 3)-iiia , and ant ( 4 ) genes , which are the most common aminoglycoside - modifying enzymes among the staphylococci , the pcr method was performed with specific primers ( table 1 ) ( 18 ) . all pcr mixtures were prepared in a 25 l volume containing 12.5 l of pcr master mix ( amplicon , denmark ) , 1 mmol of each primer , 3 l of dna template , and 7.5 l of deionized water . the mixtures were placed in a thermocycler ( pio intellectica , canada ) , and the pcr products were then visualized by electrophoresis in agarose gel , stained with ethidium bromide , and examined under uv illumination . all data were analyzed with spss version 22 . for compression of the presence of drug - resistance patterns of mrsa in this study on hospitalized patients conducted during 2014 , 174 mrsa isolates were obtained from various clinical samples , including blood ( 3.1% ) , sputum ( 6.2% ) , tracheal exudates ( 31.9% ) , lung ( 15.5% ) , pleura ( 7.1% ) , catheters ( 8% ) , urine ( 10% ) , and wounds ( 18.2% ) . the isolates from each hospital drug - susceptibility testing results showed that the highest resistance in tehran was to erythromycin ( 84.4% ) , while the highest resistance in sari was against gentamicin ( 75% ) ( table 4 ) . resistance to gentamicin as an indicator of aminoglycoside resistance was observed in 71.7% of the isolates from tehran . the aac ( 6)-ie / aph ( 2 ) gene was detected in 134 ( 77% ) of the 174 isolates ( figure 2 ) . in total , the aph ( 3)-iiia and ant(4)-ia genes were detected in 119 ( 68.4% ) and 122 ( 70.1% ) of the isolates , respectively ( table 5 , figures 3 and 4 ) . m , ladder 100 bp ; lane 1 , negative control ; lane 2 , positive control s. aureus ( atcc700698 ) ; lanes 3 6 , clinical samples . m , ladder 100 bp ( fermentas , uk ) ; lane 1 , positive control s. aureus ( atcc43300 ) ; lane 2 , negative control ; lanes 3 6 , clinical samples . m , ladder 100 bp ; lane 1 , negative control ; lane 2 , positive control s. aureus ( atcc43300 ) ; lanes 3 - 6 , clinical samples . m , ladder 100 bp ; lane 1 ; lane 2 , negative control ; lane 4 , clinical samples ; lane 5 , positive control s. aureus ( atcc43300 ) . in the present study , the prevalence of aminoglycoside resistance in mrsa strains in iran was evaluated , and high resistance rates were observed . in addition , most of the isolates had mdr features . according to our results , vancomycin is still a good choice against mrsa in iranian clinics . it is important to be aware that aminoglycoside - resistant mrsa is distributed in hospitals in iran , and should not be neglected . during the past few decades , s. aureus has become the most common cause of nosocomial infections ( 20 , 21 ) . one of the success factors of this bacteria is its resistance to drugs . with the arrival of each new antibiotic , resistant strains of bacteria have rapidly emerged and the treatment of infections caused by these strains has become difficult . for example , after the introduction of penicillin to the market for the treatment of hospitalized patients , penicillin - resistant strains quickly appeared ( 22 ) . therefore , the rapid and accurate identification of mrsa is necessary in order to help physicians make appropriate selections for antibiotic treatment , and to prevent the spread of these species ( 16 ) . according to askari et al.s meta - analysis and systematic review in 2012 , the overall prevalence of mrsa in iran varied from 20% to 90% , with the average prevalence in tehran found to be 52% ( 23 ) . thus , considering the importance of the pathogenesis and increasing prevalence of mrsa in recent years , regular monitoring of the antibiotic susceptibility of isolates is necessary to control and prevent the spread of resistant strains . our study showed that the rate of methicillin resistance in the two investigated tehran hospitals reached 43.5% , compared to 11.3% in the sari hospital . factors that may affect the prevalence of mrsa in different parts of the world include different infection - control policies , the amount of antibiotics and how they are prescribed , the predominant population or types of strains , and the laboratory methodologies used for mrsa detection ( 24 , 25 ) . despite their nephrotoxicity , ear toxicity , and problems associated with bacterial resistance , aminoglycosides continue to be effective , particularly for the treatment of staphylococcal infections ( 25 ) . cell wall synthesis inhibitors such as beta - lactams lead to increased uptake of aminoglycosides , and antibiotic combinations have useful and valuable antimicrobial properties ( 26 ) . several studies have shown a relationship between resistance to aminoglycosides and resistance to methicillin ( 27 ) . in some countries , moreover , resistance to gentamicin is especially important because it is often used in the treatment of staphylococcal endocarditis in combination with a beta - lactam or a glycopeptide ( 28 ) . sensitivity of s. aureus isolates to gentamicin is a marker for sensitivity to other aminoglycosides . in the present study , we considered not only the aac ( 6)-ie / aph ( 2 ) gene , which encodes the aac ( 6)-aph ( 2 ) enzyme responsible for gentamicin resistance , but also other modifying enzymes ( 18 , 28 , 29 ) . in this study , drug - susceptibility testing showed rates of gentamicin - resistant mrsa strains of 71.7% in tehran and 75% in sari . previous studies showed that the aac ( 6')/aph ( 2 ' ) gene is the most prevalent gene encoding ame enzymes among clinical mrsa isolates in european countries ( 18 ) . choi et al . obtained similar results in south korea in 2003 ( 19 ) . their results showed that the prevalence of the aac ( 6')/aph ( 2 ' ) gene among mrsa isolates was 65% , followed by the aph ( 3')-iiia and ant ( 4')-ia genes at 41% and 9% , respectively ; our results were in accordance with these . in a study conducted by ardic and colleagues in 2006 , the aac ( 6')/aph ( 2 " ) gene was found in 66% of mrsa isolates , followed by the ant ( 4)-ia and aph ( iiia ) genes at 24% and 8% , respectively ( 30 ) . in contrast , in a survey conducted by ida et al . in 2001 on 381 clinical isolates in japan , the prevalence of ant ( 4)-ia was 84.5% , which was higher than the rate of two other genes ( 31 ) . yadegar et al . ( 2009 ) reported a prevalence of the ant ( 4')-ia gene as 58% , higher than other modifying enzyme genes among mrsa strains isolated from tehran hospitals ( 32 ) . the present study s results were similar to the majority of studies , in which aac ( 6')/aph ( 2'')-ia was the predominant gene . in this case , 78.3% and 72.2% of mrsa isolates carried the aac ( 6')/aph ( 2'')-ia gene in tehran and sari , respectively . in conclusion , aminoglycoside - resistant genes are different in various mrsa colonies in different geographical regions ( 31 ) . also , the aac ( 6')/aph ( 2 ' ) gene products cause higher resistance to aminoglycosides among mrsa isolates in iran . moreover , we can conclude that in different geographical regions of iran , different genes may be the cause of aminoglycoside resistance . with regard to the high rate of aminoglycoside - resistant mrsa isolates in our study , we recommend that the use of aminoglycosides against mrsa infections must be limited in iranian hospitals . even natural products ( 33 ) can be used to help in the treatment and eradication of such drug - resistant cases . | backgroundstaphylococcus aureus is one of the most important causative agents in community- and hospital - acquired infections .
aminoglycosides are powerful bactericidal drugs that are often used in combination with beta - lactams or glycopeptides to treat staphylococcal infections.objectivesthe main objective of the present study was to determine the prevalence of aminoglycoside resistance among methicillin - resistant staphylococcus aureus ( mrsa ) isolates in hospitalized patients in sari and tehran , iran.methodsin this study , 174 mrsa strains isolated from different clinical samples , such as blood , sputum , tracheal exudates , bronchus , pleura , urine , wounds , and catheters , were collected from hospitalized patients in tehran and sari during 2014 .
antibiotic susceptibility testing was performed against nine antibiotics with the kirby - bauer disk diffusion method according to clsi guidelines .
the mrsa strains were examined with oxacillin and cefoxitin disks .
mrsa was then validated by detection of the meca gene .
pcr was used to evaluate the prevalence of the aminoglycoside - resistance genes aac ( 6)-ie / aph ( 2 ) , aph ( 3)-iiia , and ant ( 4 ) among the mrsa isolates.resultsthe results of drug susceptibility testing showed that the highest rate of resistance was against erythromycin in tehran ( 84.4% ) and gentamicin ( 71.7% ) in sari .
all isolates were sensitive to vancomycin , and all strains harbored the meca gene .
the aac ( 6)-ie / aph ( 2 ) , aph ( 3)-iiia , and ant ( 4)-ia genes were detected among 134 ( 77% ) , 119 ( 68.4% ) , and 122 ( 70.1% ) of the isolates , respectively.conclusionsthe present study showed a high prevalence of aminoglycoside - resistance genes among mrsa isolates in two cities in iran . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the peptide nociceptin / orphanin fq ( n / ofq ) was isolated for the first time in 1995 by two distinct research groups from rat and porcine brain extracts . n / ofq is composed by seventeen amino acids residues , and this peptide was nominated nociceptin due to the hyperalgesic effects that it evokes after supraspinal administration . the other name , orphanin fq , was given by the reinscheid 's group due to the fact that this peptide displayed affinity to an orphan receptor actually , this was one of the first well - experienced cases of reversal pharmacology ; while f and q were used to discriminate the amino acids phenylalanine from the n - terminal and glutamine located in the c - terminal position . n / ofq is a neuropeptide sharing sequence homology with classical opioid peptides , but with a distinct pharmacological profile . n / ofq was being considered an opioid - like peptide , since it is structurally related to endogenous opioids , particularly dynorphin a ; however , n / ofq does not bind to classical opioid receptors . additionally , n / ofq is the endogenous ligand for the n / ofq peptide ( nop ) receptor ( nominated before as opioid receptor like-1 , abbreviated as orl-1 ) , which is closely related to the opioid receptor family , but does not bind opioid ligands . nop , similar to the opioid family , is a receptor coupled to a g - protein . thus , the activation of the n / ofq signaling via nop receptor can lead , among other effects , to inhibition of adenylate cyclase , blockade of ca , and opening of k channels ( for a review , see ) , as described in details in section 5 . the n / ofq peptide precursor ( ppn / ofq ) and nop receptor are widely expressed in the nervous system as well as in peripheral organs and the immune system . in the central nervous system , of particular interest is the expression of nop receptor in the forebrain , including cortical areas , olfactory regions , the thalamus , and a variety of limbic structures , such as the hippocampus , the amygdaloid complex , and in several nuclei of the hypothalamus , that are involved in the processing of emotional stimuli . some brainstem areas , as the periaqueductal gray , on serotoninergic and noradrenergic nuclei ( i.e. , raphe complex and locus coeruleus ) , and several sensory and motor nuclei also express nop receptors ( for a review , see ) . in contrast to the expression of nop receptors , the distribution of the ppn / ofq mrna is almost limited to the limbic areas [ 6 , 7 ] . in the periphery , nop receptor has been detected in the peripheral nervous system and several organs , such as rat intestine and vans deferens , retina , heart , porcine gastrointestinal tract and kidney , and several guinea - pig ganglia . however , one of the principal locations of the nop receptor in the periphery is the immune system . mrna transcripts for the nop receptor have been detected in mouse splenic lymphocytes ( cd4 , cd8 , cd4 , and cd8 ) . in the human immune system , nop receptors are also expressed in lymphocytic b and t - cell lines , monocytic cell lines , circulating lymphocytes , and monocytes [ 13 , 14 ] . taken together , this wide central and peripheral distribution of nop expression may explain the broad spectrum of biological actions of this peptidergic system . in fact , in vivo , experimental studies have demonstrated that n / ofq modulates a variety of biological functions , such as nociception [ 1 , 2 ] , food intake , learning and memory processes , spontaneous locomotor activity , rewarding actions of opioids and ethanol , and responses to stress and anxiety . peripheral effects , such as hypotension , bradycardia , diuresis , inhibition of gastrointestinal and airway motility , and/or some reflexes such as coughing and the micturition reflex have also been reported for n / ofq . most recently , the effects of n / ofq - nop receptor system in modulating immune functions have received particular attention , in special its involvement in sepsis , inflammatory , and autoimmune diseases . in this review , we focus on summarizing the experimental evidence that suggests an important role played by this peptidergic system in the modulation of the immune functions , and we highlight the potential therapeutic effects of nop ligands in the treatment of diseases which involve immune responses . neuropeptides have been described as important source of immunoregulatory molecules [ 2527 ] . in this line , several evidence suggests that n / ofq - nop pathway may act as a potent regulatory during immune response . in 1995 , halford and colleagues reported for the first time the expression of nop receptors in mouse lymphocytes , while at the same year , wick et al . described the expression of nop receptor mrna in human peripheral blood lymphocytes and lymphocytic cell lines . in agreement , in 1998 , peluso and colleagues detected the expression of mrna nop receptor in the human normal circulating lymphocytes and also in monocytes . still in 1998 , pampusch et al . demonstrated that nop receptors are also expressed in the porcine immune cells and , in 2000 , the same research group reported the expression of nop receptor and ppn / ofq mrna in porcine lymphoid tissue , such as thymus , lymph nodes , spleen , and freshly isolated splenocytes . later , it was demonstrated that high - affinity binding sites for n / ofq are distributed in human mononuclear and polymorphonuclear leukocytes [ 31 , 32 ] . additionally , the incubation of human neutrophils with n / ofq elicited intracellular signaling which was mimicked by the nop synthetic agonist , ro 64 - 6198 , thus reinforcing that nop receptors are present and functional in human neutrophils . in 2002 , for the first time , it was reported that the peripheral blood mononuclear cells transcribe ppn / ofq . additionally , it was reported that n - formyl - methionine - leucine - phenylalanine-(fmlp- ) stimulated polymorphonuclear neutrophils rapidly secrete n / ofq by exocytosis , indicating that at least in neutrophils this neuropeptide is stored in preformed vesicles rather than de novo synthesized . nowadays , it is accepted that numerous immune cells were found to secrete n / ofq , thus pointing to these inflammatory cells as a source of n / ofq . importantly , several inflammatory mediators including bacterial products ( i.e. , lipopolysaccharide , lps ) and cytokines could modulate both the transcription of ppn / ofq mrna and its protein expression [ 33 , 34 ] . therefore , n / ofq seems to act as a paracrine , autocrine , and/or endocrine immunomodulator , since activated immune cells led to the induction of nop receptor mrna , and the same activated cells were able to express n / ofq . based on in vitro and in vivo studies , many biological actions were reported for n / ofq and nop receptor system in modulating immune functions . in vitro studies have shown that n / ofq evokes chemotaxis of polymorphonuclear and human monocytes , and when injected in murine air pouches ( an animal model to study leukocyte infiltration in vivo ) , n / ofq elicits leukocyte infiltration in a concentration - dependent manner . further studies aiming to investigate the mechanisms by which n / ofq stimulates chemotactic responses suggest that these effects are mediated by nop receptors , since the selective blockade of nop receptors prevent these actions . it was found also that n / ofq - stimulated polymorphonuclear neutrophils infiltration was inhibited by treating mice with a synthetic analog of the aspirin - triggered lipid mediator 15-epi - lipoxin a4 . taken together , these data suggest that n / ofq , via activation of nop receptor signaling , acts as a potent chemoattractant , possibly due to the involvement of arachidonic acid products . evidence from the literature also suggests that n / ofq - nop receptor system plays a role in regulating chemoattractant responses of leukocytes through chemokine suppression . chemokines are now known to be involved in mediating chemotaxis , integrin activation and leukocyte - endothelial cell interactions , leukocyte degranulation , and release of inflammatory mediators and angiogenesis ( [ 37 , 38 ] ; for a review , see ) . kaminsky and rogers reported that n / ofq suppresses the production of ccl2/mcp-1 and ccl5/rantes chemokine protein in both primary cd14 human monocytes and monocyte - like cell lines . however , this suppression does not seem to be at the level of transcription , as n / ofq treatment did not alter the mrna levels for these chemokines in monocytes . a series of data support a modulatory effect of n / ofq under cellular immunity , as summarized below . peluso and colleagues demonstrated that in vitro n / ofq could decrease the proliferative response of human peripheral blood mononuclear cells stimulated with phytohemagglutinin . miller and fulford have found that both the il-2 production and t lymphocyte proliferation induced by the mitogen con a were inhibited by n / ofq . elegant data described by researchers from mcleod 's laboratory have elucidated the mechanism by which n / ofq modulates human t - cell response . first , the authors showed that n / ofq inhibits the proliferative response of t cells activated by staphylococcal enterotoxin b ( seb ) presented by chinese hamster ovary ( cho ) cells transfected with human hla dr4 and cd80 , and in a subsequent work , they showed that the suppressive effect of n / ofq on the t - cell proliferation could be blocked by the nop receptor antagonist ufp-101 , an anti - cd80 antibody , an inactivator of transforming growth factor- ( tgf- lap ) , l - name , and l - nmma ( both nos inhibitors ) . they also have shown that n / ofq induces the expression of the immunosuppressive modulator indoleamine 2,3-dioxygenase ( ido ) . in view of the factors modulating ido expression , it was suggested that n / ofq decreases t - cell proliferation through ido expression by a mechanism involving ifn- , tgf- , prostaglandin and nitric oxide . the ability of n / ofq - nop receptor system in modulating humoral immunity was also described in the literature . recently , it has been demonstrated that n / ofq , added in vitro to murine spleen cells at picomolar concentrations , caused a significant suppression of antibody formation against sheep red blood cells , which was reversed by nop antagonists . in addition , n / ofq given in vivo by osmotic pump for 48 h suppressed the capacity of spleen cells cultured ex vivo to produce anti - sheep red blood cell antibody . these studies showed that n / ofq directly inhibits an adaptive immune response , that is , antibody production , both in vitro and in vivo . in agreement with the evidence for an immunosuppressive effect evoked by n / ofq , du and colleagues have shown that in normal rats the intracerebroventricular administration of n / ofq , at nmol doses , reduced the nk cell activity . however , in rats under surgical trauma , n / ofq antagonised the immune function depression , and this anti - immunosuppression evoked by n / ofq was completely reversed by the pretreatment with the antisense oligonucleotide to nop receptor mrna . taken together , a growing body of evidence suggests a complex role for n / ofq in modulating , by inhibiting or activating , immune functions depending on the nature of the stimuli . it is well established that regulation of immune and inflammatory responses depends on cytokines signaling . therefore , it is expected that n / ofq evokes immune responses as a result of the modulation of cytokine activity or expression . however , it is possible that the altered expression of cytokines is due to the nop receptor signaling - induced production of regulatory mediators which , in turn , lead to altered levels of cytokines ( for a review , see ) . there is no consensus regarding the role of n / ofq on inflammatory and immune responses . in fact , goldfarb and colleagues demonstrated that in c57bl/6j mice the intraperitoneal injection of n / ofq ( 55 nmol / kg ) 30 min before challenge with staphylococcal enterotoxin a ( sea , 5 g ) caused a significant increase in levels of spleen tnf- and ifn- mrna , without causing any significant effects on il-1 and il-2 mrna levels . moreover , mice lacking the n / ofq precursor gene showed diminished tnf- and ifn- transcripts in the spleen in response to sea challenge , suggesting that n / ofq system can exacerbate the immune function . by contrast , following the induction of trauma in rats , zhao and colleagues found typical robust increases in both tnf- and il-1 transcripts in peritoneal macrophages , but when n / ofq was intracerebroventricularly administered , both tnf- and il-1 expression was attenuated in these cells . additionally , n / ofq immunoreactive cells and mrna for nop receptor were significantly reduced after trauma in cerebral cortex , hippocampus , and hypothalamus of rats . still under traumatic stress , high levels of il-1 transcript in hippocampus were antagonised by icv administration of n / ofq , and these effects were reversed by the treatment with an nop receptor antagonist , thus suggesting that the effects of n / ofq in the cytokines expression could depend on the tissues , pretreatment time , dose and via of n / ofq administration , and nature of stimuli . obviously , further studies at this point should be performed in order to give additional information about the role played by the n / ofq - nop receptor system in the modulating cytokines expression . it is worthy of mentioning that the inflammatory process is a necessary step for induction of protective immunity and to contain the infections , but can also lead to dangerous effects , if uncontrolled . hence , an imbalance between proinflammatory and anti - inflammatory mediators , between th1/th17 effector cells and t regulatory cells may result in hyperinflammatory or autoimmune diseases . considering the bidirectional relationship between the n / ofq - nop and the immune system , it is possible that nop receptor signaling modulates the outcome of some inflammatory diseases including sepsis , autoimmunity , and possibly the transplantation rejection , a condition not investigated yet . the complex syndrome of sepsis is characterized by impaired recruitment of neutrophils , inability of the immune system to limit bacterial spread during an ongoing infection and systemic inflammation associated with deleterious accumulation of neutrophils in vital organs , especially the lung that culminates in multiple organ failure [ 4850 ] . the systemic inflammatory response syndrome ( sirs ) , hallmark sign of sepsis , is characterized by a systemic inflammatory response with massive release of proinflammatory cytokines such as tnf- , il-1 , chemokines , nitric oxide , leukotrienes , reactive oxygen species [ 51 , 52 ] . this response is counterregulatory by a compensatory anti - inflammatory response syndrome ( cars ) through the secretion of inhibitory molecules such as il-10 and tgf-. it has been suggested that in septic patients a delicate balance between the pro and anti - inflammatory mediators are decisive to the outcome of disease , since the proinflammatory phase is necessary for both the recruitment of neutrophils and induction of microbicidal activity but also responsible for the failure of neutrophils migration to the infectious focus . in addition , it may be related to subsequent immunosuppression [ 49 , 54 ] . using the caecal ligation and puncture ( clp ) model of sepsis , our group have demonstrated that the administration of the nop receptor antagonist ufp-101 , immediately after surgery , promoted a significantly reduction on mortality rate of septic rats compared with clp - untreated rats . in this study , we observed that the protective dose of nop antagonist was able to prevent the massive influx of inflammatory cells into both the lung and bacterial dissemination . these protective effects were associated with significant decrease in plasmatic levels of tnf- , il-1 , and ccl2 . it should be mentioned that this beneficial effect of ufp-101 was evident after a single drug injection after induction of clp , suggesting that the n / ofq - nop system plays an important role in modulating the early phases of the septic process . the molecular mechanisms by which the nop receptor antagonist , ufp-101 have protected septic rats are under investigation by our group . in our study , we did not evaluate the role of nitric oxide and other regulatory molecules such as programmed death-1 ( pd-1)/pd-1 ligands , tgf- , and clta-4 ( cytotoxic t - lymphocyte antigen 4 ) . although we have detected a decreased number of bacteria in the blood , it was not investigated whether nop antagonist modulates directly or indirectly the bactericidal activity of neutrophils . additional data have supported the idea that high levels of n / ofq in septic patients may contribute to its pathogenesis . despite the small size of the sample , it was found that septic patients who died within 30 days ( n = 4 ) displayed higher n / ofq plasmatic levels compared with survivors ( n = 17 ) . however , when evaluating the role of n / ofq - nop receptor system in a complex event such as sepsis , we should be aware of the broad range of effects evoked by nop receptor signaling , that contribute to the septic condition , such as impairment of cardiovascular performance and tissue perfusion , beside the immune responses herein discussed ( for a review see ) . very recently , stamer and colleagues have shown that peripheral blood cells from patients with sepsis had higher n / ofq and lower ppn / ofq mrna expression than healthy controls . again , these observations suggest the involvement of the nop - n / ofq system in inflammation and impaired immune function in sepsis . corroborative data showing the involvement of n / ofq - nop system in the physiopathology of other immune disturbances have been described . in this regard , fiset and colleagues found high levels of n / ofq in the synovial fluid but not in the plasma of patients with arthritis . in view of the presence of n / ofq and polymorphonuclear cells accumulation in the inflammatory synovial cavity of arthritic patients , further studies are imperative to investigate the involvement of n / ofq - nop receptor at the beginning of the inflammatory process . using a mouse model of bowel disease induced by the injection of dextran sulfate sodium , kato and colleagues demonstrated that both the inflammatory response and severity of disease were associated with the upregulation of n / ofq expression . furthermore , nop knockout mice did not develop colitis , thus indicating the participation of n / ofq in disease . regarding the histopathological findings , the authors found that the number of t lymphocytes ( t cd4 and t cd8 ) , b lymphocytes , macrophages , and neutrophils present in the colonic mucosa of dextran sulphate sodium - treated nop - deficient mice was significantly lower than the number of those found in wild - type animals . concerning parkinson 's disease , the second most common age - associated progressive neurodegenerative disorder , the inflammation , oxidative stress , and microglia - mediated neurotoxicity of dopaminergic neurons in the substantia nigra are considered the hallmark of disease [ 6063 ] . some findings for neuroinflammatory mechanisms leading to the immunopathology of parkinson 's disease include microgial activation , secretion of tnf- , il-1 , il-2 , il-6 , and ccl5 , antibody against different components of dopaminergic neurons , expression of inducible nitric oxide synthase , astrogliosis , shift to th1 phenotype , increased number of activated t cells , and other inflammatory markers [ 6062 , 6469 ] . several preclinical studies reported by professor 's morari 's group have suggested the participation of n / ofq in the physiopathology of parkinson 's disease [ 7074 ] . interestingly , an enhancement of n / ofq expression and release in 6-hidroxydopamine hemi - lesioned rats was detected in the lesioned substantia nigra compared with the unlesioned , indicating that parkinsonism may be associated with overactivation of nop receptor signaling . furthermore , the pharmacological blockade of nop receptor signaling attenuates parkinsonian - like behavior in 6-hydroxydopamine hemi - lesioned , haloperidol , and reserpine - treated rodents , whereas deletion of the nop receptor gene conferred mice protection from these symptoms [ 71 , 74 , 75 ] . corroborating to the view that n / ofq - nop receptor system plays an important role in parkinson 's disease , very recently , marti and colleagues found increased levels of n / ofq in the cerebrospinal fluid of parkinsonian patients compared with nonparkinsonian . the ofq / n system modulates many functions in a variety of immune cells including monocytes , macrophages , neutrophils , mast cells , and lymphocytes by a mechanism not clearly elucidated yet . table 1 summarizes some of these functions , the participation of n / ofq in the neuroimmune axis , and the mechanisms underlying some immunoregulatory activities triggered by nop receptor activation . nop receptor together with the classical opioids ( , , ) receptors belongs to the g - protein - coupled receptor ( gpcr ) family , which plays a vital role in the transduction of signals regulating several effectors . regarding to n / ofq , some authors have described that the nop activation by its natural ligand or agonists induces the activation of k conductance and inhibition of voltage - gated ca channels and either augments ( via activated -subunit of gs class of g - protein ) or decreases ( via the activated form of the gi / go ) camp formation in a variety of cells including immune cells [ 1 , 2 , 4 , 8688 ] . n / ofq also induces stimulation of phospholipase c ( via -subunit of gq ) , which leads to 1,4,5-triphosphate ( ip3 ) and diacylglycerol production and also to ca - dependent protein kinase c ( pkc ) activation ( for a review , see [ 83 , 89 , 90 ] ) . it was also demonstrated that in cho cells the type of g - protein involved in pkc activation by n / ofq were a gi / o g - protein . moreover , n / ofq modulates extracellular signal - regulated kinase ( erk ) , p38 , c - jun n - terminal kinase ( jnk ) isoforms of mitogen - activated protein kinase ( mapk ) [ 82 , 90 , 92 , 93 ] , and the transcription of a variety of genes involved in immune and inflammatory responses [ 83 , 94 ] . it had been suggested that the signal transducer and activator of transcription ( stat3 ) may be involved in the transduction of nop signaling [ 90 , 95 ] . considering the glia - immune cells communication , it was demonstrated that lps , il-1 , and tnf- increase the levels of n / ofq mrna and immunoreactivity in rat astrocytes in culture by a mechanism dependent of the activation of erk 1/2 , p38 map kinases and the transcription factor creb . it was demonstrated that nfb pathway appears to be involved in the induction of n / ofq transcription by lps . n / ofq has been shown to cause ib kinase ( ikk ) phosphorylation and ib degradation in sh - sy5y human neuroblastoma cells . recently , donica and colleagues showed that n / ofq increases the nuclear translocation , binding to dna , and activation of transcription . hence , the activation of nfb by n / ofq may be critical for many immune functions . as commented above , n / ofq belongs to the opioid family , but despite the structural homology between ligands and receptors , there is no evidence that n / ofq activates opioid receptors , neither classical opioid ligands activate nop receptor . importantly , nop and ppn / ofq mrna are found expressed constitutively in distinct cells of the immune system [ 1 , 45 , 96 ] , while kappa opioid receptors are constitutively expressed in lymphocytic cells , but this is not the case of mu and delta opioid receptors [ 13 , 98 ] . additionally , beta - endorphin and dynorphin are expressed and secreted by immune cells , including t cells , and upregulated in these cells by various stimuli [ 99103 ] . it is wellknown that cytokines , mediators typically released from immune cells , are potent regulators of mu - opioid receptor gene expression . in fact , mu receptors are not constitutively expressed in immune cells , but these receptors are upregulated in t cells and b cells following pretreatment with interleukin 4 ( il-4 ) and tnf- [ 104 , 105 ] . thus , suggesting a putative role of classical opioids in the regulation of the immune functions . it is well documented that opioid peptides cause immunosuppressive effects in some assays and stimulatory actions in others [ 106108 ] , however , morphine , which is a preferred mu receptor agonist , generally has been found to be immunosuppressive in a variety of assays . the current review has showed that n / ofq has immunomodulatory actions , by stimulating or inhibiting the immune system . however , little information is still available in the literature regarding the relationship between n / ofq and classical opioid systems . anton and colleagues showed that n / ofq inhibits antibody formation in a naloxone - insensitive manner , thus suggesting that n / ofq effects , at least in this particular case , are not mediated by classical opioid receptors . another recent evidence that show no interaction between n / ofq - nop receptor system and the classic opioid system is coming from a clinical study , in which patients suffering from cancer who were taking opioid medication ( morphine or equivalents ) did not display any significant alterations in nop and ppn / ofq expression compared with those who did not receive opioids pretreatment . these observations suggest that , despite the immunosuppressive effects of opioid in addicted patients , the mechanisms by which classical opioids affect immune functions , especially in the periphery , did not seem to be related to the n / ofq - nop receptor system . considering the expression of classical opioids ( ligands and receptors ) and n / ofq - nop receptor in the central nervous system , beside the immune cells , a putative neuroimmune cross - talk could be suggested . it is accepted that classical opioids depress the immune function , due to the activation of the hypothalamic - pituitary - adrenal axis ( hpa ) , thus increasing corticoid hormone production . in fact , intracerebroventricular injection of n / ofq in rats led to increased plasma adrenocorticotropic hormone ( acth ) concentrations and corticosterone under resting conditions . n / ofq administered to rats under mild stress enhanced the raised acth response to stress and prolonged the higher concentrations of corticosterone , while ufp-101 , an nop receptor antagonist , significantly attenuated plasma acth and corticosterone compared to saline injection in lps - treated rats . however , under a more stressful stimulus , such as restraint , central injection of n / ofq did not affect the elevated plasma concentrations of acth or corticosterone . additionally , leggett et al . found increased corticotrophin - releasing factor ( crf ) and corticotrophic pro - opiomelanocortin ( pomc ; a protein precursor of acth , beta - endorphin , and met - enkephalin ) mrna into the parvocellular paraventricular nucleus expression due to lps challenge compared to non - lps treated rats . additionally , the intracerebroventricular administration of ufp-101 in lps - treated rats was associated with increased pomc mrna expression 4 h after injection and a clear trend towards increased parvocellular crf mrna . taken together , a neuroimmune cross - talk between the n / ofq - nop receptor and classical opioid systems seems to be occurring and could be involved in the modulation of the immune responses . in conclusion , there is no consensus regarding the role of n / ofq - nop receptor system in modulating inflammatory and immune responses . in fact , some studies have shown that n / ofq is able to evoke chemotaxis , inhibit cellular and humoral immunity , and increase or suppress the expression of proinflammatory cytokines , such as tnf- and ifn-. certainly , these immunological effects evoked by this peptidergic system make the nop receptor an attractive therapeutic target for the treatment of inflammatory diseases , such as sepsis , rheumatoid arthritis , colitis , and other immunological disturbances . interesting enough , preclinical findings from animal models of sepsis , colitis , and parkinson pointed to the blockade of nop receptor signaling as beneficial to diseases ' outcome . additional support to the involvement of n / ofq in mediating these pathologies was found in human body fluids from patients suffering from sepsis , arthritis , and parkinson , which displays increased n / ofq levels . thus , showing the vast range of immune functions evoked by n / ofq , an extensive research in basic and clinical sciences is mandatory to further investigate the potential therapeutic effects of nop ligands in the treatment of inflammatory diseases . | nociceptin / orphanin fq ( n / ofq ) is a seventeen - amino acid peptide that is the endogenous ligand of a g - protein - coupled receptor ( nop ) .
various immune cells express the precursor protein and secrete n / ofq as well as display binding sites for this peptide . the functional capacity of nop receptor was demonstrated in vitro and in vivo studies by the ability of n / ofq to induce chemotaxis of immune cells , to regulate the expression of cytokines and other inflammatory mediators , and to control cellular and humoral immunity . in this context , n / ofq could modulate the outcome of some inflammatory diseases , such as sepsis and autoimmune pathologies by mechanisms not clearly elucidated yet . in fact , human body fluid revealed increased levels of n / ofq under sepsis , arthritis , and parkinson 's diagnose .
preclinical studies pointed to the blockade of nop receptor signaling as successful in treating these experimental conditions .
further preclinical and clinical studies are required to investigate the potential of nop ligands in treating inflammatory diseases . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
engineered nanomaterials
( enms ) , such as silver nanoparticles ( agnps ) ,
have been used in many existing technologies and may impact many future
applications . for example , agnps are being
explored in inhalation therapy for respiratory infections and allergic
airway inflammation because of their potent antimicrobial properties . these enms will eventually end up in the environment , and human
exposure by multiple routes , including inhalation , is likely . another possible exposure is to aerosol
sprays or via inhalation of water droplets containing agnps . the toxicity of agnps that is responsible for
their medicinal use has been investigated , which is attributed to the toxicity of ag ions in aqueous
solution , a species that possess antimicrobial properties and is found
to react with various biomolecules . given that agnps can enter the lungs through inhalation and agnps
may be potentially toxic , it is important to know the impact of enms
such as agnps on the human body but especially the lung , where they
will likely deposit when inhaled . the determination of the actual
ag species in the lungs at different
stages following deposition is important for understanding the origin
of toxicity for agnps . unlike other more stable nanomaterials such
as gold nanoparticles , agnps may be significantly modified in the
body and especially in the lungs , which are both an oxidizing and
reducing environment . for example ,
agnps dissolve in water at different ph and in the cellular and biological
environment to form ag ions . for instance , ag ions can be reduced to
form small nanoparticles in pants or other environments . it is also known that ag in au / ag core shell nanostructures
( 80 nm in diameter ) dissolve in water under x - ray irradiation
and much smaller ( < 5 nm ) agnps are formed . the dissolved ag ions
are chemically reduced by species available in solution , such as solvated
electrons generated in water under x - ray irradiation . this again suggests
that large agnps can dissolve and reform into smaller agnps in a redox
environment . on the basis of these findings ,
it is entirely possible that agnps may be partially or completely
modified and continue to change in the lungs , and it is critical to
identify and track transient ag species in the lungs as a means to
determine their eventual fate and understand those factors that may
contribute to toxic effects . several analytical methods can
characterize the physicochemical
properties of nanomaterials in the lungs , although each has its own
shortcomings . mass spectrometry
( icp - ms ) and recent work using autometallography can help locate small
amounts of ag in the lungs . however , critical chemical
information such as oxidation state and whether the original agnps
stay intact or are dissolved and reduced to form smaller agnps can not
be revealed using these methods . traditional centrifuge separation
in combination with atomic absorption spectroscopy can not conclusively
assign the chemical state of ag species because small ( 1 nm
diameter ) ag neutral nanoparticles may stay in the supernatant after
centrifugation , even at 13 000 rpm or filtered with membranes . x - ray photoelectron spectroscopy ( xps ) may be used to identify the
chemical state of the nanomaterials and their derivatives . in addition , the sample
size is extremely small because xps is a surface probe approach , so
only a small portion of the sample is probed . electron microscopy ,
such as transmission electron microscopy ( tem ) , may be difficult to
employ to study the chemical state of enms in the environment and
body because of the limitation of being able to only perform basic
elemental analysis . as a result , none
of the reported methods can detect the needed physicochemical properties
of ag species in the lungs , information that is key to understanding
the observed biological responses to agnps . x - ray absorption
spectroscopy ( xas ) is a powerful method to study
the properties of enms in biological systems including the lungs . xas is equivalent to a local electron diffraction
method that can probe the chemical environment or local , short - range
order around a specific x - ray absorbing element , which can be ag if
agnps are under investigation . xas can determine at least two critical
chemical parameters : chemical shift and local bonding environment . the first parameter can be used to determine the oxidation state of
the element under investigation . the second can be used to infer the
size or surface area of nanoparticles and whether ag species are in
metallic nanoparticles , oxide nanoparticles or dissolved in water . the sensitivity of xas is high , down to micrograms of ag in grams
of tissues , suitable for detecting agnps in lung tissues under inhalation
conditions . in addition , x - rays are highly penetrating , capable of
studying most elements including ag and au in mm thick samples . to
date , xas has been used to study silver nanomaterials ( agnms ) in several
different background materials , predominantly at room temperature and seldom at low temperatures . hence xas is a promising method to determine chemical information
on the ag species in the lungs . one challenge for performing
xas measurements is that those experiments
are generally conducted at national facilities and it is critical
to minimize changes occurring to enms in lung tissues retrieved after
an in vivo , preferably inhalation , exposure . these exposures are often
conducted at specialized facilities far from the site of eventual
analysis . because lung tissues are full of oxidative and reducing
agents , even after the animals are sacrificed , ag species may continuously
change chemically until xas measurements are conducted . as a result ,
the samples and experimental protocols have to be designed to eliminate
further evolution of the transient ag species . here we present
the outcome of the first attempt to use xas to
characterize ag species in rat lungs after inhalation exposure of
aerosolized agnps . in the following , we have found that xas can ,
in principle , be used to retrieve important chemical information on
the ag species in the lungs from animals that have undergone practical
exposure scenarios , such as inhalation of aerosolized enms . through
this study , we have established proper protocols to employ xas to
study enms in rat lungs after inhalation and have obtained results
that may help shed light on the mechanisms of transport and fate of
agnps in the lungs . the current work focuses on the study of evolution
of agnps in the lungs after deposition . ( san diego , ca ) , and were supplied by the national institute
of environmental health sciences centers for nanotechnology health
implications research ( ncnhir ) consortium . agnps were 20 and 110 nm
in diameter and stabilized with a citrate coating . agnps were at a
concentration of 1 mg / ml in 2 mm citrate aqueous solution and were
stored in the dark at 4 c . 88 nm diameter gold
nanoparticles ( aunp ) cores were synthesized in a seed growth method
modified from an established protocol . then 50 l of haucl4 was added
to 150 ml of milliq ( mq ) water . once at reflux and with vigorous stirring ,
6 ml of 1 wt % sodium citrate was injected rapidly . the solution was
refluxed for 15 min and then allowed to cool to room temperature . 0.3 g
of poly(vinylpyrrolidone ) ( pvp ) in 10 ml of mq water was added to
the final solution . centrifugation
and washing was performed twice and the aunps resuspended into 5 ml
of mq water . the 5 ml of aunps was added to 37.5 ml of ethanol and
0.5 ml of 28 wt % nh3oh . with stirring , we added 0.5 ml
of tetraethyl orthosilicate ( teos ) , and the reaction proceeded overnight . the solution was purified by centrifuging and washing with 40 ml of
mq water five times . agnps were aerosolized
using a bgi 6-jet collison nebulizer to produce liquid aerosol droplets . the droplets were dehydrated using two tsi diffusion dryers ( 3062 ,
tsi ) and charge was neutralized using a krypton-85 -particle
source prior to delivery to the nose - only exposure unit . excess particles were scavenged from the exposure unit into a filter
using a vacuum pump . particle mass concentration was determined using
gravimetric analysis of filters and particle number concentration
using a scanning mobility particle scanner ( smps , 3071/3010 , tsi ) ,
which was also used to measure the aerosol size . dawley
rats were obtained from harlan laboratories and acclimated 1 week
prior to exposure . rats were housed in two per cage and provided laboratory
rodent diet ( purina mills , st louis , mo ) and water ad libitum . all
animal experiments were performed under protocols approved by the
university of california davis iacuc in accordance with national institutes
of health guidelines . rats were conditioned to the exposure tubes
in the week prior to exposure by being housed in tubes for progressively
longer periods of time . rats were exposed once to an aerosol of 20
or 110 nm agnps for 6 h. animals were euthanized at the end of exposure
( t0 ) , or at 1 ( t1 ) , 3 ( for 20 nm aunps only , t3 ) , and 7 days ( t7 )
post exposure using beuthanasia - d at 7.5 ml / kg and exsanquination . the abdominal and thoracic cavities were opened , the trachea cannulated
and the lung was removed en block . the lung was immediately filled
with helium at 30 cm water pressure and frozen in 2-methylbutane over
liquid nitrogen . a 1.01.5 mm section was cut from of the center
of the left lobe , secured between two layers of clear adhesive tape
and stored at 80 c in an argon purged storage box . xas , which includes
both extended x - ray absorption fine structure ( exafs ) and x - ray absorption
near edge spectroscopy ( xanes ) , was employed to determine the oxidation
state and local chemical structure of the ag species in the lung . both methods are useful in revealing the chemical state of the element
of interest . the patterns of xanes of the
samples and different standards are often adequate to directly reveal
the chemical state of the element of interest . exafs requires simulation
but often providing more detailed structural information on the elements
of interest . the xas experiments were conducted at beamline
73 at the stanford synchrotron radiation lightsource ( ssrl ) . the beamline ( si ( 220 ) monochromator ) was optimized to detect x - ray
fluorescence of ag or au in the samples , while reducing the scattering
from the soft tissues and ice in the background . data collection was
performed either at room temperature or at 85 k. for measurements
performed at 85 k , the immediately frozen and inertly stored lung
samples were cooled to 85 k using a liquid helium thermal station . exafs data ( k edge of ag and l edge of au ) were measured using a multiple
element ge detector , and each sample took more than 6 h to measure . the signals from all the detector elements were summed to obtain the
exafs raw data . the background in the raw data was removed and the
exafs oscillation was obtained . the k range data was selected ,
deglitched , and then fourier transformed ( ft ) to the real space . interatomic
distances ( r ) , coordination numbers ( n ) , and disorders ( debye waller factor or ) were then
optimized to fit the exafs data in the k space . standard
deviation of the fitting parameter is estimated by changing the parameter
to double the fitting error . xanes spectra were processed similarly ,
although no ft was used and no fitting was performed . as a control , lung samples were also prepared and stored at room temperature without
the inert environment and measured at room temperature as well . the
xas data was processed similarly as described above . in analyzing
exafs data , we selected exafs in the energy space
from 25565 to 26050 ev for ag measurements , corresponding to k reciprocal space of 214 , which is broader than commonly used in the literature to retrieve
agnp structural information in environmental samples . generally speaking , the broader the k data range ,
the higher quality of exafs data . the broader range used here is enabled
by low temperature ( 85 k ) measurements and hence provides more accurate
exafs data and higher quality fittings . oxidation state ( os )
information was retrieved by examining the
chemical shift obtained from xanes data . second derivative was taken
against each xanes trace , and chemical shift ( cs ) of the samples was
calibrated against the same internal reference of a thin silver foil
at room temperature for each measured sample . for data with large
noise at the inflection point , analytical formulas were created to
fit the first derivative near the inflection point and then the shifts
of the xanes patterns were determined . oxidation state can be calculated
by comparing the chemical shift of the samples to that of ag foil
( os = 0.0 ) and agno3 ( os = + 1.0 ) . exafs data can directly
reveal the nature of chemical bonding environment
through the examination of the position and the amplitude of the peaks
in exafs data for the dominating ag species in the lungs . figure 1a and b show the exafs data in the reciprocal space
obtained at 85 k of the frozen and properly stored lungs tissues exposed
to 20 and 110 nm agnps at 0 , 1 , 3 ( only for 20 nm ) , and 7 days . figure 1d and e show the same exafs results after ft into
the real space . in the results shown here ( figure 1d and e ) there is only one dominant peak between 1 and 3
in the real space for all seven samples ( t0 , t1 , t3 , and t7 ) . this
peak corresponds to first ag ag coordination shell around the
x - ray absorbing ag or direct ag ag bonds in these samples . other peaks at greater distances represent higher - order coordination
shells around the absorbing ag . on the basis of this information , we conclude that ag species
in all seven samples are dominated by pristine metallic ag . this is
the first direct evidence that ag species carried into the lungs are
metallic , not oxides or sulfides , over an extensive period of time . the amplitude of the peaks in the exafs data reveals how the coordination
number changes over time . results shown in figure 1 display that the differences between exafs data for 20 and
110 nm agnps . for 110 nm agnps in the lungs as shown in figure 1d , ag in t1 samples has a slightly lower amplitude
than that of ag species in t0 samples . in contrast , amplitude for
t7 is less than half of that for t0 and t1 samples . the decrease in
the modulation amplitude for t7 sample is also obvious in the energy
space , as shown in figure 1a . for samples obtained
with 20 nm agnps starting material ( figure 1e ) , on the other hand , the similarity is that there is little ag o / n / cl / s scattering
and the main peak corresponds to ag the differences
are ( 1 ) the amplitude of the exafs peak of t0 for 20 nm agnps is significantly
lower than those of 110 nm agnps at similar time points and ( 2 ) the
change from day 0 to day 7 is less significant for ag obtained with
20 nm agnps than 110 nm agnps . these observations seem to agree with
the recently obtained inhalation toxicity data . from these data , it is evident that 20 nm agnps were modified
more significantly at the onset of deposition , but followed by smaller
changes over the 7-day period than 110 nm agnps . exafs results in reciprocal
( a c ) and real ( d f )
space . the samples include 110 nm ( a / d ) and 20 nm ( b / e ) agnps and
several reference samples ( c / f ) . figure d and f are the ft counterparts
of the plots shown in panels a and c , respectively . several silver references or standards , including a metallic
ag
foil , 20 and 110 nm agnps and frozen ag nitrate aqueous solution were
measured , and their results are shown in figure 1c and f. ag foil was the only sample that was measured at room temperature
while the rest were all measured at 85 k. exafs results for t0 of
110 nm shown in figure 1a and d are similar
to the pristine 110 nm agnps , but t0 data for 20 nm is quite different
from that of 20 nm pristine agnps : the 20 nm t0 sample has a much
lower exafs peak corresponding to ag ag scattering . both 20
and 110 nm pristine agnps in water are barely oxidized , as shown in
figure 1c and f , and they are close to the
pristine agnps . in contrast , there is no ag the agno3 data in the r space is obtained
from the k space exafs data with slightly a smaller
range of k space data of 29 because of the lack of oscillation beyond this range , especially
in the high k region . a single peak corresponding
to ag this peak is more difficult
to observe if the sample is measured at room temperature because of
greater disorder . the measured results of these references suggest
that the inhaled 20 and 110 nm agnps and their derivatives remain
metallic in rat lungs after 7 days , albeit the nanoparticles of two
sizes behaved differently . we also measured agno3 and 110 nm agnps incubated in
artificial lung fluids ( alf ) as well as 20 and 110 nm agnps in o2 bubbled water . agnps in o2 bubbled water did not change significantly compared with pristine
agnps . for agno3 in alf , there was clearly white precipitate
and the exafs results in the real space show only the ag amplitude
of the main exafs peak for ag in 110 nm agnps in alf sample is slightly
lower than pristine agnps , implying that alf could do the same to
agnps as the lungs did to the agnps . it is worth pointing out that
agnps were only incubated in alf for a few hours , possibly explaining
the relatively small decrease in amplitude of exafs signal in the
r space shown in supporting information figure si-1c . table 1 lists the fitted
parameters of r
( distance between two scatters ) , debye waller factors ( disorder
or ) and coordination numbers n of the lung samples studied
here and shown in figure 1 . in fitting , the
most intense peak between 1.0 and 3.0 corresponding to either
ag ag or ag o was isolated and selected and then fitted
to the selected data in a chosen k range in the reciprocal space .
the fitting is straightforward because of the dominant peak for most
of the samples . an example of the peak isolation and fitting is shown
in supporting information figure si-2 . chemical shift ( cs ) values are
obtained from xanes measurements described . on the basis of table 1 , it
is clear that
the two types of agnps continue to change in the lungs after inhalation / deposition .
for 110 nm , there is no initial drop from pristine to day 0 followed
by a significant drop of 52% from t0/t1 of 10.0 1.2 to day
7 of 4.87 0.70 . pristine 110 nm agnps and t0 ag species have
similar disorders , and n for the pristine agnps ( 9.2
0.7 ) and t0/t1 are within statistical errors . the average
n for 20 nm before inhalation is 8.6 0.4 , with a similar disorder
to t0 sample . immediately after inhalation , the n of ag in the lungs
at t1 drops to 5.8 0.19 , a 33% drop that may be caused by either
the inhalation process or how rat lungs take up these smaller nanoparticles . the n then only decreases further down to 3.50 0.24 , another
39% drop over the next 7 days . supporting information figure si-3 summarizes the results . the disorder varies only
slightly among these ag species measured
at 85 k. the disorder is slightly less for the pristine 110 nm agnps
and ag species in t0 sample . however , ag species in the lungs derived
from 110 nm agnps in t7 sample have a similar disorder even these
ag species have a much lower average n than the pristine agnps . the
disorders of other agnps measured at 85 k are similar , staying within
7% of the average value of 0.00365 . the disorder
for ag foil , the only sample measured at room temperature , is almost
three times that of other samples measured at 85 k and is very close
to the previous reported values . disorder
for agno3 is much higher , due to the randomness in distance
between ag cations and nearby oxygen or nitrogen in solution . in addition to exafs measurements , xanes can more directly detect
small changes to the oxidation state of the ag species in the samples
through the measurement of chemical shift . on the basis of figure 2a , it is evident
that day 7 sample of 110 nm agnps has a smaller modulation amplitude
than that of day 0 or 1 sample in the xanes region . the raw data showed
the modulation amplitude in t7 xanes data was about 50% of that t0
and t1 , agreeing with the exafs data . on the other hand , the chemical shifts ,
which are represented by the inflection points
or the shifts of the first derivative patterns of the xanes data ,
are listed in table 1 . the two benchmark samples
are bulk ag foil and agno3 , and the chemical shifts for
these two samples are 0.0 and + 2.4 ev . it is clear that nitrate has
a much greater chemical shift than ag foil in which ag species should
be neutral . ag species in 110 nm t0 sample and two other 110 nm agnp
control samples that are exposed to o2 and alf have approximately
no charge . there are small amounts of positive charge on ag in the
110 nm t1 and t7 samples , agreeing with the exafs data showing no
ag o peak . in contrast , all of the 20 nm agnp samples including
the pristine 20 nm agnps seem to have negative charge on them , meaning
that the ag species are chemically reduced instead of oxidized . xanes results
of the inhaled 110 and 20 nm agnps and references
samples . as a control , because of the protection layer of 20-nm
thick sio2 , we did not expect this nanomaterial be modified
in the lungs . the results of aunps@sio2 at t0 and t7 day
are shown in figure 3 . the background scattering
from ice / tissue is stronger due to the lower energy of x - rays used
to study the l edge of au at approximately 13 kev . xanes data shown
in figure 3a reveals no oxidation . from the
exafs data , which is shown in figure 3b / c ,
it is also clear that no oxidation occurred . it is important to note
that the exafs data of aunps@sio2 in t0 and t7 samples
are almost identical , without much change to n , which is in contrast
to those of agnps shown in figure 1d / e . it
indicates that aunps were largely the same after spending 7 days in
the lungs , while agnps underwent measurable transformations . xanes ( a ) and
exafs ( b / c ) data for the aunps@sio2 . there
is only one exafs peak in the real space in the direct bonding region
of 13 . the sample preparation
and measurement protocols are critical to
the success of the measurements . if not immediately frozen and stored
in the inert environment and measured at low temperatures , the xas
results are invalid . the data of these samples taken at room temperature
is shown in supporting information figure
si-4 . in contrast to immediately freezing / storage in the inert environment ,
agnps stored exposed to air and measured at room temperature were
completely oxidized and possibly dissolved . supporting
information figure si-4a shows the xanes results of these samples
without immediate freezing and storage in inert environment . ag species
of even 110 nm agnps in the lungs are mostly oxidized , similar to
that in agno3 ( aq ) . supporting information figure si-4b and c show the exafs results in the k and r space of the lung samples without immediate
freezing and storage in the inert environment . it is clear that the
quality of the data is poor in the high k region ,
because of the much larger debye waller factors or disorder
of the species under investigation at room temperature . for 110 nm
agnps , the peaks at the left of the main peak became more prominent
and the peak intensities increase further for o2 bubbled
agnps . in contrast , for 110 nm agnps in the lungs , whether it is after
1 or 7 days , the ag ag peak largely disappeared , similar to
that in the standard agno3 ( aq ) . these results suggest
that if the samples were not properly prepared and stored , 110 nm
agnps were completely oxidized or even dissolved in the lungs after
just 1 day because of the extensive time of several weeks between
the sample preparation and xas measurements . on the other hand ag scattering after o2 bubbling
through the agnps solution ( aq ) for 24 h. the results shown here demonstrate
the importance of properly treating and measuring the samples in order
to preserve the chemical state of ag species in lung tissues obtained
post exposure . the absorption changes
shown in xanes raw data ( not shown ) can
be used to infer the amount of ag in the samples , which shows approximately
the same amounts of ag in all the lungs at t0 . these results are corroborated
by an icp - ms study of the total amounts of ag in the lung , which were
321 and 357 ng at t0 for 20 and 110 nm agnps following inhalation . this shows that even small amounts of ag species
deposited in the lung can be studied with xas measurements to reveal
their chemical structures . we did not investigate the effect
of aerosolization and inhalation
process on the modification of agnps , which may cause temporary aggregation
to some agnps . we do not believe that the aerosolization process alters
the chemical state of the ag species in agnps . for 110 nm agnps , there
was little or no aggregation the smps measurements suggested
the size of 110 nm . for 20 nm agnps ,
the smps measurements showed the size of 77 nm , which may be caused
by aggregation , as well as by sodium citrate salt in the solution . because the nebulizer produces droplets with a mass medium diameter
of 1.9 m , each liquid droplet may contain single ( 110 nm agnp )
or multiple ( 20 nm agnps ) agnps . upon drying , the final product may
contain either single agnps or aggregates of several agnps . in the
presence of citrate , such aggregation generates little chemical modification
to the ag species in the nanoparticles and once these nanoparticles
are deposited on the surface in the lung it is interesting to note
that the values of the average coordination
number n are small ( around 3.5 to 5.5 ) for the ag
species detected at the end of 7-day postexposure . these values correspond
to the n values for 3 and 6 nm diameter agnps reported
in the literature . for perfect crystalline
ag bulk , the value of n decreases as
the particle size reduces or surface area increases because there
are more surface atoms . surface atoms in a 111 facet of a face - center - cube
crystalline structure have fewer than 9 neighbors whereas the bulk
atoms have 12 . however ,
even for a 100-atom nanoparticle corresponding to a roughly 1.0 nm
diameter nanoparticle , the average n of the first
coordination shell is approximated 8.0 if the cluster is perfectly
crystalline or cuboctahedral . the low n measured here , and those shown in the literature for small agnps ,
seems to suggest that these ag species may be contained in either
very small agnps , of the order 1 nm in diameter , or in highly porous
larger sized ( 36 nm or even larger ) ag nanomaterials , possibly
resembling ag - doped zeolites . this means
that the ag species in t7 may contain a large portion of such new
metallic ag species that are derived from the original 20 or 110 nm
agnps . the dominant metallic ag species detected in the lungs
suggests
that if ag ions are responsible for the observed toxicity ,
then those ions must be short - lived and be readily reduced to neutral
atoms chemically , which may form small agnps . the fact that ag ag
scattering accounts for the only major peak in exafs suggests that
majority of ag species in the lungs at any time are in the form of
small metallic nanoparticles or highly porous metallic nanomaterials
such as zeolites . the results also show that ag species in the
lungs derived from
110 nm agnps change more quickly than 20 nm agnps and the inhalation
process itself seems to be able to modify the smaller 20 nm agnps
at the onset of inhalation , which does not happen for 110 nm agnps . this seems to be in agreement with a recent inhalation toxicity study . for 20 nm agnps , there was more significant
modification to the nanoparticles from aerosolization to inhalation / deposition . on the other hand , the change occurring to the inhaled 20 nm agnps
over the 7 day period after deposition is less marked than in the
larger 110 nm agnps . these findings suggest that size does play a
role in determining the chemical fate of these nanomaterials in animals . there are several possible explanations for the formation of smaller
agnps in the t7 sample . the most plausible explanation is that the
surface ag atoms were oxidized and dissolved from the inhaled agnps
and these dissolved atoms , or ions , then form smaller agnps . because
the average coordination number is only around 4.0 and because xas
is an ensemble measurement , the average surface area of ag species
in the measured volume must be large . since the average ag species
are still metallic , it means that the agnps need to be broken down
but the new ag species must stay nonoxidized through chemical reduction ,
which is possible in the lungs . this proposed oxidation , dissolution
and reformation process has been observed in the past in a redox environment . we speculate that there might be temporary high
concentrations of ag ions around the original agnps as
the nanoparticles dissolve into ions that are immediately reduced
to metallic ag atoms and then reform into small agnps . this process
continues until the agnps are depleted or the concentration of ag
ions / atoms becomes too low to form small nanoparticles . the
second possibility is that most original large agnps were dissolved
away and cleared from the lungs on day 7 , leaving behind only the
newly formed smaller agnps . however , in order for this scenario to
be true , the signal strength of t7 sample has to be much weaker ( orders
of magnitude ) , which is not the case . the third possible scenario
is that there is no dissolution of agnps but just that the smaller
agnps in the original agnps solution were the ones that remained in
the lungs after larger agnps were cleared from the lungs . because
larger agnps carry much more ag , this scenario also requires that
the absolute amount of ag in the lungs decreases significantly at
t7 , which was not observed . icp - ms measurements of the dose of agnps
in the lungs found similar amounts of ag species in the lungs 7 days
after inhalation exposure to 20 and 110 nm agnps , proving that significant
amounts of ag species remain in the lungs for a prolonged period of
time . the fourth pathway is that agnps
simply become more porous as they are transformed into zeolite - like
nanomaterials . the negative chemical shifts for ag species derived
from 20 nm
agnps are uncommon since more often ag is oxidized and possesses positive
chemical shifts . if the surface
area is large to give rise to small n , it is possible
that these ag species may be negatively charged because of interaction
with ligands . because the ag species in all samples are metallic ,
the negative charge on ag species derived from 20 nm agnps it is intriguing that the 20 and 110 nm or
derivatives in the lungs had different chemical shifts , a result that
requires further scrutiny in the future . our results suggest
that it is possible to use xas to study inhaled
agnps and determine the chemical state of the ag species in the lungs
after inhalation . important steps must be taken to obtain the desired
data that can be used to help elucidate the transport and fate of
agnps in the lungs . one of the most critical procedures is that lung
samples need to be immediately frozen and stored in an inert environment
to ensure stoppage of the oxidation process after lung samples are
taken . it is also important to take measurements at low temperatures
to reduce noise at high k values and maintain a weakly
oxidizing environment . we used extended x - ray
absorption fine structure ( exafs ) and x - ray
absorption near edge spectroscopy ( xanes ) to study agnps in the lungs . the samples were prepared after inhalation of aerosolized agnps aqueous
solution by rats and the prepared lung samples were frozen in inert
environment immediately after inhalation exposure experiment . the
20 and 110 nm agnps in lung tissues were then measured at 85 k at
ssrl . xanes data suggest that all the agnps in day 0 , 1 , 3 , and 7
are metallic and agnps in day 7 sample were different from those at
day 0 and 1 . exafs data confirmed that the dominant ag species in
the lungs remain metallic throughout the seven - day period and the
nanoparticles were possibly dissolved and smaller agnps or zeolite
agnms are formed in the lungs over the seven - day period . furthermore ,
the rate of change of these nanoparticles is size dependent and larger
110 nm agnps experienced more dramatic change over 7 day period than
the smaller 20 nm particles . because xas is an ensemble measurement ,
the results shown here do not exclude the existence of small amounts
of ag atoms or ions . | following
a 6-h inhalation exposure to aerosolized 20 and 110 nm
diameter silver nanoparticles , lung tissues from rats were investigated
with x - ray absorption spectroscopy , which can identify the chemical
state of silver species .
lung tissues were processed immediately after
sacrifice of the animals at 0 , 1 , 3 , and 7 days post exposure and
the samples were stored in an inert and low - temperature environment
until measured .
we found that it is critical to follow a proper processing ,
storage and measurement protocol ; otherwise only silver oxides are
detected after inhalation even for the larger nanoparticles .
the results
of x - ray absorption spectroscopy measurements taken in air at 85 k
suggest that the dominating silver species in all the postexposure
lung tissues were metallic silver , not silver oxide , or solvated silver
cations . the results further indicate that the silver nanoparticles
in the tissues were transformed from the original nanoparticles to
other forms of metallic silver nanomaterials and the rate of this
transformation depended on the size of the original nanoparticles .
we found that 20 nm diameter silver nanoparticles were significantly
modified after aerosolization and 6-h inhalation / deposition , whereas
larger , 110 nm diameter nanoparticles were largely unchanged .
over
the seven - day postexposure period the smaller 20 nm silver nanoparticles
underwent less change in the lung tissue than the larger 110 nm silver
nanoparticles .
in contrast , silica - coated gold nanoparticles did not
undergo any modification processes and remained as the initial nanoparticles
throughout the 7-day study period . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hydatid cysts are mostly seen in the liver and lungs , although almost all organs and systemscan be involvement . even if a long period of survey is possible , it is still difficult to eradicate the disease and effect a cure . in this study , an evaluation was made of a patient referred at yozgat state hospital orthopedics and traumatology polyclinic with complaints of pain in her left thigh close to the knee . after examinations of plain radiographs , computerized tomography , magnetic resonance images , and blood parameters , a diagnosis was made of left femoral intramedullary hydatid cyst from excised intraoperative material . throughout a 6-month follow - up period , there was no recurrence and functional results were good . based on this report ( of a patient presented with an intramedullary cyst in the long bones ) , the primary bone hydatid cyst disease should be kept in mind and be investigated in the differential diagnosis . hydatid cysts are most often seen in the liver and lungs , although there can be involvement of almost all organs and systems . hydatid cysts seen with bone involvement comprise approximately 3% of all hydatid cysts ( 1 ) . even if a long period of survey is possible , it is still difficult to eradicate the disease and effect a cure ( 2 , 3 ) . in this report of a patient presented with an intramedullary cyst in the long bones , it was emphasized that primary bone hydatid cyst disease should be kept in mind and be investigated in the differential diagnosis . a 43-year - old female referred at our polyclinic with complaints of pain in her distal area of the left thigh , which had been ongoing for approximately 6 months . the patient had a history of a dog bite in the lateral distal left thigh 15 years ago . on physical examination , there was pain on deep palpation of the distal area of the left thigh . no pathological lymph node was determined on palpation of surface lymph nodes . in the laboratory tests , apart from erythrocyte sedimentation rate of 67 and high c - reactive protein ( 5.7 mg / l ) , no pathology was determined in routine haemogram and biochemical tests . in the radiographic examination , there was a left femur distal diaphyseal - metaphyseal radio dense area . on computerized tomography ( ct ) , a hypo dense 20 cm cystic lesion was observed located medullary from the left femur at the intertrochanteric level extending to the distal metaphysis , and the width of the medullar segment with slight lobular contours caused by cortical thinning ( figure 1 ) . in the magnetic resonance ( mri ) examination , an evident hypo intense mass lesion was observed on t1-weighted images , localized in the femur distal metaphyseal - diaphyseal area involving the entire bone medulla and accompanying soft tissue components visualized as evident heterogeneous hyper intensity on the t2-weighted series ( figure 2 ) . characteristic of our specific case is a rare involvement of cystic lesion located medullary from the left femur intertrochanteric level extending to the distal metaphysis . the patient underwent surgery and following intraoperative left femur medullar cyst excision , the histopathological examination determined hyalinized membranous fragments within calcified areas consistent with hydatid cyst ( figure 3 ) . immobilization was applied for 1 month postoperatively . for a period of 6 months , mebendazole 400 mg orally was administered . echinococcosis , which is known as unilocular hydatid disease or human hydatid disease is caused by the larvae of e. granulosus . in the usa , it is seen in cattle and sheep farming areas ( arizona , utah , new mexico , and wyoming ) . similar diseases are seen in south america , europe , and australia ( 4 ) . while sheep are temporary hosts , the canidae family ( domestic dogs , foxes , jackals ) is definitive hosts . in the presented case the liver is most often affected , but other organ systems ( kidneys , intestines , central nervous system , and bones ) can also be involved . bone involvement is seen in less than 3% of cases and cystic or lytic lesions occur in trabecular bone , which may extend to other subcortical areas . progressive changes and an expanding cystic appearance may resemble tumor formation ( 5 ) . in our case , location was shown in the left femur , distal intramedullary area , which is a rarely seen location in the long bones . antigen and antibody levels are helpful in diagnosis . by defining the characteristics of the cyst with imaging methods ( plain radiographs , ct , mri and ultrasonography ) it is difficult to diagnose bone hydatid cyst disease radiologically because the findings are nonspecific ( 8) . single or multiple osteolytic lesions and in some cases , cortical thinning , osteosclerosis , and pathological fractures can be seen on radiographs . as the localization was in the distal femur intramedullary area in the current case , the clinical and tomographic findings indicated a different diagnosis , so initially an intra - osseous ganglion cyst was considered . the diagnosis of hydatid cyst was made with histopathological examination after excision of the mass and the indirect hem agglutination ( iha ) test was found positive . when the cyst expands , it destroys the surrounding trabecular area and reaches a significant size ( 3 ) . therefore , a preoperative diagnosis of skeletal hydatid disease is difficult and accurate diagnosis is generally made during surgery and confirmed histologically ( 3).in the histopathological examination , the cyst external wall is chitinous and internally the germinal layer is surrounded by a fibrous capsule and granulation tissue ( 9 , 10 ) . the best treatment for bone infection originating from echinococcosis is removal of the involved bone or amputation . however , curettage and lavage with hypertonic salt , 1% formalin , or 0.5% silver nitrate solutions have been attempted ( 5 ) . in this case , cyst excision and debridement were applied . in cases with suspected echinococcosis , diagnostic biopsy or aspiration are contraindications . the surgical approach must be well - planned as drainage of the cyst contents may spread the disease , which must be avoided . if there is leakage , the application of formalin or iodine may reduce the damage of the spread . if a difference is shown in response to treatment , albendazole or mebendazolecan be used as medication ( 5 ) . in this case , albendazoletherapy was applied to prevent spread and recurrence . the limitation of our study is the short follow - up period to decide on the prognosis . however , this case of a hydatid cyst located in a long bone was presented to emphasize the need to consider hydatid cyst in the differential diagnosis when a well - defined cystic mass is determined in endemic regions . | introduction : echinococcosis is a parasitic and zoonotic disease of animals and humans . the cause is echinococcus granulosus and occasionally , echinococcus multilocularis .
hydatid cysts are mostly seen in the liver and lungs , although almost all organs and systemscan be involvement .
hydatid cysts seen with bone involvement comprise approximately 3% of all hydatid cysts . even if a long period of survey is possible , it is still difficult to eradicate the disease and effect a cure.case presentation : in this study , an evaluation was made of a patient referred at yozgat state hospital orthopedics and traumatology polyclinic with complaints of pain in her left thigh close to the knee .
after examinations of plain radiographs , computerized tomography , magnetic resonance images , and blood parameters , a diagnosis was made of left femoral intramedullary hydatid cyst from excised intraoperative material . throughout a 6-month follow - up period , there was no recurrence and functional results were good.conclusions:based on this report ( of a patient presented with an intramedullary cyst in the long bones ) , the primary bone hydatid cyst disease should be kept in mind and be investigated in the differential diagnosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
ramachandran plots ( 1 ) of protein backbone torsions / are frequently used to validate 3d structures of proteins ( 2,3 ) . good when ( preferably all ) amino acids have / values located in allowed regions of the plot . for carbohydrates the glycosidic torsions / ( ) are the main determinants of the 3d structure and it is straightforward to validate the quality of an experimentally determined carbohydrate structure in a similar way to protein structures . in contrast to proteins , however , the allowed regions on a conformational map for a given glycosidic linkage not only depend on the linked monosaccharide types , but also on the linkage type and a feature completely different from proteins the degree of branching of the glycan . the number of available high quality crystal structures of carbohydrates is too limited to serve as a basis to determine the allowed regions for all linkage types so the accessible conformational space of carbohydrate linkages has therefore to be estimated using computational methods . consequently , over the last 30 years a considerable effort has been put into the development of force fields that are able to predict accurately the local minima and flexibility of glycosidic torsions ( 4 ) . the force field most frequently used to calculate conformational maps of glycosidic linkages is mm3 ( 5 ) . a variety of methods exist to calculate the energy of a carbohydrate as a function of the glycosidic torsions / ( or // for 16 linkages ) . a relaxed map is obtained by systematically changing and in small intervals ( normally 10 ) and minimizing all degrees of freedom while restraining / using an external force . relaxed conformational maps depend on the orientation of the exocyclic torsions in the starting conformation of the carbohydrate and therefore the calculation of an adiabatic map is advisable . to generate a fully adiabatic map the calculation of 3 relaxed maps the computational cost is reduced by taking into account only gg and gt ( or gt and tg for monosaccharides that have the oh4 group in an axial orientation ) conformations for the hydroxymethyl groups and a clock- and anticlockwise orientation for the hydroxyl groups . this reduces the number of relaxed maps to be calculated to eight resulting in a total of 10 368 conformations to minimize for each it is obvious that this approach is limited to disaccharides since the number of conformations to be minimized for a trisaccharide would already be 3 10 ( assuming the second linkage is searched in intervals of 30 ) , far too many for a large - scale project where thousands of maps need to be calculated . high temperature molecular dynamics simulation is a robust and efficient method to explore the accessible conformational space of carbohydrates ( 8) . conformational free energy maps can be derived from population analysis by applying the boltzmann equation . this approach has several advantages compared to the systematic search methods :
it is directly applicable to branched oligosaccharides , so that the same method can be used for disaccharides and larger oligosaccharides , the low energy conformational space only is explored and no computational time is wasted to calculate unrealistic high energy conformations , the required computational cost increases therefore only moderately with the number of atoms of the oligosaccharide , the data - flow can be easily optimised in such a way that the conformational maps are generated automatically and only minimal human interaction is required . it is directly applicable to branched oligosaccharides , so that the same method can be used for disaccharides and larger oligosaccharides , the low energy conformational space only is explored and no computational time is wasted to calculate unrealistic high energy conformations , the required computational cost increases therefore only moderately with the number of atoms of the oligosaccharide , the data - flow can be easily optimised in such a way that the conformational maps are generated automatically and only minimal human interaction is required . it was therefore decided that free energy maps derived from md simulations were a good first set of conformational maps with which to populate the glycomaps database . an in - house library of carbohydrate fragments ( up to pentasaccharides ) derived from structures described in the carbbank ( 9 ) and built using the sweet - ii program ( 10 ) served as input . the mm3 force field as implemented in the tinker suite ( ) [ for a comparision with the original mm3 implementation see ( 11 ) ] was used to calculate the trajectories at 1000 k. the length of the md simulation was 10 ns for disaccharides and 30 ns for larger oligosaccharides . the conformational analysis tools ( cat ) software ( ) was used for data processing and analysis . conformational maps of carbohydrate linkages can be retrieved from the database by entering the disaccharide fragment in iupac form into the search database web interface of glycomapsdb ( figure 1 ) . maps found in the database are displayed as a list , with each entry showing a preview picture and the full structure of the carbohydrate for which the map has been calculated in extended iupac form ( figure 2 ) . difference maps can be calculated e.g. to evaluate the influence of branching on the accessible conformational space of a linkage ( figure 3 ) . ii ( 10)can be displayed using jmol ( ) . if experimental data for the disaccharide fragment is available in the protein data bank ( pdb ) ( 12 ) , a link is displayed , which leads to a page where / torsion values retrieved from pdb data [ using the glytorsion tool ( 13 ) ] are overlaid onto the calculated conformational map ( figure 4 ) . some statistical data regarding the fit of the experimental data to the calculated data is also displayed . if further information such as literature references or nmr data for the carbohydrate is available in glycosciencesdb ( 14 ) a link to the corresponding entry in that database is displayed . monosaccharide residues can be selected from the pull down menus or entered directly into the appropriate fields . the complete carbohydrate structure used for the calculation of the conformational map is displayed in iupac extended nomenclature . the disaccharide fragment that defines the method used to calculate the maps is shown as well as a preview picture of the map that serves as an active link to a more detailed display of the database entry . shown the conformational maps of the disaccharide fragment -d - glcpnac-(1 - 4)--d - manp either as part of a highly branched oligosaccharide ( b ) or as part of a linear chain ( c ) are compared . the reduction of accessible conformational space caused by neighbouring residues in the branched oligosaccharide can clearly be seen in the difference map ( a , deep red areas represent regions where the neighbouring residue causes a strong energy penalty mainly by steric conflicts ) . comparison of calculated conformational maps with glycosidic torsion values derived from the pdb using the glytorsion tool ( 13 ) . the pdb database entries can be explored using the show details link . if available visualization of carbohydrate structures is performed using the java applet jmol or the plugin chime ( ) . diagrams and plots are generated in scalable vector graphics ( svg ) format . for browsers that can not display svg files , the service is hosted at and maintained by the german cancer research centre in heidelberg , germany . currently , the glycomapsdb contains 2500 conformational maps of carbohydrate fragments originally described in the carbbank . the direct crosslink between calculated maps and pdb data opens a very efficient route to crosscheck the quality of experimental structures as well as the quality of the maps . in general the amount of available high quality experimental data currently available for carbohydrates in the pdb database is rather limited compared to that for proteins and for some linkages there is no experimental data available at all , so there is a clear lack of experimental reference data . in this respect , the conformational maps contained in glycomapsdb might help crystallographers to crosscheck their data before submission similar to the ramachandran plot analysis for proteins . for this purpose , maps from the glycomapsdb are also accessed by the carp ( carbohydrate ramachandran plot ) software ( 13 ) , where users can upload a structure in pdb file format and retrieve plots comparing the torsions present in the structure with the conformational maps . glycomapsdb indirectly offers an interface for data mining in the pdb database , e.g. to find carbohydrate entries with unusual glycosidic torsion values . for -d - glcpnac-(1 - 4)--d - glcpnac , a frequent fragment contained in n - glycans , the agreement between experimental and calculated data is remarkably good ( figure 4 ) . more than 80% of the crystal structures have values in low energy areas of the conformational map . but there are also some outliers that are located in not allowed areas of the maps . of special interest are also those structures that have or values of 180 ( anti conformation ) . the show details link would help to find the corresponding entries in the pdb . in the near future we will provide also conformational maps calculated with force fields other than mm3 , so that the influence of different parameter sets can be investigated . an upload feature for maps will be added so that users can upload and compare their own calculated maps with the maps stored in the database . in addition , a functionality that will allow users to calculate maps not already contained in the database is planned . | conformational energy maps of the glycosidic linkages are a valuable resource to gain information about preferred conformations and flexibility of carbohydrates . here
we present glycomapsdb , a new database containing more than 2500 calculated conformational maps for a variety of di- to pentasaccharide fragments contained in n- and o - glycans .
oligosaccharides representing branchpoints of n - glycans are included in the set of fragments , thus the influence of neighbouring residues is reflected in the conformational maps . during refinement of new crystal structures , maps contained in glycomapsdb
can serve as a valuable resource to check whether the torsion values of a glycosidic linkage are located in an
allowed region similar to the ramachandran plot analysis for proteins .
this might help to improve the structural quality of the glycan data contained in the protein data bank ( pdb ) .
a link between glycomapsdb and the pdb has been established so that the glycosidic torsions of all glycans contained in the pdb can be retrieved and compared to calculated data .
the service is available at . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
this study is part of the zodiac study ; the design and details of this study have been presented elsewhere ( 19 ) . in this project , general practitioners are assisted by hospital - based nurses specialized in diabetes in their care of patients with type 2 diabetes . the patients consult with the nurses once per year . during the first year ( 1998 ) of the zodiac study , a total of 338 patients that were already treated in the secondary care for their diabetes were excluded from participation . another 57 patients were excluded because of a very short life expectancy ( including patients with active cancer ) or insufficient cognitive abilities . eventually , 1,269 eligible patients were invited to participate . of those , 1,143 patients agreed to participate in the study . baseline data , collected in 1998 , consisted of a full medical history , including macrovascular complications , medication use , and tobacco consumption . patients were considered to have macrovascular complications when they had a history of angina pectoris , myocardial infarction , percutaneous transluminal coronary angioplasty , coronary artery bypass grafting , stroke , or transient ischemic attack . laboratory and physical assessment data , such as lipid profile , creatinine levels , urinary albumin / creatinine ratio , blood pressure , weight , and height were collected annually . blood pressure was measured twice with a welch allyn sphygmomanometer in the supine position after at least 5 min of rest . for each visit previous studies found that the prognostic properties of mr - proanp are comparable with those of nt - probnp ( 69 ) . mr - proanp was measured using an automated sandwich immunoassay in 867 out of the 1,143 ( 75.9% ) patients using plasma collected at baseline and kept frozen at 80c until analysis according to the instructions of the manufacturer ( b.r.a.h.m.s . we examined two clinical end points in this study : all - cause mortality and cardiovascular mortality . in early 2009 , the vital status and cause of death were retrieved from records maintained by the hospital and the general practitioners . the causes of death were coded according to the international classification of diseases , 9th revision ( icd-9 ) . we used spss version 16.0 ( sas institute , cary , nc ) and stata version 11 ( statacorp , college station , tx ) for statistical analyses . continuous variables are represented as mean ( sd ) for normally distributed values and as median ( interquartile range ) for the non - normally distributed variables . because of missing confounders in 19 patients , all analyses were performed in 848 out of 867 patients ( 98% ) whose mr - proanp values were determined . cox proportional hazard models were used to investigate the association between mr - proanp and mortality with adjustment for selected confounders . the following variables were selected for possible confounding effects : age , sex , smoking ( dichotomous ) , bmi , systolic blood pressure ( sbp ) , duration of diabetes , serum creatinine level , cholesterol - to - hdl ratio , macrovascular complications ( dichotomous ) , albuminuria ( dichotomous ) , and the use of lipid - lowering and antihypertensive medications ( dichotomous ) . we used three different models : a crude model , an age - adjusted and sex - adjusted model , and a model in which we additionally adjusted for all these mentioned variables . analyses were performed for mr - proanp as a continuous variable ( log mr - proanp ) . stata ph test was used to test the assumption of proportional hazards for baseline predictors . all p values for the ph test were nonsignificant , meaning that no substantial deviations were observed . in case of a significant association between mr - proanp and ( cardiovascular ) mortality calibration was investigated using the groennesby and borgan test , assessing the goodness of fit ( 20 ) . when the average predicted risk within subgroups of a prospective cohort matches the proportion that actually develops disease , the model is considered well - calibrated . harrell c statistic was used to compare how well the presence of mr - proanp in the different models used predicts mortality ( 21 ) . harrell c value is a rank - based measure ( more or less comparable with the area under the receiver - operating characteristic curve ) the idi can be interpreted as the difference between model - based probabilities for events and nonevents for the models with and without mr - proanp . the multivariate model as described was repeated without mr - proanp for patients aged older than 75 years to investigate whether the relationship between blood pressure and mortality differs between the models with and without mr - proanp . analyses were performed for mr - proanp as a continuous variable and for mr - proanp as a categorical variable . for the categorical variable this cut - off value was chosen because in patients with known chronic heart failure , this value had the highest diagnostic accuracy for the detection of a left ventricular ejection fraction < 40% ( 10 ) . additional analyses , in which we used updated mean blood pressure values were performed to adjust for changes in blood pressure over time . this technique is similar to the one used in the uk prospective diabetes study ( ukpds ) ( 23 ) . for example , at 2 years the updated mean of sbp is the average of baseline , 1-year , and 2-year values . the relationship between mr - proanp , blood pressure , and mortality was illustrated by using a kaplan meier curve , for which all patients were categorized into four categories : 1 ) mr - proanp less than the median and sbp greater than median ; 2 ) mr - proanp and sbp less than the median ; 3 ) mr - proanp and sbp greater than the median ; and 4 ) mr - proanp greater than the median and sbp less than median . all hazard ratios of the blood pressure indices refer to a pressure increase of 10 mm hg . the zodiac study and the informed consent procedure were approved by the local medical ethics committee of the isala clinics , zwolle , the netherlands . verbal informed consent was obtained for all patients by the participating diabetes specialist nurses and the consent was documented in the patients records . according to dutch law , this study is part of the zodiac study ; the design and details of this study have been presented elsewhere ( 19 ) . in this project , general practitioners are assisted by hospital - based nurses specialized in diabetes in their care of patients with type 2 diabetes . the patients consult with the nurses once per year . during the first year ( 1998 ) of the zodiac study , a total of 338 patients that were already treated in the secondary care for their diabetes were excluded from participation . another 57 patients were excluded because of a very short life expectancy ( including patients with active cancer ) or insufficient cognitive abilities . eventually , 1,269 eligible patients were invited to participate . of those , 1,143 patients agreed to participate in the study . baseline data , collected in 1998 , consisted of a full medical history , including macrovascular complications , medication use , and tobacco consumption . patients were considered to have macrovascular complications when they had a history of angina pectoris , myocardial infarction , percutaneous transluminal coronary angioplasty , coronary artery bypass grafting , stroke , or transient ischemic attack . laboratory and physical assessment data , such as lipid profile , creatinine levels , urinary albumin / creatinine ratio , blood pressure , weight , and height were collected annually . blood pressure was measured twice with a welch allyn sphygmomanometer in the supine position after at least 5 min of rest . for each visit previous studies found that the prognostic properties of mr - proanp are comparable with those of nt - probnp ( 69 ) . mr - proanp was measured using an automated sandwich immunoassay in 867 out of the 1,143 ( 75.9% ) patients using plasma collected at baseline and kept frozen at 80c until analysis according to the instructions of the manufacturer ( b.r.a.h.m.s . we examined two clinical end points in this study : all - cause mortality and cardiovascular mortality . in early 2009 , the vital status and cause of death were retrieved from records maintained by the hospital and the general practitioners . the causes of death were coded according to the international classification of diseases , 9th revision ( icd-9 ) . we used spss version 16.0 ( sas institute , cary , nc ) and stata version 11 ( statacorp , college station , tx ) for statistical analyses . continuous variables are represented as mean ( sd ) for normally distributed values and as median ( interquartile range ) for the non - normally distributed variables . variables with a skewed distribution were logarithmically transformed before analysis . because of missing confounders in 19 patients , all analyses were performed in 848 out of 867 patients ( 98% ) whose mr - proanp values were determined . cox proportional hazard models were used to investigate the association between mr - proanp and mortality with adjustment for selected confounders . the following variables were selected for possible confounding effects : age , sex , smoking ( dichotomous ) , bmi , systolic blood pressure ( sbp ) , duration of diabetes , serum creatinine level , cholesterol - to - hdl ratio , macrovascular complications ( dichotomous ) , albuminuria ( dichotomous ) , and the use of lipid - lowering and antihypertensive medications ( dichotomous ) . we used three different models : a crude model , an age - adjusted and sex - adjusted model , and a model in which we additionally adjusted for all these mentioned variables . analyses were performed for mr - proanp as a continuous variable ( log mr - proanp ) . stata ph test was used to test the assumption of proportional hazards for baseline predictors . all p values for the ph test were nonsignificant , meaning that no substantial deviations were observed . in case of a significant association between mr - proanp and ( cardiovascular ) mortality , calibration was investigated using the groennesby and borgan test , assessing the goodness of fit ( 20 ) . calibration is a measure of how well predicted probabilities agree with actual observed risk . when the average predicted risk within subgroups of a prospective cohort matches the proportion that actually develops disease , the model is considered well - calibrated . harrell c statistic was used to compare how well the presence of mr - proanp in the different models used predicts mortality ( 21 ) . harrell c value is a rank - based measure ( more or less comparable with the area under the receiver - operating characteristic curve ) . the higher the value , the better the model predicts mortality . the idi can be interpreted as the difference between model - based probabilities for events and nonevents for the models with and without mr - proanp . the multivariate model as described was repeated without mr - proanp for patients aged older than 75 years to investigate whether the relationship between blood pressure and mortality differs between the models with and without mr - proanp . analyses were performed for mr - proanp as a continuous variable and for mr - proanp as a categorical variable . for the categorical variable this cut - off value was chosen because in patients with known chronic heart failure , this value had the highest diagnostic accuracy for the detection of a left ventricular ejection fraction < 40% ( 10 ) . additional analyses , in which we used updated mean blood pressure values were performed to adjust for changes in blood pressure over time . this technique is similar to the one used in the uk prospective diabetes study ( ukpds ) ( 23 ) . for example , at 2 years the updated mean of sbp is the average of baseline , 1-year , and 2-year values . the relationship between mr - proanp , blood pressure , and mortality was illustrated by using a kaplan meier curve , for which all patients were categorized into four categories : 1 ) mr - proanp less than the median and sbp greater than median ; 2 ) mr - proanp and sbp less than the median ; 3 ) mr - proanp and sbp greater than the median ; and 4 ) mr - proanp greater than the median and sbp less than median . all hazard ratios of the blood pressure indices refer to a pressure increase of 10 mm hg . cox proportional hazard models were used to investigate the association between mr - proanp and mortality with adjustment for selected confounders . the following variables were selected for possible confounding effects : age , sex , smoking ( dichotomous ) , bmi , systolic blood pressure ( sbp ) , duration of diabetes , serum creatinine level , cholesterol - to - hdl ratio , macrovascular complications ( dichotomous ) , albuminuria ( dichotomous ) , and the use of lipid - lowering and antihypertensive medications ( dichotomous ) . we used three different models : a crude model , an age - adjusted and sex - adjusted model , and a model in which we additionally adjusted for all these mentioned variables . analyses were performed for mr - proanp as a continuous variable ( log mr - proanp ) . stata ph test was used to test the assumption of proportional hazards for baseline predictors . all p values for the ph test were nonsignificant , meaning that no substantial deviations were observed . in case of a significant association between mr - proanp and ( cardiovascular ) mortality , the following analyses were performed . calibration was investigated using the groennesby and borgan test , assessing the goodness of fit ( 20 ) . calibration is a measure of how well predicted probabilities agree with actual observed risk . when the average predicted risk within subgroups of a prospective cohort matches the proportion that actually develops disease , the model is considered well - calibrated . harrell c statistic was used to compare how well the presence of mr - proanp in the different models used predicts mortality ( 21 ) . harrell c value is a rank - based measure ( more or less comparable with the area under the receiver - operating characteristic curve ) the idi can be interpreted as the difference between model - based probabilities for events and nonevents for the models with and without mr - proanp . the multivariate model as described was repeated without mr - proanp for patients aged older than 75 years to investigate whether the relationship between blood pressure and mortality differs between the models with and without mr - proanp . analyses were performed for mr - proanp as a continuous variable and for mr - proanp as a categorical variable . for the categorical variable , we used a cut - off value of 122 pmol / l . this cut - off value was chosen because in patients with known chronic heart failure , this value had the highest diagnostic accuracy for the detection of a left ventricular ejection fraction < 40% ( 10 ) . additional analyses , in which we used updated mean blood pressure values were performed to adjust for changes in blood pressure over time . this technique is similar to the one used in the uk prospective diabetes study ( ukpds ) ( 23 ) . for example , at 2 years the updated mean of sbp is the average of baseline , 1-year , and 2-year values . the relationship between mr - proanp , blood pressure , and mortality was illustrated by using a kaplan meier curve , for which all patients were categorized into four categories : 1 ) mr - proanp less than the median and sbp greater than median ; 2 ) mr - proanp and sbp less than the median ; 3 ) mr - proanp and sbp greater than the median ; and 4 ) mr - proanp greater than the median and sbp less than median . all hazard ratios of the blood pressure indices refer to a pressure increase of 10 mm hg . the zodiac study and the informed consent procedure were approved by the local medical ethics committee of the isala clinics , zwolle , the netherlands . verbal informed consent was obtained for all patients by the participating diabetes specialist nurses and the consent was documented in the patients records . according to dutch law , median mr - proanp in the total study sample was 75 pmol / l ( interquartile range , 48124 pmol / l ) . for patients older than 75 years , the median mr - proanp value was 122 ( 80184 ) pmol / l . after follow - up for 10 years , 354 out of 848 patients ( 41.7% ) had died . baseline characteristics results of the cox regression analyses for the total study sample as well as the analyses stratified according to age are presented in table 2 . in the overall sample and in both age strata , higher levels of log mr - proanp were related to increased all - cause and cardiovascular mortality . the highest idi values and the largest increases in harrell c values were observed for adding mr - proanp to the age - adjusted and sex - adjusted models . adding mr - proanp to the multivariate model resulted in smaller increases in the harrell c values and in lower idi values . in patients older than 75 years results of the cox regression analyses of the logarithmically transformed midregional fragment of pro - a type natriuretic peptide , the comparison of predictive capability for mortality and cardiovascular events as determined by the harrell c statistic , and the integrated discrimination improvement for adding the peptide to models 2 and 3 , respectively rates of cardiovascular mortality according to different levels of sbp and mr - proanp in patients older than 75 years are shown in fig . the number of cardiovascular deaths was the highest in patients with mr - proanp levels greater than the median and sbp less than the median . the lowest number was observed in patients with mr - proanp levels less than the median and sbp greater than the median . hazard ratios for all - cause and cardiovascular mortality according to different measures of blood pressure are shown in table 3 . all blood pressure measures were inversely related to all - cause mortality . for cardiovascular mortality , we observed inverse relationships for sbp and pulse pressure . adjustment for mr - proanp did not affect the relationship for any of the blood pressure measures . all elderly patients ( n = 225 ) were divided into four categories . from top to bottom , the lines represent the following : 1 ) mr - proanp < median and sbp > median ( green ) ; 2 ) mr - proanp and sbp < median ( blue ) ; 3 ) mr - proanp and sbp > median ( orange ) ; and 4 ) mr - proanp > median and sbp < median ( yellow ) . hazard ratios of blood pressure indices for all - cause and cardiovascular mortality in patients older than 75 years using updated mean blood pressure values and exclusion of deaths in the first 2 years of follow - up did not relevantly change the results ( data not shown ) . first , higher serum levels of mr - proanp were associated with increased all - cause and cardiovascular mortality in patients with type 2 diabetes , irrespective of age . second , the consistently lower harrell c values in old age showed that the predictive capabilities of mr - proanp diminish with advancing age . third , the inverse relationship between blood pressure and mortality in old age was not affected by additional adjustment for baseline serum levels of mr - proanp used as a surrogate marker of heart failure . adding mr - proanp to models with age , sex , and other cardiovascular risk factors resulted in increased predictive capabilities , as measured with the harrell c and idi statistics , of both all - cause and cardiovascular mortality . although mr - proanp has prognostic value for cardiovascular events in patients from the general population , results from previous studies showed conflicting results concerning the association with cardiovascular mortality ( 5,9,10 ) . in a recently published study in the general population however , based on the width of the 95% ci , a relevant association between mr - proanp and cardiovascular mortality could not be excluded . in a study with chronic heart failure patients , the relationship between mr - proanp and cardiovascular mortality was similar to the study with all - cause mortality ( 10 ) . the predictive capabilities of the various models , as measured with the harrell c statistics , increased by adding more variables to the models . adding mr - proanp to the models with all conventional risk factors resulted in small increases in the c values . the lowest c values were observed in the group of elderly patients , indicating that the prognostic properties of mr - proanp diminish with advancing age . the idi for adding mr - proanp to the fully adjusted models in the sample 75 years of age or older was significant for both all - cause and cardiovascular mortality . for elderly patients , improvements in the idi were only observed for the models investigating all - cause mortality . a plausible explanation for the diminishing properties with advancing age may be the phenomenon of competing risks : the effect of a certain risk factor on mortality declines with advancing age because other risk factors , including age itself , become more important with advancing age ( 24 ) . in the current study we had no data on nt - probnp ; therefore , we were not able to perform a head - to - head comparison . previous studies , however , have shown that mr - proanp has comparable prognostic and diagnostic capabilities as nt - probnp , and it can be considered as an alternative for nt - probnp ( 69 ) . although our study showed that mr - proanp is an independent risk factor for mortality , its practical implications still remain to be determined . based on the small improvements in harrell c values when adding biomarkers to the adjusted models , one may conclude that the additional value of mr - proanp in risk prediction seems rather limited . however , it is important to realize that it is difficult to achieve further improvements in risk prediction by adding a biomarker to models with all conventional risk factors ( 5 ) . in the current study , the c values of the fully adjusted models without mr - proanp in the overall population were 0.79 and 0.80 for all - cause and cardiovascular mortality , respectively . these values leave little room for further improvements in risk prediction . to our knowledge , this is the first study investigating whether adjustment for natriuretic peptides influences the inverse relationship between blood pressure and mortality in old age . it is important to emphasize that because of the observational design of our study , no conclusions about causality can be drawn . the results from fig . 1 , in which the highest mortality rate was observed in patients with the highest mr - proanp levels and the lowest sbp levels , suggest that heart failure may explain the inverse relationship . however , these results were not confirmed by the cox regression analyses . even though we tried to adjust for comorbidities and frailty in our analyses , it is not unlikely that these factors still account for the inverse relationship ( residual confounding ) . ( 25 ) showed that the relationship between mortality and blood pressure is influenced by walking speed , which can be regarded as a marker of frailty . higher blood pressure was only associated with increased mortality among faster walkers and no relationship was found for slow walkers ( 25 ) . a subgroup analysis of the advance trial , in which predominantly healthy elderly patients were included , showed beneficial results of antihypertensive treatment in patients with type 2 diabetes aged older than 75 years ( 26 ) . these results confirm the hypothesis that blood pressure is especially an important target for treatment in healthy elderly patients with a low level of frailty . side effects of antihypertensive medication and excessive lowering of blood pressure also should be considered as explanations for the inverse relationships observed . for example , in the international verapamil sr - trandolapril trial , a study among patients with type 2 diabetes and coronary artery disease , sbp < 115 mm hg was associated with increased mortality ( 27 ) . because the majority of our elderly population had hypertension ( 84% ) , and because 64% received antihypertensive treatment , confounding by indication also may have led to the inverse relationships . also , the results of our blood pressure analyses should be used as hypothesis - generating only , because the use of baseline serum mr - proanp levels as a surrogate measure of heart failure has several limitations . first , because we only adjusted for a single baseline mr - proanp value , we were not able to adjust for heart failure that has developed during the follow - up period or for potential variability in concentrations . second , the evidence for which cut - off values should be used in the diagnosis of chronic heart failure is limited . the cut - off value we used was established in a study that compared the prognostic properties of mr - proanp and nt - probnp ( 10 ) . third , levels of natriuretic peptides tend to increase with older age , which makes it more problematic to use these peptides as a marker of heart failure . however , we did observe increased mortality with higher levels of mr - proanp . another limitation is that ranges of meaningful improvements are not established for the idi ( 22 ) . furthermore , the idi originally had not been developed for censored data such as ours . therefore , the results are difficult to interpret and caution is needed when basing conclusions on the idi . strengths of our study were its prospective design , the high number of deaths after the 10-year follow - up period , and the additional analyses , including the updated mean method , we performed . we conclude that this study shows that mr - proanp is independently associated with all - cause and cardiovascular mortality in patients with type 2 diabetes , and that its predictive capabilities decrease with advancing age . | objectiveevidence that midregional fragment of pro - a type natriuretic peptide ( mr - proanp ) is a marker of mortality in patients with type 2 diabetes is limited .
therefore , we aimed to investigate the capabilities of mr - proanp in predicting mortality .
we also investigated whether mr - proanp influences the relationship between blood pressure and mortality in old age.research design and methodsin 1998 , 1,143 primary care patients with type 2 diabetes participated in the zodiac study . because blood was drawn for 867 patients ( 76% ) and confounders were missing for 19 patients , the final study sample comprised 848 patients .
after a follow - up time of 10 years , we used cox proportional hazard models to evaluate the relationship between mr - proanp and ( cardiovascular ) mortality .
harrell c statistic was used to compare models with and without mr - proanp .
the regression analyses were repeated without mr - proanp for patients aged older than 75 years.resultsmedian mr - proanp in the total study sample was 75
pmol / l ( interquartile range , 48124 pmol / l ) . during follow - up , 354 ( 42% ) out of 848 patients had died , of whom 152 ( 43% ) deaths were attributable to cardiovascular factors .
mr - proanp was independently associated with all - cause and cardiovascular mortality , irrespective of age . during old age
, there was a significant inverse relationship between blood pressure and mortality .
this relationship did not change after adjustment for mr-proanp.conclusionsmr-proanp is independently associated with mortality in patients with type 2 diabetes .
mr - proanp did not influence the inverse relationship between blood pressure and mortality in elderly patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
ectopic gastric mucosa in the esophagus is considered to be the residue of columnar epithelium of the embryonic esophagus . replacement of columnar epithelium by stratified squamous epithelium begins in the mid esophagus and extends proximally and distally . therefore , rests of columnar epithelium occasionally may persist in the upper and distal end of the esophagus . as shown in autopsy and endoscopic studies , ectopic gastric mucosa can occur as solitary or multiple mucosal patches , most frequently in the upper third of the esophagus , near the level of the cricopharyngeal muscle . it is frequently overlooked on routine endoscopic examination because of technical problems in observing the upper esophagus and its asymptomatic nature . however , certain complications have been reported , including dysphagia , esophageal stricture , tracheoesophageal fistula , adenocarcinoma and ring . it has been suggested that these complications develop from acid secretion from the heterotopic gastric mucosa . we report a case of heterotopic gastric mucosa in the upper esophagus with the secretion of acid demonstrated by continuous ambulatory ph monitoring . a 33-year - old man visited the gastrointestinal department of the gil medical center with throat discomfort for the previous month . he denied symptoms of dysphagia , but suffered from occasional hoarseness , coughing and heartburn . physical examination revealed that the vital signs were stable and the patient s pharynx and abdomen appeared unremarkable . on gastroesophageal endoscopic findings , there was no definite abnormal findings on the lower esophagus and stomach . upon withdrawal of the endoscope , a patch of salmon colored epithelium was clearly demarcated from the surrounding normal mucosa in the upper esophagus ( figure 1a ) . its diameter was between one - quarter and one - half fully expanded , and it was located just below the upper esophageal sphincter . endoscopic biopsy finding from the patches revealed gastric - type columnar epithelium with parietal cells and helicobacter pylori was not found on the giemsa stain ( figure 1b ) . esophageal manometry was performed to confirm the level of the lower and upper esophageal sphincters . the level of the lower esophageal sphincter was 39 to 42 cm and that of the upper sphincter was about 19 cm from the incisor . a dual - probe antimony ph catheter with a diameter of 2.1 mm ( synectics medical inc . , the distal probe was placed at 5 cm above the manometrically defined lower esophageal sphincter . the proximal electrode was placed at 19 cm from the incisor , which corresponded approximately with the endoscopic findings of the heterotopic gastric mucosa . the ph values from both intraesophageal electrodes were recorded continuously on an ambulatory mark iii digitrapper ( synectics medical inc . ) , and the data were downloaded to an ibm - compatible computer for calculation and analysis by gastrosoft ( synecitics medical inc . ) . a 24-hour ambulatory ph monitoring showed that the ph in the proximal esophagus less than 4 ( including supine and upright positions ) were 3.8% of the time in total ( normal value < 1 ) , 3.3% ( normal value < 1.3 ) in the upright position , and in 4.6% ( normal value is 0 ) in the supine position , respectively . the ph less than 4 in distal esophagus was 9.2% ( normal value < 4.5 ) of the time in total ( including supine and upright positions ) , 13.1% ( normal value < 6.3% ) in the upright position and in 3.5% ( normal value < 1.2 ) in the supine position , respectively . despite the increased acid exposure in the proximal ph probe , there was no acid reflux in supine position from 15:45 to 16:10 ( figure 2 ) . the patient was treated with 40 mg of omeprazole , once daily , which resulted in improvement of the throat discomfort , hoarseness and cough . the occurrence of gastric fundic type epithelium in the esophagus has been noted since the 1800s . as opposed to barrett s esophagus , gastric epithelium in the upper esophagus is thought to be a developmental anomaly . during embryonic development , the esophageal mucosa is initially lined with columnar epithelium , which is later replaced with a stratified squamous epithelium . the replacement begins in the middle of the esophagus and spreads gradually in both the caudal and cephalic directions . the occurrence of gastric fundic type epithelium in the upper esophagus is , therefore , thought to represent a failure of this spread to reach the cephalic end of the esophagus . the prevalence of inlet patch on endoscopy varies considerably from 3.8% to 10% . in most cases , the patients were thought to be asymptomatic , but in some cases the inlet patch causes pharyngeal and upper esophageal symptoms . the proposed mechanisms of the symptoms are cricopharyngeal spasm by acid secretion and increased tone of upper esophageal sphinicter in response to acid stimulation . since complications associated with heterotopic gastric mucosa have been reported , they are presumed to be related to acid secretion by this ectopic mucosa . some investigators have tried to demonstrate the secretary capability of this mucosa by different methods . jabbari and goresky measured the ph profile from the stomach to the esophageal inlet patch in five patients 30 minutes after administering 10 g / kg of pentagastrin intravenously . the ph values decreased in the area of the heterotopic gastric mucosa in two patients with large patches . hamilton and thune used a sensitive stain and pentagastrin stimulation to study the production of acid by this mucosa . four patients were infused with 1% congo red solution in the area of the inlet patch after pentagastrin infusion . a darkening of the stained area ( consistent with a ph < 4.5 ) occurred in all patients . nakajima and munakata measured the ph profile of the esophagus in five patients with heterotopic gastric mucosa after tetragastrin stimulation , using a ph electrode attached to a standard fiberscope . significant reduction in ph was observed at the heterotopic gastric mucosa or adjacent areas in three of five patients , and was confirmed with congo red staining . galan et al reported a case of heterotopic gastric mucosa in the upper esophagus , where the acid secretion was demonstrated by continuous 24-hour ph monitoring , complicated with an upper esophageal stricture and dysphagia . these previous studies suggest that heterotopic gastric mucosa in the upper esophagus is capable of secreting acid . furthermore , it was believed that this proximal acid exposure was not caused by acid reflux because only the upper esophageal ph dropped without falling in the lower esophageal ph . the normal ph finding in lower esophageal probe may be due to a relatively small volume of acid , which can be easily diluted and neutralized by saliva , and which is then rapidly cleared . in our case , the patient complained of pharyngeal symptoms and cough , and was diagnosed with a large inlet patch and showed ph discrepancy in the upper and lower esophagus . despite the increased acid exposure in the distal esophagus , the proximal acid reflux could not be explained because there was no correlation between the proximal and distal acid exposure . the pharyngeal and laryngeal symptoms caused by inlet patch are relieved after administration of h2 antagonist or proton pump inhibitor . it leads to the speculation that the extraesophageal manifestations may also have been related to the acid secretion of the heterotopic gastric mucosa . also the patient s cough and hoarseness resolved with proton pump inhibitor therapy dramatically in our case . in summary , we report a case of heterotopic gastric mucosa in the upper esophagus , where the acid secretion was demonstrated by continuous 24-hour ph monitoring . in the supine position , the upper esophageal ph dropped below four without falling in the lower esophageal ph , and the patient s throat discomfort was improved after aggressive acid suppressive therapy . | heterotopic gastric mucosa in the upper esophagus is frequently found during endoscopic examination . although most patients with heterotopic gastric mucosa of the upper esophagus , referred as inlet patch , are asymptomatic , symptomatic patients with complications resulting from this ectopic mucosa have also been reported .
acid secretion by the inlet patch has been suggested in some reports .
we report a case of heterotopic gastric mucosa in the upper esophagus , with secretion of acid , demonstrated by continuous ambulatory ph monitoring , and the improvement of pharyngeal symptoms after the use of a proton pump inhibitor . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
however , the lifetime risk of developing complications in patients with meckel 's diverticulum is believed to be less than 5% . infrequently , meckel 's diverticulum can invert and invaginate into the ileal lumen and can be the leading point of the intussusception ( figs . 1 and 2 ) . the incidence of intussusception attributed to an inversion of meckel 's diverticulum accounts for 4% of all cases presenting with intestinal obstruction due to intussusception . it occurs when the meckel 's diverticulum sags into the bowel lumen and then serves as a lead point to allow telescoping of the small intestine , first into the distal ileum and then in to the large intestine , causing ileo - ileal and ileo - colic type of intussusceptions . we hereby report a case where surgical inversion was done as a treatment for meckel 's diverticulum which lead to intussusception and intestinal obstruction . a 14-year - old boy presented with colicky abdominal pain and distention of abdomen with bilious vomiting . he had undergone open appendicectomy through mcburney 's incision 5 days back at a peripheral rural setup . on presentation erect abdominal x - ray showed dilated small bowel loops with multiple air fluid levels . ultrasonography of abdomen showed multiple fluid filled dilated small bowel loops suggestive of small bowel obstruction . naso - gastric decompression was done and he was started on iv fluids , anti - spasmodics and antibiotics . midline laparotomy incision was taken and ileo - colic intussusceptions were identified as the cause of small bowel obstruction . intussusceptions could be reduced and surgically inverted meckel 's diverticulum ( done probably at the time of open appendicectomy ) was identified as the lead point for intussusception . at about 50 cm from ic junction non - absorbable silk sutures were identified which were invaginating 2 cm 1 cm of meckel 's diverticulum into the ileal lumen . as rest of the bowel was viable and healthy , segmental resection of meckel 's diverticulum with ileo - ileal anastomosis was done . in children less than 3 years , lead points for 9095% of the intussusceptions are idiopathic . where as meckel 's diverticulum is the most common cause of non - idiopathic intussusception , especially in older children . there are various mechanisms by which it can cause intestinal obstruction like ( a ) volvulus of small intestine around a fibrous band extending from meckels diverticulum to umbilicus . ( b ) intussusception in which meckel 's diverticulum sags into the bowel lumen and then serves as a lead point to allow telescoping of the small intestine into first the distal ileum and then in to the large intestine causing ileo - ileal and ileocolic type of intussusception . ( c ) littres hernia incarceration of the diverticulum in hernia , ( inguinal or femoral ) causing intestinal obstruction . ( d ) entrapment of small bowel beneath the blood supply of the diverticulum , also known as a meso - diverticular band . ( g ) band extending between the diverticulum and the base of the mesentery , forming a loop in which a part of ileum may get stuck causing obstruction . symptoms caused by meckel 's diverticulum are abdominal pain , malena and vomiting . more often patients present with features of small bowel obstruction . radiological investigations help diagnose the case and ultrasonography shows classical appearance of target or doughnut sign. cect abdomen is the most sensitive imaging modality with reported accuracy of 58100% and it characteristically shows the inverted diverticulum as a central core of fat attenuation surrounded by a collar of multiple concentric rings of soft - tissue attenuation . treatment of meckel 's diverticulum depends on the location of diverticulum and the progression and the severity of the disease . simple diverticulectomy or segmental resection is preferred since the malignancy rate is low ( 17% ) . diverticulectomy is predicted as a simple , minimal and cost effective technique which can resolve the disease . resection with anastomosis is clearly indicated in cases of inflammation and ischemia of ileum and is also recommended in oedematous , inflamed or perforated base of meckel 's diverticulum . laparoscopy represents an alternative method of treatment with techniques varied from segmental resection of meckel 's diverticulum to reduction of intussusception , diverticulectomy and intracorporeal anastomosis . in asymptomatic or incidentally detected meckel 's diverticulum , it is advocated that prophylactic resection of the diverticulum be done when it has an umbilical connection , mesodiverticular band or is heterogeneous on palpation and there is no contraindication for diverticulectomy . thus we conclude , there is no role for surgical inversion of diverticulum even in patients with incidentally detected meckel 's diverticulum . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request.key learning pointssurgically inverting meckel 's diverticulum is not a treatment option.instead of curing it predisposes to further complications . surgically inverting meckel 's diverticulum is not a treatment option.instead of curing it predisposes to further complications . | introductionintusussception leading to intestinal obstruction is a known complication of meckel 's diverticulum .
inverting of meckel 's acts as a lead point for intussusception .
causes of inversion are many but surgical inversion leading to intusussception is extremely rare.presentation of casewe hereby report a case of a 14 year adolescent boy operated previously for open appendicetomy presenting to us with intestinal obstruction who on exploration was found to have an surgically inverted meckel 's diverticulum acting as a lead point for ileo - colic intusussception.discussionto the best of our knowledge , surgically inverting any meckel 's diverticulum is never a treatment option even when the diverticulum is incidentally detected .
diverticulectomy or segmental resection is the procedure of choice for meckel 's diverticulum.conclusionmeckel's divereticulum should never be inverted surgically .
not only it is a wrong method but also increases the risk of complications . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
parkinson 's disease ( pd ) is the most frequent neurodegenerative disorder in europe , with a prevalence of 1/1,000 in the general population and 1.5% in subjects more than 65 years of age . it originates in destruction of the dopaminergic nigrostriatal circuit ; and it is manifested in parkinson 's syndrome , which entails cognitive and psychic complications . in fact , depression is frequent in this disease , with an average prevalence of 40% . many other neuropsychiatric subcortical manifestations have been described in the literature [ 35 ] , but apathy is among the most frequent : current estimates of its prevalence in parkinson 's disease vary between 16.5% and 42% [ 6 , 7 ] . apathy refers to a wide - ranging behavioural , emotional , and motivational constellation including reduced interest and participation in normal purposeful behaviour , lack of initiative with problems initiating or sustaining an activity to completion , lack of concern or indifference , and affective flattening [ 8 , 9 ] . with that said , apathy syndrome may be partially secondary , with regard to dysfunction of a fronto - subcortico - striato - thalamo - cortical loop [ 8 , 1012 ] . furthermore , these circuits are in all likelihood the same as those involved in the motor and cognitive dysfunction typical of parkinson 's disease [ 10 , 13 , 14 ] . in fact , apathy may be considered as a multicomposite entity consisting in dysfunction of associative and limbic loops and accompanied by emotional and motivational aspects . in most cases of apathy , the emotional and motivational dimension arises from intricate links between the generally unconscious mobilization of attentional resources and their purposeful utilization , in which the automatic attentional process assumes a major role . have underscored the basic role of the prefrontal cortex ( particularly the dorsolateral prefrontal cortex ) in attentional process . their studies were primarily based on analyses of patients with frontal lobe injury ( with chronic infarction in the dorsolateral prefrontal cortex ) in which subjects were made to view repetitive frequent ( for voluntary attention ) and infrequent ( for automatic attention ) background stimuli : they demonstrated a correlation between decrease of attentional level , prefrontal lesions , and increase of apathy level ( evaluated with marin apathy scale ) . another study showed a strong correlation between decrease of the electrophysiological attentional marker p300a ( novelty p3 ) and increase of apathy . the same correlation between p300a and apathy has been found in alzheimer 's disease and in cerebral trauma with selective lesion of prefrontal cortex , as illustrated in functional cerebral imaging studies we nonetheless wish to hypothesise that , in parkinson 's disease , there exists a correlation between increase of apathy level and decrease of p300a amplitude , which constitutes an electrophysiological marker of automatic attention . twenty - five patients ( 13 women and 12 men ) , hospitalized in the department of neurology ( chu poitiers ) for evaluation of parkinson 's disease , were included with their agreement ; written informed consent for research purposes was obtained for each patient . the general characteristics of this population were age = 64.1 6.4 years ; duration of pd = 11.5 4.8 years ; daily dose of dopa therapy = 1567.8 725.4 mg ; total updrs score during off period = 25.8 11.8 ; total updrs score during on period = 9.0 7.1 ; hoehn and yahr score = 2.5 0.4 . patients presented with the usual parkinson 's disease criteria . the severity of the disease was evaluated with the hoehn and yahr score , which maps out stages from i through v . the daily dose of dopa therapy was calculated by addition of a daily dose of levodopa and the dopaminergic agonists transcribed as dose - equivalent dopa [ 21 , 22 ] . patients with dementia ( mmse < 24 ) or with serious depression , melancholy , or depression with delirium ( according to the diagnostic and statistical manualcriteria ) were excluded from the study . each subject included in the study was evaluated with cognitive , motor , psychiatric , and subsequent electrophysiological tests during off ( without dopaminergic treatment ) and on ( with dopaminergic treatment ) periods . the study took into account the fluctuating characteristics of pd over the daytime . each period ( on or off ) was selected alternatively in order to have as many patients during the on period as during the off period ( 1 subject ) . only patients able to withstand the off period , or without important dyskinesia in the on period , were included in the study . patients were analyzed during the off period , before taking a levodopa test , patients stopped their treatments the previous evening , and the study began at 8:30 the following morning ( prior to the levodopa test ) . for each patient , the study took place over 3 days ( d0 , d1 , and d2 ) ; the order of tests was systematically the same for all patients . the cognitive assessment included 4 tests systematically taken in 30 minutes in the following order ( in both on and off periods ) : verbal fluency test , stroop test , wisconsin sorting card test , and fab ( frontal assessment battery ) test . in the verbal fluency test , patients were asked to name in one minute as many items as they could from one semantic category ( animals ) and then as many words as they could beginning with the letter m ( one minute ) ; category switching ( boys ' names and fruits ) was then assessed ( one minute ) . in an alternative form , the last one of these verbal fluency tests was used for evaluation of mental flexibility . the stroop test was used for evaluation of inhibitory control . with the wisconsin card sorting test ( wcst ) , we collected data ( number of series , number of mistakes , and perseveration percentage ) in order to evaluate mental flexibility . finally , the frontal assessment battery ( fab ) was used for the purposes of general evaluation of executive functions . after day 0 ( d0 ) assessment , we applied the updrs iii scale and then the hoehn and yahr score , for motor evaluation of pd . in order to assess apathy , we used the starkstein apathy scale . as a variant of the marin apathy scale each item was rated from 0 to 3 so as to calculate an apathy score ranging from 0 to 42 . cut - off score was 14 with 66% sensitivity and 100% specificity . in our study , only patients with score > 14 were considered apathetic . for purposes of psychiatric evaluation , we used the dsm ( diagnostic and statistical manual ) criteria ( d0 ) and the had scale ( d1 and d2 ) . the had scale ( hospital anxiety and depression scale ) was also used during the on and off periods in order to quantify the depression and anxiety levels . we calculated a depression and anxiety score with cut - off > 7 for each of two categories . each patient was subjected to the recording of long - latency auditory evoked potentials according to a previously described protocol [ 3133 ] , and according to the guidelines for event - related potentials ( erp ) , 140 tone bursts ( intensity : 80 db ; duration : 20 ms ; 0.9 ms rise - fall time ) were presented binaurally through earphones at a rate of 1 tone every 0.8 sec , including 100 low frequency sounds ( 1000 hz ) , 20 high target sounds ( 2000 hz ) , and 20 randomized unexpected novelty stimulations ( the word airplane in french , i.e. , avion ) . a disc electrode was affixed to the midline site cz and referred to linked mastoids ; responses to rare and frequent stimuli were averaged separately . the curves were numerically filtrated ( high - pass filter : 0.5 hz ; low - pass filter : 15 hz ) . the horizontal and vertical bipolar electrooculogram ( eog ) was recorded during the task to monitor artefacts . trials with artefacts were automatically excluded from the averages : if any data point ( beyond the first 2.5 ms of the sweep ) was greater than 96% full scale , the entire sweep was rejected and was not added to the memory block . after this first run , all subjects were able to distinguish high - pitched from low - pitched tones and were then instructed to keep a mental record of the rare tones and to report their number at the end of the run ( active condition ) . the p300 wave ( target p3 ) was clearly identifiable only in the active condition in response to rare 2000 hz tones ; this condition was used in measurement of amplitude and latency of n200 and p300 potentials . the p300a ( novelty p3 ) was clearly identifiable in response to the randomized unexpected novelty stimulation ( word avion ) . latency values were calculated from the intersection of extrapolated lines from the ascending and descending slopes of each peak . latencies of n200 and p300 were determined for each subject , as well as the peak - to - peak amplitude of n200-p300 . latency and maximum amplitude of p300a were identified in an interval ranging from 250 ms to 360 ms after stimulation ( on fz , cz , and pz electrodes ) . in addition , average p300a amplitude was calculated in an interval varying from 250 to 360 ms after stimulation and was evaluated in comparison with the basal line ( 60 ms before the stimulation ) . correlations between apathy score ( starkstein apathy scale ) and each feature ( electrophysiological , cognitive , psychiatric , and motor ) were carried out independently ( for data during on and off periods ) with correlation index ( nonparametric spearman 's test ) . the roles of dopaminergic innervation ( reflected by the percentage of improvement after updrs iii score ) or of nondopaminergic lesions ( reflected by the residual updrs iii score in on period ) on the different features ( electrophysiological , cognitive , psychiatric , and motor ) were determined with a matched nonparametric signed - rank wilcoxon test ( z ) with regard to averages during the on and off periods for each feature . differences for each feature ( electrophysiological , cognitive , psychiatric , and motor ) between apathetic and nonapathetic subjects ( a cut - off score was established at 14 ) were determined by using a nonparametric mann - whitney u test for quantitative data and a chi - square test ( corrected chi - square test and exact fisher 's test , according to the conditions of application ) for qualitative data . if a significant correlation between the apathy score and an electrophysiological data appeared , this electrophysiological variable is further dichotomized ( median as cut - off value ) for subsequent logistic regression to predict high or low value of electrophysiological data , apathy score , and other potential confounding factors . after univariate data screening , an ascending stepwise procedure for multivariate analysis was used with significant p values at 10% level to include it into logistic regression . correlations between electrophysiological data and the other variables were calculated using the spearman nonparametric correlation coefficient . the risk was 5% and the statistical tests were carried out in bilateral situations . the software we used for data capture and analysis was statview 5.0 ( from sas institute ) . the apathy score was correlated , during off periods , with a decrease of p300 amplitude in cz and pz locations and with average p300 amplitude in cz and fz locations ( see table 1 and figure 1 ) . during on periods , there was a significant decrease of the amplitude of p300a wave ( in fz ) in apathetic subjects ( see table 1 and figure 2 ) . during off periods , there was a tendency towards decrease of p300a amplitude in fz ( statistically insignificant : p = 0.0707 ) . the apathy score was positively correlated , on the one hand with alteration of mental flexibility ( wcst and verbal fluency test ) and on the other hand with severity of executive dysfunctions ( fab ) during on and off periods , whereas there was no correlation with disturbed inhibitory control ( explored by the stroop test ) ( table 1 ) . in the entire studied population ( 25 patients ) , 6 patients ( 24% ) were depressive according to the dsm criteria , independently of on or off period . the apathy score was positively correlated with the depression score ( had depression ) , during on and off periods , whereas anxiety was not correlated with apathy ( table 1 ) . lastly , the apathy score was correlated with the treated motor score ( total updrs iii during on period ) and the axial updrs iii score . during the off period , the apathy score tended to be correlated with the axial updrs iii score ( statistically insignificant : p = 0.0594 ) ( table 1 ) . the dopaminergic treatment had no consequence on the latency of p300 and p300a amplitude ( in all localizations ) , but it brought about an electrophysiological modification by increasing n200 amplitude during the on period ( p = 0.045 ) . after administration of dopaminergic treatment , the apathy score was significantly lower ( p = 0.0394 ) , whereas there was no significant modification for the other cognitive data . there existed a dopaminergic effect on anxiety ( p = 0.0348 ) but not with regard to depression ( p = 0.3325 ) . lastly and logically , the motor score improved with dopa therapy ( p < 0.0001 ) . during off periods ( table 2 ) , no electrophysiological feature showed a detectable difference between apathetic and nonapathetic patients , but average p300a amplitude ( in fz ) tended to decrease in apathetic subjects ( statistically insignificant : p = 0.0592 ) . on the other hand , apathetic subjects during off period presented with alteration of mental flexibility ( verbal fluency and wcst ) and impairment of executive functions ( fab ) and a higher , more significant depression score ( had depression ) than in nonapathetic subjects . finally , the motor axial score ( axial updrs iii ) and patient age were higher in apathetic subjects ( during off period ) . during on period ( table 3 ) , apathetic patients in on showed a significant decrease of average p300a amplitude ( in fz ) ( figure 3 ) and an increase of n200 latency ( in cz ) . mental flexibility ( wcst ) was lower in apathetic patients during on . apathetic patients during on recorded higher significant depression ( had depression ) and anxiety scores ( had anxiety ) . no modification was observed for motor score or age during on period . following the correlation highlighted by spearman 's test between p300a amplitude ( in fz and on period ) and other variables , the logistic regression was applied only for four variables ( p 0.01 ) : age , verbal fluency ( letter m ) , fab , and apathy score ( starkstein ) . results indicated that apathy is the only variable correlated with the decrease of the amplitude of p300a ( in fz area and on period ) ( table 4 ) . to the best of our knowledge , this study is the first to explore characteristics of apathy in pd by analysing the role of a dysfunction in automatic attention and through use of a neurophysiological approach designed to test patients ' capacity of automatic reactivity to an unexpected sound . the first wave collected ( p300a ) is considered to be a reflection of the automatic attentional process . we have shown a correlation between the apathy score and the decrease of p300a amplitude ( only in fz localization ) and between apathy and treated motor score , severity of frontosubcortical cognitive alteration ( mental flexibility and executive functions ) , and depression . lastly , the dopaminergic treatment increased n200 amplitude ( in pz ) and lessened apathy . the decrease of p300a amplitude in pd is in agreement with other studies , one of which showed , in treated pd , a decrease of p300a amplitude with regard to frontal disturbances . our result nonetheless differs on account of its selectivity : it is observed only during on period ( but with a pronounced tendency during off period ) and it is correlated with the apathy score ( not explored in previous studies ) . the decrease of p300a amplitude has in fact been reported in other studies using a similar electrophysiological protocol , but with a solely visual modality . in patients with alzheimer 's disease , decreased p300a amplitude has been shown and was more pronounced in those with a higher apathy level . p300a wave abnormality was found to be maximal in the central area and interpreted as a consequence of a specific dysfunction of the automatic attentional process ( and not as a consequence of the cognitive disturbance ) . our results consequently suggest , in pd during on period ( and off period ) , the existence of a disturbance of automatic attention as one possible precursor of apathy . this result is in agreement with the hypothesis of marin : apathy could be the partial consequence of a deficit in mobilization of the appropriate attentional resources in a new or unusual situation . in this study , data obtained by linear regression analysis showed that , independently of other data , decreased p300a amplitude predicts severity of the apathy score , thereby confirming this hypothesis . if this hypothesis is admitted , how can we explain the lack of correlation between the apathy score and a modification of the p300a wave during the on period , whereas it is present during off period ? moreover , varied and at times contradictory results with regard to the effect of dopaminergic treatment on p300 and p300a waves have been reported : shortened or unmodified p300 latency with dopa therapy , lengthened p300 latency with dopaminergic agonists , or decrease of p300 amplitude with dopa therapy after acute levodopa and dopaminergic agonist treatment . the improved apathy score with dopaminergic treatment corroborates the results of starkstein et al . and of researchers exploring the influence of dopaminergic treatments on motivation . in a population of 30 nondepressive patients with pd ( without dementia ) , these authors have shown , in comparison with control subjects , that apathy or lessened motivation was more serious during the off period and less serious after the dopaminergic treatment . the clinical result is also coherent with experimental data suggesting a role for dopaminergic mesolimbic innervation in the regulation of the cerebral circuits involved in reward . in these circuits , secretion of dopamine strengthens the signalling of new stimuli for reward , and permits mobilization of attentional resources towards the latter . alternatively , in our work , the hypothesis of a different effect of dopaminergic treatments on attentional process can not be excluded : sensitivity of voluntary attention ( reflected by the p300 wave ) and insensitivity of automatic attention ( likewise reflected by the p300a wave ) for dopaminergic treatment . the results of our study indicate a correlation between the apathy score and severity of frontosubcortical dysfunction . indeed , apathetic patients present executive function disorders ( deterioration of fab ) such as disruption of mental flexibility ( verbal fluency and wcst ) and working memory ( verbal fluency ) . our findings confirm those of pluck and brown , who have shown in their study of apathy in 45 patients with pd a strong link between severity of apathy and disruption of executive functions ( wcst ) and verbal fluency . interestingly , another study using a visual modality of our neurophysiological protocol in patients with frontal lobe injury underscored a correlation between decrease of p300a amplitude and intensity of executive dysfunctions . the authors suggested that prefrontal dysfunction ( particularly dorsolateral prefrontal cortex ) contributed to the disruption of mobilization of attentional resources toward new stimuli . the prefrontal cortex assumes an important role in the appropriate direction of attentional resources toward new stimuli [ 15 , 41 ] . in our patients , executive dysfunctions appear to contribute ( through a similar mechanism suggested by daffner et al . ) to the electrophysiological anomaly we have reported . the frontosubcortical dysfunction probably reflects the progression of nondopaminergic lesions , since it is insensitive to dopaminergic treatment and is correlated with the treated motor score ( reflected by updrs iii in on period ) and the axial motor score during the on period . illustrate one possible mechanism , by showing that apathetic parkinsonian subjects , in comparison with reference subjects , present an attentional disorder ( in situations where attention precedes action ) due to insufficient activation of connections between the prefrontal cortex and premotor cortical areas . and our data strongly suggest that while dopaminergic probably mesolimbic denervation contributes to apathy , nondopaminergic lesions ( bringing about a dysfunction of the frontosubcortical loops probably involving the dorsolateral prefrontal cortex ) likewise play a crucial role . if this is true , how do we explain the results with regard to noncorrelation with the stroop test ? in fact , similar results have been reported in studies concerning healthy [ 43 , 44 ] or parkinsonian subjects . as is the case with ours , these results are compatible with the hypothesis according to which the stroop effect does not apply to perceptive mechanisms but rather to stimulation assessment and response elaboration . and , as we have found in this study , the stroop test requires an adequate attentional level but does not directly necessitate the presence of the loops involved in attentional process . lastly , imaging studies have reported a possible anatomical functional substrate for this hypothesis by showing a lack of activation during the stroop effect this result is similar to the one reported by czernecki et al . who found , in a nondepressive parkinsonian population , using bdi depression scale , a correlation with depression . but it contrasts with the results given by pluck and brown who found no correlation between apathy and depression . furthermore , prevalence of 24% of depression in our study may have reflected a bias . with that said , three arguments counteract this hypothesis : ( a ) prevalence of depression in our population is lower than the average of 40% reported in the literature [ 2 , 48 ] ; ( b ) in this work , the decrease of p300a amplitude ( in fz , during on period ) effectively predicts the severity of apathy score , independently from depression ( table 4 ) ; ( c ) finally , if modifications of p300a wave are reported in depression , they concern mainly a lengthening of latencies , and only melancholy is associated with a decrease of p300a amplitude . in fact , none of our patients present severe depression or melancholy . therefore , these different arguments confirm the postulate that it is possible to distinguish apathy from depression . the absence of a control group and the lack of event - related potential ( erp ) spatial resolution also represent methodological limits . on this subject , some studies have clearly shown modifications of p300a wave with age , but without any observed modification of amplitude . in our case , a control group would have facilitated confirmation that neurophysiological modifications are age independent . it may nonetheless be difficult to explain this result because , in pd , intensity of cognitive troubles is correlated with severity of treated motor score , duration of evolution of the disease , and age of the patient [ 53 , 54 ] , but due to subject distribution , we are prudent when interpreting the data assembled in table 3 . finally , in our study , use of erp does not allow for topographical indication of the neuronal loops involved in apathy . this additional limit is inherent to erp , which presents the advantage of excellent temporal resolution and the drawback of spatial resolution so poor as to preclude precise topographical indication of the dysfunctions . in our exploration of apathy with an electrophysiological approach , it appears that apathy in pd is correlated with a decrease of p300a amplitude : it represents a reliable neurophysiological marker , independently from depression . our results confirm on the one hand the involvement of a dorsolateral prefrontal cortex dysfunction in the antecedents of apathy and on the other hand the beneficial effect on apathy of dopaminergic treatment . enhanced and more purposeful allocation and mobilization of attentional resources are likely to result . from a physiopathological aspect , our results allow us to put forward the following hypothesis : in pd , apathy is the consequence of dopaminergic denervation ( probably mesolimbic ) and nondopaminergic lesions ( linked to evolution of the disease and particularly affecting prefrontal subcorticodorsolateral circuits ) . unfortunately , the low spatial resolution inherent to erp does not allow for a sufficiently accurate approach to the topography of the neuronal pathways involved ; the success of such an approach will require an adroit combination of erp and functional imaging . | in parkinson 's disease ( pd ) , apathy ( or loss of motivation ) is frequent .
nevertheless , the contribution of attentional disorders to its genesis is still not clearly known .
we want to determine the relation existing between apathy and attentional disorders by using p300a ( or novelty p3 ) as a marker of the attentional process .
the study included 25 patients ( 13 women and 12 men ) with pd for whom we have determined the relationship between automatic attention ( represented by p300a ) and motor status , apathy , executive dysfunction , mental flexibility , inhibitory control , and depression / anxiety .
we have found a correlation between the apathy score and amplitude of novelty p300 during the on period and also a correlation of the apathy score with a decrease in amplitude of p300 during the off period . in a linear regression model ,
changes in the p300a predicted the severity of apathy independently of any other variable .
we concluded firstly that the reduction in amplitude of the p300a wave was a neurophysiological marker of apathy in pd and secondly that apathy led to both dopaminergic denervation ( mesolimbic ) and nondopaminergic ( dorsolateral prefrontal - subcortical ) dysfunction . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it is estimated that chronic hepatitis c ( chc ) affects more than 180 million people worldwide , which is about 3% of the world population ( 1 ) . an increase in hepatitis c virus ( hcv)-related morbidities and mortalities has been observed in recent years . in addition , increasing rates of advanced liver disease as a result of hcv infection are expected to be observed in the next decade , and developing countries , which have a higher prevalence of hcv infection , will experience the major burden of end - stage liver diseases ( esld ) throughout the world ( 2 - 4 ) . therefore , it is obvious that this infection is a major concern of health policy makers . fortunately , the risk of developing hepatocellular carcinoma ( hcc ) as one of the main complications of hcv infection can be reduced by 75% with successful treatment ( 5 ) , and today , newly introduced treatment strategies have provided opportunities to manage and control this public health concern ( 6 , 7 ) . in the present study , we conducted an electronic search of available literature published to find pertinent contents reporting novel hcv treatments toward clearance in all hcv infected patient groups and cost benefits of new treatments in the era of daas . to identify articles , the search was begun among all peer - reviewed journal indexed in pubmed , scopus and google scholar . the literature search was done by using the following key words : " hepatitis c virus , hcv , hcv genotypes , special groups , hiv / hcv co - infections , thalassemia , hemophilia , hemodialysis , liver transplantation , mass screening , diagnosis and treatment outcome " . the search results were investigated carefully , and then most relevant results were strongly considered for including in this study by all authors and consulting the supervisor of the study ( sma ) . it began with interferon ( ifn ) mono - therapy , with less than 20% sustained virological response ( svr ) . milestones include the addition of ribavirin ( rbv ) to the treatment protocol and providing pegylated - ifn ( pegifn ) as an alternative treatment ( 8 - 10 ) . treatment with pegifn / rbv was the standard of care for about 10 years , and it allowed about 50% of subjects with hcv genotype 1 infection to attain svr ( 10 - 12 ) . the success rate of treatment with this regimen is very dependent on patient characteristics , including age , body mass index , ethnicity , and genetic factors such as polymorphisms near the interferon lambda 3 ( ifnl3 ) gene ( 13 , 14 ) . viral factors , especially hcv genotype , also affect the response to hcv treatment ( 15 ) , and there are always additional factors that should be taken into account in each treatment approach , including treatment success rate , duration , cost , and side effects . in light of these concerns , knowledge of the hcv replication cycle and the role of viral proteins in the virulence of hcv have resulted in targeting of the viral proteins involved in the hcv life cycle to develop new hcv treatments . in 2011 , the first generation of direct acting antivirals ( daas ) boceprevir ( boc ) and telaprevir ( tvr ) were introduced and added to the previous pegifn / rbv regimen ( 17 , 18 ) . these new triple therapy strategies led to higher svr , but they were still ifn - based and had severe adverse effects . triple therapy with boc or tvr quickly fell out of favor due to the introduction of a new wave of more efficient daas beginning in 2013 , which changed the standards for hcv treatment . in december 2013 , the fda approved sofosbuvir ( sof ) in combination with pegifn / rbv for treatment of hcv genotype 1 infection . this approach achieved a response rate of over 85% ; however , the presence of unfavorable treatment predictors such as cirrhosis , previous history of treatment , and unfavorable host genetics can influence the success rate of treatment with sof / pegifn / rbv ( 19 ) . sof in combination with rbv and/or pegifn was also approved for treatment of hcv genotypes 2 , 3 , and 4 , with limited efficacy for hcv genotype 3 ( 20 ) . in october 2014 , the fda approved ledipasvir ( ldv ) in combination with sof for treatment of hcv genotype 1 , which achieved more than 95% efficacy ( 21 , 22 ) . fortunately , in addition to being more effective than the previous sof / pegifn / rbv regimen , sof / ldv is influenced little by patient characteristics . in december 2014 , the fda approved another ifn - free daa regimen a combination of ombitasvir / paritaprevir - r / dasabuvir ( a three direct acting antiviral , or 3d ) for treatment of hcv genotype 1 infection , with an efficacy rate of over 95% ( 23 ) . finally , in january 2016 , the fda approved combination therapy with grazoprevir / elbasvir ( gzr / ebr ) , with about a 95% svr rate ( 24 ) . other regimens containing daas , such as simeprevir ( smv ) and daclatasvir ( dcv ) , have also been approved for treatment of hcv infection since 2013 ( 25 , 26 ) . the use of new treatment strategies has provided opportunities to eradicate hcv infection . however , effective treatment is not enough ; there are still major issues that must be taken into account , some of which we address in this paper . although an effective treatment regimen is a necessary tool in infection eradication , identifying infected individuals is also of vital importance . subjects with hcv infection can remain asymptomatic for a long time , so they may be unaware of their infection . during this period , infection can progress to advanced liver disease , and the patient may spread the virus to others . surprisingly , about 75% of patients with hcv in the united states are unaware of being infected ( 27 ) . another challenge to developing screening strategies for hcv is the occult nature of this infection , which can not be identified with routine diagnostic tests ( 28 , 29 ) . we believe that health policy makers should design powerful screening programs to identify hcv - infected subjects . risk factors for hcv infection include intravenous drug use ( ivdu ) , history of unsafe injection practices , use of blood and/or blood products before the introduction of blood donor screening for hcv between 1992 and 1996 ( depending on the national policies of different countries ) , being homeless , and history of imprisonment ( 30 ) . the prevalence of these risk factors varies among different populations and countries ; population - based studies have determined that different geographical regions have unique risk factors for hcv infection . for example , baby boomers , persons born between 1945 and 1965 in the united states , account for about 70% of hcv infections in the us ( 31 ) . in addition , previous parenteral therapy for schistosomiasis is a significant predictor of hcv infection in egypt ( 32 ) . however , in some countries , further population - based studies are required to determine the special risk factors related to each area . once this is done , subjects with these risk factors can be recognized as special groups and singled out for screening . these population - based studies should be conducted alongside the implementation of new prevention and treatment strategies in order to track changes in geographically - based risk factors and changes in the prevalence of hcv among subjects with these risk factors . these studies will also help in the evaluation of screening strategies . as a result of geographical differences in risk factors and prevalence , a different screening strategy is needed for each country , and this should be supported by governmental and non - governmental organizations . governments should pay attention to this important issue and fund screening , and health policy makers should design a risk - based , powerful screening method . furthermore , the quality of these activities and screening methods should be evaluated by research projects and epidemiological population - based studies , which can guide policy makers . ultimately , medical practitioners and healthcare personnel have an important role in this regard , and they must support screening projects . risk - based screening strategies can identify about 86% of patients with hcv ( 33 ) . some patients do not have traditional risk factors and therefore can not be identified by risk - based screening . therefore , worldwide clinical screening , together with the approach of risk - based screening ( 34 ) , is recommended . however , the feasibility of such an approach is highly dependent on the economic situation of a given country . one of the main inconveniences of new treatment strategies is their current high cost . for example , the cost of a 12-week treatment with sof is 85,000 - 110,000 usd . new treatment approaches have shorter durations , minimal adverse effects , and higher efficacy ; however , they are very expensive . strategies should be applied to reduce treatment costs and provide wide access to new treatments , especially in low- and middle - income countries , in which about 80% of patients with chc live ( 5 , 35 , 36 ) . people with inherited bleeding disorders ( such as hemophilia ) , people with inherited hemoglobin disorders ( such as thalassemia ) , patients under hemodialysis , patients with organ transplantation ( especially liver- and kidney - transplant patients ) and hcv patients co - infected with hiv are some of the groups that need special attention and priority in treatment ( 37 ) . special patient groups with chc are at increased risk of death or complications ( 38 ) . a basic question arises here : what considerations need to be made for special patient groups in the era of daas ? these populations are the most challenging to treat , and they require massive attention . because of faster progression to both esld and hcc in special patients , hcv is a significant cause of morbidity and mortality in these populations ( 39 ) . hiv / hcv co - infection : hiv and hcv co - infection poses a challenge because it is widespread , particularly among ivdus , and it exhibits lower rates of spontaneous hcv clearance , poor response to treatment of chronic hcv in the pre - daa era , and more rapid progression of hcv - related liver diseases such as cirrhosis and hcc ( 40 ) . global statistics indicate that four to five million people are co - infected with hiv / hcv ( 41 ) . adoption of interferon - based hcv treatments ( following the pegifn / rbv and first - generation hcv protease inhibitors ) resulted in lower svr in those with hiv / hcv co - infection than in those with hcv mono - infection ( 40 ) . furthermore , hcv treatment regimens involve serious adverse effects and pharmacokinetic drug interactions with hiv - antiretroviral drugs ( 42 - 44 ) . the development and approval of new oral regimens of daas has created an opportunity to improve hcv treatment efficacy and safety for hiv / hcv co - infected patients . however , drug interactions between hcv daas and hiv - antiretroviral agents are still a major problem . for example , smv and 3d regimens are contra - indicated in hiv patients receiving many protease inhibitors . today , sof plays a key role in treating hiv / hcv co - infection ; it has a lower degree of interaction with hiv - antiretroviral drugs . the combination of sof / ldv or sof / dcv provides high rates of svr in hiv / hcv co - infected patients . recently , the use of sof / ldv and sof / dcv has been shown to be effective and safe in patients with hiv / hcv co - infection , achieving svr rates of 98% and 96% - 98% , respectively ( 45 , 46 ) . although there has been much progress in the field of hiv / hcv co - infection treatment , this patient population still needs more attention . thalassemia and hemophilia : hcv infection is one of the most common infections following the use of blood and blood products among thalassemia and hemophilia patients ( 47 ) . the treatment of thalassemia patients infected with hcv is a very controversial issue . dual therapy with pegifn / rbv , use of protease inhibitors ( boc and tvr ) , and pegifn / rbv - based triple therapy leads to rbv - associated life - threatening anemia in many thalassemia patients ( 48 ) . on the other hand , the elimination of rbv and the use of low - dose rbv in the treatment of thalassemia patients seems to result in low svr rates ( 49 ) . nevertheless , because of the severe adverse effects of rbv - based treatments in these patients unfortunately , there are currently no clinical trials evaluating the effect of daa use to treat hcv infection in thalassemia patients . although the combination of pegifn and rbv is still used in treatment of hcv - infected thalassemia patients ( 15 ) , a few thalassemia cases have been treated with sof - based treatment in our clinic ( middle east liver disease center ) and experienced a favorable treatment response . however , clinical trials with new daas are required to evaluate this approach . liver failure due to hcv infection is one of the common causes of death in patients with hemophilia . anti - hcv therapy plays a vital role in the interruption of the hcv infection pathway in order to prevent cirrhosis and hcc . the current standard of care for treatment of hcv in hemophilia is pegifn / rbv , which achieves svr in 61% of patients ( 51 ) . however , the side effects of the pegifn / rbv regimen , including thrombocytopenia and excessive bleeding , should be considered . a recent open - label study showed that out of 14 hemophilia patients infected with hcv and treated with sof / ldv , all achieved svr ( 100% ) ( 52 ) . despite the increasing use of highly effective anti - hcv agents with minimal side effects to treat hemophilia patients , hemophiliacs still constitute a unique patient population that requires special consideration . hemodialysis : hcv infection is one of the most common infections transmitted by the parenteral route in patients receiving maintenance hemodialysis ( 53 ) . the use of rbv is problematic in this group . receiving an ifn - free and , if possible , rbv - free regimen is a fundamental , urgent need in patients under hemodialysis ( 51 ) . in persons with renal impairment receiving chronic hemodialysis , options for hcv treatment however , asunaprevir , dcv , smv , gzr / ebr , and 3d regimens are cleared by hepatic metabolism and can be used in patients with renal disease ( 54 ) . liver transplantation : hepatitis c recurrence is common after liver transplantation when patients are transplanted with detectable viral loads . recurrence of hcv following liver transplantation may accelerate graft injury , which is difficult to treat with ifn / rbv therapy ( 55 ) . antiviral treatment before transplantation can prevent hcv recurrence . ifn - based regimens are poorly tolerated and are either ineffectual or contra - indicated in most liver - transplant patients ( 56 ) . in contrast , sof - based regimens have satisfactory virological response in more than 80% of post - transplant patients ( 57 ) . favorable response to the currently available therapies and new highly effective treatments for hcv revealed that hcv clearance could be significantly improved in special patient groups . daa - based therapies stand to achieve a very high rate of treatment success with minimal side effects . the introduction of new therapeutic agents does not detract from the importance of preventive strategies , including the development of an hcv vaccine ( 58 ) . it seems that an effective vaccine is achievable in the near future , and as bill gates has said , treatment without prevention is simply unsustainable . on the other hand , reduction of harmful behaviors should be the main strategy to reduce the prevalence of hcv infection in certain high - risk groups , such as ivdus and inmates ( 27 , 30 ) . furthermore , public knowledge and awareness are vital to the eradication of every disease , and ignorance will prevent future eradication of hcv . it began with interferon ( ifn ) mono - therapy , with less than 20% sustained virological response ( svr ) . milestones include the addition of ribavirin ( rbv ) to the treatment protocol and providing pegylated - ifn ( pegifn ) as an alternative treatment ( 8 - 10 ) . treatment with pegifn / rbv was the standard of care for about 10 years , and it allowed about 50% of subjects with hcv genotype 1 infection to attain svr ( 10 - 12 ) . the success rate of treatment with this regimen is very dependent on patient characteristics , including age , body mass index , ethnicity , and genetic factors such as polymorphisms near the interferon lambda 3 ( ifnl3 ) gene ( 13 , 14 ) . viral factors , especially hcv genotype , also affect the response to hcv treatment ( 15 ) , and there are always additional factors that should be taken into account in each treatment approach , including treatment success rate , duration , cost , and side effects . in light of these concerns , knowledge of the hcv replication cycle and the role of viral proteins in the virulence of hcv have resulted in targeting of the viral proteins involved in the hcv life cycle to develop new hcv treatments . in 2011 , the first generation of direct acting antivirals ( daas ) boceprevir ( boc ) and telaprevir ( tvr ) were introduced and added to the previous pegifn / rbv regimen ( 17 , 18 ) . these new triple therapy strategies led to higher svr , but they were still ifn - based and had severe adverse effects . triple therapy with boc or tvr quickly fell out of favor due to the introduction of a new wave of more efficient daas beginning in 2013 , which changed the standards for hcv treatment . in december 2013 , the fda approved sofosbuvir ( sof ) in combination with pegifn / rbv for treatment of hcv genotype 1 infection . this approach achieved a response rate of over 85% ; however , the presence of unfavorable treatment predictors such as cirrhosis , previous history of treatment , and unfavorable host genetics can influence the success rate of treatment with sof / pegifn / rbv ( 19 ) . sof in combination with rbv and/or pegifn was also approved for treatment of hcv genotypes 2 , 3 , and 4 , with limited efficacy for hcv genotype 3 ( 20 ) . in october 2014 , the fda approved ledipasvir ( ldv ) in combination with sof for treatment of hcv genotype 1 , which achieved more than 95% efficacy ( 21 , 22 ) . fortunately , in addition to being more effective than the previous sof / pegifn / rbv regimen , sof / ldv is influenced little by patient characteristics . in december 2014 , the fda approved another ifn - free daa regimen a combination of ombitasvir / paritaprevir - r / dasabuvir ( a three direct acting antiviral , or 3d ) for treatment of hcv genotype 1 infection , with an efficacy rate of over 95% ( 23 ) . finally , in january 2016 , the fda approved combination therapy with grazoprevir / elbasvir ( gzr / ebr ) , with about a 95% svr rate ( 24 ) . other regimens containing daas , such as simeprevir ( smv ) and daclatasvir ( dcv ) , have also been approved for treatment of hcv infection since 2013 ( 25 , 26 ) . the use of new treatment strategies has provided opportunities to eradicate hcv infection . however , effective treatment is not enough ; there are still major issues that must be taken into account , some of which we address in this paper . although an effective treatment regimen is a necessary tool in infection eradication , identifying infected individuals is also of vital importance . subjects with hcv infection can remain asymptomatic for a long time , so they may be unaware of their infection . during this period , infection can progress to advanced liver disease , and the patient may spread the virus to others . surprisingly , about 75% of patients with hcv in the united states are unaware of being infected ( 27 ) . another challenge to developing screening strategies for hcv is the occult nature of this infection , which can not be identified with routine diagnostic tests ( 28 , 29 ) . we believe that health policy makers should design powerful screening programs to identify hcv - infected subjects . risk factors for hcv infection include intravenous drug use ( ivdu ) , history of unsafe injection practices , use of blood and/or blood products before the introduction of blood donor screening for hcv between 1992 and 1996 ( depending on the national policies of different countries ) , being homeless , and history of imprisonment ( 30 ) . the prevalence of these risk factors varies among different populations and countries ; population - based studies have determined that different geographical regions have unique risk factors for hcv infection . for example , baby boomers , persons born between 1945 and 1965 in the united states , account for about 70% of hcv infections in the us ( 31 ) . in addition , previous parenteral therapy for schistosomiasis is a significant predictor of hcv infection in egypt ( 32 ) . however , in some countries , further population - based studies are required to determine the special risk factors related to each area . once this is done , subjects with these risk factors can be recognized as special groups and singled out for screening . these population - based studies should be conducted alongside the implementation of new prevention and treatment strategies in order to track changes in geographically - based risk factors and changes in the prevalence of hcv among subjects with these risk factors . these studies will also help in the evaluation of screening strategies . as a result of geographical differences in risk factors and prevalence , a different screening strategy is needed for each country , and this should be supported by governmental and non - governmental organizations . governments should pay attention to this important issue and fund screening , and health policy makers should design a risk - based , powerful screening method . furthermore , the quality of these activities and screening methods should be evaluated by research projects and epidemiological population - based studies , which can guide policy makers . ultimately , medical practitioners and healthcare personnel have an important role in this regard , and they must support screening projects . risk - based screening strategies can identify about 86% of patients with hcv ( 33 ) . some patients do not have traditional risk factors and therefore can not be identified by risk - based screening . therefore , worldwide clinical screening , together with the approach of risk - based screening ( 34 ) , is recommended . however , the feasibility of such an approach is highly dependent on the economic situation of a given country . one of the main inconveniences of new treatment strategies is their current high cost . for example , the cost of a 12-week treatment with sof is 85,000 - 110,000 usd . new treatment approaches have shorter durations , minimal adverse effects , and higher efficacy ; however , they are very expensive . strategies should be applied to reduce treatment costs and provide wide access to new treatments , especially in low- and middle - income countries , in which about 80% of patients with chc live ( 5 , 35 , 36 ) . people with inherited bleeding disorders ( such as hemophilia ) , people with inherited hemoglobin disorders ( such as thalassemia ) , patients under hemodialysis , patients with organ transplantation ( especially liver- and kidney - transplant patients ) and hcv patients co - infected with hiv are some of the groups that need special attention and priority in treatment ( 37 ) . special patient groups with chc are at increased risk of death or complications ( 38 ) . a basic question arises here : what considerations need to be made for special patient groups in the era of daas ? these populations are the most challenging to treat , and they require massive attention . because of faster progression to both esld and hcc in special patients , hcv is a significant cause of morbidity and mortality in these populations ( 39 ) . hiv / hcv co - infection : hiv and hcv co - infection poses a challenge because it is widespread , particularly among ivdus , and it exhibits lower rates of spontaneous hcv clearance , poor response to treatment of chronic hcv in the pre - daa era , and more rapid progression of hcv - related liver diseases such as cirrhosis and hcc ( 40 ) . global statistics indicate that four to five million people are co - infected with hiv / hcv ( 41 ) . adoption of interferon - based hcv treatments ( following the pegifn / rbv and first - generation hcv protease inhibitors ) resulted in lower svr in those with hiv / hcv co - infection than in those with hcv mono - infection ( 40 ) . furthermore , hcv treatment regimens involve serious adverse effects and pharmacokinetic drug interactions with hiv - antiretroviral drugs ( 42 - 44 ) . the development and approval of new oral regimens of daas has created an opportunity to improve hcv treatment efficacy and safety for hiv / hcv co - infected patients . however , drug interactions between hcv daas and hiv - antiretroviral agents are still a major problem . for example , smv and 3d regimens are contra - indicated in hiv patients receiving many protease inhibitors . today , sof plays a key role in treating hiv / hcv co - infection ; it has a lower degree of interaction with hiv - antiretroviral drugs . the combination of sof / ldv or sof / dcv provides high rates of svr in hiv / hcv co - infected patients . recently , the use of sof / ldv and sof / dcv has been shown to be effective and safe in patients with hiv / hcv co - infection , achieving svr rates of 98% and 96% - 98% , respectively ( 45 , 46 ) . although there has been much progress in the field of hiv / hcv co - infection treatment , this patient population still needs more attention . thalassemia and hemophilia : hcv infection is one of the most common infections following the use of blood and blood products among thalassemia and hemophilia patients ( 47 ) . the treatment of thalassemia patients infected with hcv is a very controversial issue . dual therapy with pegifn / rbv , use of protease inhibitors ( boc and tvr ) , and pegifn / rbv - based triple therapy leads to rbv - associated life - threatening anemia in many thalassemia patients ( 48 ) . on the other hand , the elimination of rbv and the use of low - dose rbv in the treatment of thalassemia patients seems to result in low svr rates ( 49 ) . nevertheless , because of the severe adverse effects of rbv - based treatments in these patients , it is very important to utilize rbv - free regimens . unfortunately , there are currently no clinical trials evaluating the effect of daa use to treat hcv infection in thalassemia patients . although the combination of pegifn and rbv is still used in treatment of hcv - infected thalassemia patients ( 15 ) , a few thalassemia cases have been treated with sof - based treatment in our clinic ( middle east liver disease center ) and experienced a favorable treatment response . however , clinical trials with new daas are required to evaluate this approach . liver failure due to hcv infection is one of the common causes of death in patients with hemophilia . anti - hcv therapy plays a vital role in the interruption of the hcv infection pathway in order to prevent cirrhosis and hcc . the current standard of care for treatment of hcv in hemophilia is pegifn / rbv , which achieves svr in 61% of patients ( 51 ) . however , the side effects of the pegifn / rbv regimen , including thrombocytopenia and excessive bleeding , should be considered . a recent open - label study showed that out of 14 hemophilia patients infected with hcv and treated with sof / ldv , all achieved svr ( 100% ) ( 52 ) . despite the increasing use of highly effective anti - hcv agents with minimal side effects to treat hemophilia patients , hemophiliacs still constitute a unique patient population that requires special consideration . hemodialysis : hcv infection is one of the most common infections transmitted by the parenteral route in patients receiving maintenance hemodialysis ( 53 ) . receiving an ifn - free and , if possible , rbv - free regimen is a fundamental , urgent need in patients under hemodialysis ( 51 ) . in persons with renal impairment receiving chronic hemodialysis , options for hcv treatment however , asunaprevir , dcv , smv , gzr / ebr , and 3d regimens are cleared by hepatic metabolism and can be used in patients with renal disease ( 54 ) . liver transplantation : hepatitis c recurrence is common after liver transplantation when patients are transplanted with detectable viral loads . recurrence of hcv following liver transplantation may accelerate graft injury , which is difficult to treat with ifn / rbv therapy ( 55 ) . antiviral treatment before transplantation can prevent hcv recurrence . ifn - based regimens are poorly tolerated and are either ineffectual or contra - indicated in most liver - transplant patients ( 56 ) . in contrast , sof - based regimens have satisfactory virological response in more than 80% of post - transplant patients ( 57 ) . favorable response to the currently available therapies and new highly effective treatments for hcv revealed that hcv clearance could be significantly improved in special patient groups . daa - based therapies stand to achieve a very high rate of treatment success with minimal side effects . the introduction of new therapeutic agents does not detract from the importance of preventive strategies , including the development of an hcv vaccine ( 58 ) . it seems that an effective vaccine is achievable in the near future , and as bill gates has said , treatment without prevention is simply unsustainable . studies on vaccine development should be prioritized . on the other hand , reduction of harmful behaviors should be the main strategy to reduce the prevalence of hcv infection in certain high - risk groups , such as ivdus and inmates ( 27 , 30 ) . furthermore , public knowledge and awareness are vital to the eradication of every disease , and ignorance will prevent future eradication of hcv . new treatments have a higher rate of success , less severe side effects , and a shorter duration of therapy . the main goal for the hepatology and infectious disease communities is the eradication of hcv in the next 20 years ; however , hcv eradication will be an uphill battle . the next steps are ( 1 ) finding and treating patients with hcv infection in the general population ; ( 2 ) improving the availability and affordability of effective treatments in developing countries , which will bear the majority of the burden of liver diseases in the next decade without proper management ; ( 3 ) combatting hcv infection in special groups , such as patients with thalassemia , hiv / hcv co - infection , kidney disease , and liver - transplant patients ; and ( 4 ) concentration on prevention alongside treatment , always remembering that prevention is better than a cure . | contextafter the introduction of safe and highly effective hepatitis c virus ( hcv ) treatments , eradication of hcv in the next 20 years is the ultimate goal . since 2011 , the advent of first generation direct acting antivirals ( daas ) were started and followed by the introduction of a new wave of daas in 2013 which exhibit outstanding efficacy .
it is obvious that the eradication of hepatitis c is not restricted to development of daas.evidence acquisitionan electronic search of available literature published was conducted in all peer - reviewed journal indexed in pubmed , scopus and google scholar .
the literature search was done among articles related treatment of hepatitis c with daas in different patient groups with mass screening of the patients and cost benefit of new treatments as main key words.resultsthere are major steps that should be taken to eradicate hcv , including ( 1 ) the development of screening strategies , particularly for groups such as intravenous drug users and recipients of blood or blood products before the introduction of hcv screening in donors ; ( 2 ) the development of strategies to overcome issues with the high cost of recently introduced treatments ; ( 3 ) special attention to special patient groups , such as hiv / hcv co - infection , hemophilia , thalassemia , hemodialysis , and liver - transplant patients ; and ( 4 ) development of preventive strategies , such as the development of an efficient hcv vaccine , special attention to harm reduction in high - risk groups , and promotion of mass awareness of hcv.conclusionsthe eradication of hcv will require significant governmental financial investment for screening , prevention , and treatment of infected patients .
although , we have a long way to eradication of hcv , the next steps could be including proper planning to patient finding , availability of new treatments to all patients and development of hcv prevention strategies such as vaccines . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the rise in mortality seen in central and eastern europe ( cee ) and the former soviet union ( fsu ) in the aftermath of the political transformations of the 1980s and 1990s has attracted considerable attention.16 the mortality increase was largest in russia and other fsu countries . the increase in deaths was largest in working - age men , although it also took its toll on women.2
3
6
7 currently , the mortality profile of cee / fsu is still adverse , relative to western europe.8 yet there is substantial heterogeneity between cee / fsu countries,1
6
8
9 with the czech republic doing particularly well and russia performing particularly badly . for example , in 2011 , male life expectancy at birth was 75 years in the czech republic versus 63 years in the russian federation ( who data ) . in general , cee countries have a better health status than fsu countries . although it is difficult to identify the main cause for this divergence , differences in socioeconomic conditions , health behaviours ( smoking , alcohol ) , diets and healthcare systems are likely to play a role.1
6 national mortality trends conceal marked and persistent within - country differences.1012 an inverse association between socioeconomic position ( sep ) and mortality has been demonstrated in western and eastern europe.1317 however , the description of mortality inequalities in cee / fsu remains fragmentary.13 published reports suggest relatively large socioeconomic gradients in cee / fsu mortality14
15 and a rapid rise in the magnitude of inequalities in recent decades.18
19 yet most studies examined educational inequalities14
15
19
20 and used unlinked vital statistics data , in which information on mortality is derived from one data source , and population data , such as number of person - years , from another source.20
21 unlinked data , although valuable , suffer from numerator - denominator bias , which may seriously affect the estimates of the magnitude and trends in inequalities.20
21 the fact that previous studies mainly focused on educational differentials is an important limitation for several reasons . education measures only one part of socioeconomic stratification , and other dimensions are important as well . different sep parameters convey divergent information on inequalities and , hence , may shed light on the causal mechanisms at stake.2224 second , because of the rapid rise in income inequalities in cee / fsu after the societal transformations of the 1980s and 1990s,25 it is particularly important to investigate the role of material deprivation in this region . the aim of the present study is to quantify and compare socioeconomic inequalities in all - cause mortality during the 2000s in urban population samples from four cee / fsu countries ( the czech republic , russia , poland and lithuania ) , using three different measures of sep . cross - country comparisons of socioeconomic inequalities are likely to improve our understanding of inequality - generating mechanisms . insofar as inequality patterns differ between countries , country characteristics are important determinants of inequalities . based on previous research , we hypothesise that the burden of mortality and , consequently , the absolute inequalities , will be larger in russia , especially among men.26 the sep measures considered in this paper are education , difficulty buying food and household amenities . education is thought to affect health either directly , via knowledge and skills acquired , or indirectly , via its influence on future employment and income.2224 the other two sep indicators difficulty buying food and household amenities are markers of material circumstances . the former reflects current material resources and is considered a measure of absolute deprivation , affecting health directly ( eg , through malnutrition ) . the latter captures accumulated wealth through the life course and can be seen as an indicator of relative deprivation , which may influence health indirectly ( eg , through reduced participation in society).2224
26 as socioeconomic stratification has multiple dimensions , it is hypothesised that each sep indicator will be independently associated with mortality . data from the baseline survey and the mortality follow - up of the health , alcohol and psychosocial factors in eastern europe ( hapiee ) study were used . the study was set up to investigate determinants of health in cee / fsu following the societal transformations . the hapiee study consists of four cohorts in the czech republic , russia , poland and lithuania . these cohorts are situated in seven middle - sized towns in the czech republic and three leading centres of academic and cultural life ( novosibirsk , krakow and kaunas ) , in russia , poland and lithuania . the cohorts were randomly selected from urban population registers ( electoral lists in russia ) , stratified by gender and 5-year age groups . in total , 35 992 people aged 4569 years at baseline participated in the study . the baseline survey took place in 20022005 in the czech republic , russia and poland and in 20052008 in lithuania . a more detailed description of the hapiee study methodology has been reported elsewhere.27 the study was approved by the university college london / university college london hospital ethics committee and by the local ethics committee in each participating centre . deaths in the cohorts were identified through linkage with mortality registers ( n=2750 ) . for the czech republic and lithuania , mortality was followed until the end of 2011 , for russia until the end of 2010 and for poland until 30 june 2009 . median follow - up was 8.1 , 6.5 , 5.5 and 4.5 years for the czech republic , russia , poland and lithuania , respectively . people who were lost to follow - up were censored at their last date of contact ( n=1082 ) . the proportion of people lost to follow - up varied considerably by country , ranging from 0.3% in the czech republic and lithuania to 7% in poland . the high percentage of censored people in poland is mainly due to withdrawal from the study . , education was classified according to the international standard classification of education ( isced ) , v.2011 . participants were grouped into three levels of education : ( 1 ) preprimary , primary and lower secondary ( isced 02 ) ; ( 2 ) upper secondary ( isced 34 ) ; and ( 3 ) tertiary education ( isced 58 ) . absolute material deprivation was assessed by the question how often do you not have enough money for food. answers were coded as never / rarely ( 0 ) and sometimes / often / all the time ( 1 ) ; the derived variable was called deprivation . the number of household amenities ( microwave , video recorder , colour television , washing machine , dishwasher , freezer , camcorder , satellite tv , telephone and mobile phone ) , varying from 0 to 10 , was divided into country - specific tertiles to represent relative deprivation . the proportion of missing values was 0.4% for education , 0.8% for deprivation and 4.6% for amenities . as the distribution of sep indicators differed substantially by country and gender ( table 1 ) , we calculated country - specific and gender - specific age - standardised mortality rates ( asmrs ) , directly standardised to the who standard population.28 distribution of baseline socioeconomic position indicators by country and gender * pre - primary , primary and lower secondary education . to assess relative sep differences in all - cause mortality , age - adjusted cox regression models were fitted , with time - on - study as time scale . the relative index of inequality ( rii ) was calculated to measure the magnitude of inequalities in mortality by education.29
30 first , a country - specific and gender - specific educational rank variable was constructed , ranging from 0 to 1 ( highest to lowest end of educational distribution ) . it was then regressed on all - cause mortality , using age - adjusted poisson regression.31 the resulting rii can be interpreted as the rate of dying at the bottom versus the top of the educational hierarchy . as the rii accounts for differences in the distribution of education , it can be used for comparative purposes.32 in addition to the rii , the slope index of inequality ( sii ) by education was calculated , representing the absolute difference between the predicted mortality rates at the lower versus the higher end of the education distribution.15 despite large relative and absolute differences in mortality inequalities between countries , the direction and graded pattern of the association between sep and all - cause mortality was similar in all samples . two gender - specific cox models were fitted : first , a model with age , country and each sep measure separately ; and second , a model with age , country and all three sep measures simultaneously . the proportional hazards assumption was checked in all cox models,33 indicating no violation of the assumption . to evaluate the robustness of the findings , sensitivity analyses were conducted : ( 1 ) different categorisations of sep variables were used in the models ; and ( 2 ) the first 2 years of follow - up were excluded , to filter out possible health selection effects . data from the baseline survey and the mortality follow - up of the health , alcohol and psychosocial factors in eastern europe ( hapiee ) study were used . the study was set up to investigate determinants of health in cee / fsu following the societal transformations . the hapiee study consists of four cohorts in the czech republic , russia , poland and lithuania . these cohorts are situated in seven middle - sized towns in the czech republic and three leading centres of academic and cultural life ( novosibirsk , krakow and kaunas ) , in russia , poland and lithuania . the cohorts were randomly selected from urban population registers ( electoral lists in russia ) , stratified by gender and 5-year age groups . in total , 35 992 people aged 4569 years at baseline participated in the study . the baseline survey took place in 20022005 in the czech republic , russia and poland and in 20052008 in lithuania . a more detailed description of the hapiee study methodology has been reported elsewhere.27 the study was approved by the university college london / university college london hospital ethics committee and by the local ethics committee in each participating centre . deaths in the cohorts were identified through linkage with mortality registers ( n=2750 ) . for the czech republic and lithuania , mortality was followed until the end of 2011 , for russia until the end of 2010 and for poland until 30 june 2009 . median follow - up was 8.1 , 6.5 , 5.5 and 4.5 years for the czech republic , russia , poland and lithuania , respectively . people who were lost to follow - up were censored at their last date of contact ( n=1082 ) . the proportion of people lost to follow - up varied considerably by country , ranging from 0.3% in the czech republic and lithuania to 7% in poland . the high percentage of censored people in poland is mainly due to withdrawal from the study . , education was classified according to the international standard classification of education ( isced ) , v.2011 . participants were grouped into three levels of education : ( 1 ) preprimary , primary and lower secondary ( isced 02 ) ; ( 2 ) upper secondary ( isced 34 ) ; and ( 3 ) tertiary education ( isced 58 ) . absolute material deprivation was assessed by the question how often do you not have enough money for food. answers were coded as never / rarely ( 0 ) and sometimes / often / all the time ( 1 ) ; the derived variable was called deprivation . the number of household amenities ( microwave , video recorder , colour television , washing machine , dishwasher , freezer , camcorder , satellite tv , telephone and mobile phone ) , varying from 0 to 10 , was divided into country - specific tertiles to represent relative deprivation . the proportion of missing values was 0.4% for education , 0.8% for deprivation and 4.6% for amenities . as the distribution of sep indicators differed substantially by country and gender ( table 1 ) , we calculated country - specific and gender - specific age - standardised mortality rates ( asmrs ) , directly standardised to the who standard population.28 distribution of baseline socioeconomic position indicators by country and gender * pre - primary , primary and lower secondary education . to assess relative sep differences in all - cause mortality , age - adjusted cox regression models were fitted , with time - on - study as time scale . the relative index of inequality ( rii ) was calculated to measure the magnitude of inequalities in mortality by education.29
30 first , a country - specific and gender - specific educational rank variable was constructed , ranging from 0 to 1 ( highest to lowest end of educational distribution ) . it was then regressed on all - cause mortality , using age - adjusted poisson regression.31 the resulting rii can be interpreted as the rate of dying at the bottom versus the top of the educational hierarchy . as the rii accounts for differences in the distribution of education , it can be used for comparative purposes.32 in addition to the rii , the slope index of inequality ( sii ) by education was calculated , representing the absolute difference between the predicted mortality rates at the lower versus the higher end of the education distribution.15 despite large relative and absolute differences in mortality inequalities between countries , the direction and graded pattern of the association between sep and all - cause mortality was similar in all samples . two gender - specific cox models were fitted : first , a model with age , country and each sep measure separately ; and second , a model with age , country and all three sep measures simultaneously . the proportional hazards assumption was checked in all cox models,33 indicating no violation of the assumption . to evaluate the robustness of the findings , sensitivity analyses were conducted : ( 1 ) different categorisations of sep variables were used in the models ; and ( 2 ) the first 2 years of follow - up were excluded , to filter out possible health selection effects . educational attainment was particularly high in russia , poland and lithuania , mainly because these cohorts are situated in cities with large universities . women were generally worse off than men : they were less educated and more deprived . large differences in asmrs were observed across countries and between genders ( table 2 ) . in men and women , asmrs ranged from 12.2 ( 95% ci 11.0 to 13.3 ) per 1000 person - years in the czech republic to 23.6 ( 95% ci 21.7 to 25.5 ) in russia ; among women , they varied from 4.7 ( 95% ci 3.6 to 5.7 ) per 1000 in lithuania to 7.1 ( 95% ci 6.3 to 8.0 ) in russia . country - specific and gender - specific numbers of deaths and age - standardised mortality rates ( asmrs ) per 1000 person - years by education , deprivation and amenities ( hapiee mortality follow - up data ) * pre - primary , primary and lower secondary education . hapiee , health , alcohol and psychosocial factors in eastern europe ; second , secondary ; sii , slope index of inequality . absolute sep differences by country and gender are presented in table 2 . for education and amenities , the mortality difference between the bottom and top tertile of amenities amounted to 23.1 per 1000 person - years , and the sii for education to 19.4 per 1000 . the largest absolute inequalities for difficulty buying food were found in lithuanian men , with a rate difference of 15.9 per 1000 . although having a high sep was beneficial in all countries , mortality in russian men remained high at all levels of sep . absolute mortality differentials by all three sep measures were smaller in women than in men , reflecting lower death rates . all models were age - adjusted and included only one sep measure at a time . for example , in czech women , hazard ratios ( hrs ) were 2.4 ( 95% ci 1.3 to 4.2 ) and 1.6 ( 95% ci 0.9 to 2.7 ) for women with lower and upper secondary education , respectively , compared with women with a university degree . rii reached 4.9 ( 95% ci 2.1 to 11.8 ) , denoting that the rate of dying at the bottom of the educational hierarchy is almost five times the rate of dying at the top of the educational hierarchy . in all countries , people who reported being deprived ( ie , were short of money for food ) died more often . there was an inverse graded association between household amenities and mortality : persons who were in the bottom tertile of this variable had the highest mortality , followed by people in the mid tertile . age - adjusted country - specific and gender - specific hazard ratios ( hrs ) and 95% cis by education , deprivation and amenities ( hapiee mortality follow - up data ) * pre - primary , primary and lower secondary education . hapiee , health , alcohol and psychosocial factors in eastern europe ; rii , relative index of inequality ; second , secondary . when all three sep indicators were included in one model , hrs were reduced by about a third , but all variables retained strong independent effects ( table 4 , model 2 ) . age - adjusted and gender - specific hazard ratios ( hrs ) cis by education , deprivation and amenities in pooled sample ( hapiee mortality follow - up data ) * model 1 : adjusted for age and country . pre - primary , primary and lower secondary education . hapiee , health , alcohol and psychosocial factors in eastern europe . absolute sep differences by country and gender are presented in table 2 . for education and amenities , largest absolute inequalities were observed in russian men . the mortality difference between the bottom and top tertile of amenities amounted to 23.1 per 1000 person - years , and the sii for education to 19.4 per 1000 . the largest absolute inequalities for difficulty buying food were found in lithuanian men , with a rate difference of 15.9 per 1000 . although having a high sep was beneficial in all countries , mortality in russian men remained high at all levels of sep . absolute mortality differentials by all three sep measures were smaller in women than in men , reflecting lower death rates . all models were age - adjusted and included only one sep measure at a time . for example , in czech women , hazard ratios ( hrs ) were 2.4 ( 95% ci 1.3 to 4.2 ) and 1.6 ( 95% ci 0.9 to 2.7 ) for women with lower and upper secondary education , respectively , compared with women with a university degree . rii reached 4.9 ( 95% ci 2.1 to 11.8 ) , denoting that the rate of dying at the bottom of the educational hierarchy is almost five times the rate of dying at the top of the educational hierarchy . in all countries , people who reported being deprived ( ie , were short of money for food ) died more often . there was an inverse graded association between household amenities and mortality : persons who were in the bottom tertile of this variable had the highest mortality , followed by people in the mid tertile . age - adjusted country - specific and gender - specific hazard ratios ( hrs ) and 95% cis by education , deprivation and amenities ( hapiee mortality follow - up data ) * pre - primary , primary and lower secondary education . hapiee , health , alcohol and psychosocial factors in eastern europe ; rii , relative index of inequality ; second , secondary . when all three sep indicators were included in one model , hrs were reduced by about a third , but all variables retained strong independent effects ( table 4 , model 2 ) . age - adjusted and gender - specific hazard ratios ( hrs ) cis by education , deprivation and amenities in pooled sample ( hapiee mortality follow - up data ) * model 1 : adjusted for age and country . in all four countries , we found clear mortality differentials by the three sep measures . the largest absolute inequalities were generally observed among russian men , while largest relative inequalities were seen among lithuanian women . the hapiee samples are predominantly urban , and , hence , are not entirely representative of the populations of their respective countries . it is likely , however , that the socioeconomic characteristics and mortality profiles of the hapiee samples reflect those of the urban populations of the czech republic , russia , poland and lithuania , respectively.27 the generalisability of our results is somewhat restricted by withdrawal from the study and non - response to the baseline survey . the response rates in the hapiee study were similar to those in other contemporary studies.34
35 people who withdrew from the study were likely to be lower educated and more deprived . consistent with many other studies , hapiee non - responders were more likely to be male , younger , lower educated and less healthy than responders.27 to the extent that the non - responder characteristics differ between countries , cross - country comparisons are problematic . due to higher mortality rates and a generally less favourable socioeconomic profile among non - responders , within - country analyses are likely to underestimate the burden of mortality and its sep gradient . furthermore , to partly account for between - country differences in the meaning and distribution of the amenities variable , country - specific tertiles were derived . the cohort design of the study minimises the numerator - denominator bias and facilitates the assessment of causality . the association between the sep variables at baseline and subsequent mortality is unlikely to result from reverse causality . however , some health selection may have occurred , and it may partly account for the observed associations between sep and mortality . the effect of recent health selection is probably rather small , as suggested by the sensitivity analyses : excluding the first 2 years of follow - up did not alter the results substantially . yet other methodological strengths are the use of absolute and relative measures of inequality ( sii and rii ) and of different sep indicators ( education , deprivation and amenities ) . sii and rii can be used for comparative purposes , on condition that the relationship between the educational rank variable and the outcome ( in our case , all - cause mortality ) is linear . despite the fact that the education variable consisted of merely three groups , the assumption of linearity was not violated . as mentioned in the introduction , virtually all previous studies in cee / fsu used education as the main or only sep indicator . assessment of measures of material circumstances adds important new information to the evidence of social inequalities in the region . the absolute mortality rates in the hapiee samples were highest in russia . despite improvements in the last few years , the long - term mortality trends and mortality rises in the 1990s led to mortality rates that are among the highest in the world.6
8 mortality rates in urban czech , polish and lithuanian hapiee samples were lower than the national averages and comparable with each other , and with western european rates.8 for example , in 20012009 , belgian asmrs were 12.5 ( 95% ci 12.3 to 12.6 ) per 1000 person - years for 4569-year - old men and 6.6 ( 95% ci 6.4 to 6.7 ) for 4569-year - old women ( own calculations ) . the relatively low mortality rates in the czech , polish and lithuanian samples are probably related to the urban character of the cohorts.36 contrary to expectations , lithuanian mortality rates were similar to those in the czech republic and poland , possibly due to a favourable socioeconomic profile of kaunas.36 in agreement with other findings,12 mortality was lower among women , compared with men , in all hapiee samples . in the past , research on socioeconomic inequalities in cee / fsu mainly used education14
15
19
20 or area - level data.13 for the latter , the assumption is that area - level associations between sep indicators and mortality mirror associations at the individual level.13 this assumption may often hold , but it could be prone to ecological fallacy . regarding the former , previous studies have demonstrated educational gradients in all - cause mortality in cee / fsu countries.14
19 our study adds to the literature by also focusing on other individual - based measures of sep . to the best of our knowledge , there is only one comparative study on individual - level socioeconomic inequalities , which includes cee / fsu countries and looks beyond education.17 eikemo et al17 have shown that class - related morbidity inequalities in cee / fsu were comparable with those in the rest of europe . in line with these findings , our analyses indicate that inequalities exist according to all sep indicators considered . in other words , education and absolute and relative deprivation all play a part . our pooled analyses have shown that , despite some overlap between the three indicators , the effects of these sep measures were largely independent . we were able to demonstrate an important independent role of absolute and relative material deprivation ( difficulty buying food and amenities ) . these material factors mediated some of the effect of education on mortality . on the other hand , education remained important , demonstrating the relevance of other factors for socioeconomic stratification in mortality . notwithstanding large similarities in inequality patterns across countries and between genders , country- and gender - specific differences were observed . this finding may partially reflect the relatively small burden of mortality in these groups,37 but it also supports previous research that found relatively large relative inequalities in lithuanian mortality.19 as expected , absolute inequalities were largest in russian men , and they were larger in men than in women , reflecting the higher absolute mortality rates.37 the high absolute mortality rates among russian men in every sep group suggest that it is the lower - educated and poor men who are affected by the conditions responsible for the high mortality burden , and that these conditions impinge upon all russian men . on the other hand , these findings point at the importance of societal characteristics for understanding sep inequalities among russian men . hence , russia may benefit the most from prevention programmes , targeting the socioeconomic gradient and the overall high mortality level , and with a specific focus on men . in all four countries , we found clear mortality differentials by the three sep measures . the largest absolute inequalities were generally observed among russian men , while largest relative inequalities were seen among lithuanian women . the hapiee samples are predominantly urban , and , hence , are not entirely representative of the populations of their respective countries . it is likely , however , that the socioeconomic characteristics and mortality profiles of the hapiee samples reflect those of the urban populations of the czech republic , russia , poland and lithuania , respectively.27 the generalisability of our results is somewhat restricted by withdrawal from the study and non - response to the baseline survey . the response rates in the hapiee study were similar to those in other contemporary studies.34
35 people who withdrew from the study were likely to be lower educated and more deprived . consistent with many other studies , hapiee non - responders were more likely to be male , younger , lower educated and less healthy than responders.27 to the extent that the non - responder characteristics differ between countries , cross - country comparisons are problematic . due to higher mortality rates and a generally less favourable socioeconomic profile among non - responders , within - country analyses are likely to underestimate the burden of mortality and its sep gradient . furthermore , to partly account for between - country differences in the meaning and distribution of the amenities variable , country - specific tertiles were derived . the cohort design of the study minimises the numerator - denominator bias and facilitates the assessment of causality . the association between the sep variables at baseline and subsequent mortality is unlikely to result from reverse causality . however , some health selection may have occurred , and it may partly account for the observed associations between sep and mortality . the effect of recent health selection is probably rather small , as suggested by the sensitivity analyses : excluding the first 2 years of follow - up did not alter the results substantially . yet other methodological strengths are the use of absolute and relative measures of inequality ( sii and rii ) and of different sep indicators ( education , deprivation and amenities ) . sii and rii can be used for comparative purposes , on condition that the relationship between the educational rank variable and the outcome ( in our case , all - cause mortality ) is linear . despite the fact that the education variable consisted of merely three groups , the assumption of linearity was not violated . as mentioned in the introduction , virtually all previous studies in cee / fsu used education as the main or only sep indicator . assessment of measures of material circumstances adds important new information to the evidence of social inequalities in the region . the absolute mortality rates in the hapiee samples were highest in russia . despite improvements in the last few years , the long - term mortality trends and mortality rises in the 1990s led to mortality rates that are among the highest in the world.6
8 mortality rates in urban czech , polish and lithuanian hapiee samples were lower than the national averages and comparable with each other , and with western european rates.8 for example , in 20012009 , belgian asmrs were 12.5 ( 95% ci 12.3 to 12.6 ) per 1000 person - years for 4569-year - old men and 6.6 ( 95% ci 6.4 to 6.7 ) for 4569-year - old women ( own calculations ) . the relatively low mortality rates in the czech , polish and lithuanian samples are probably related to the urban character of the cohorts.36 contrary to expectations , lithuanian mortality rates were similar to those in the czech republic and poland , possibly due to a favourable socioeconomic profile of kaunas.36 in agreement with other findings,12 mortality was lower among women , compared with men , in all hapiee samples . in the past , research on socioeconomic inequalities in cee / fsu mainly used education14
15
19
20 or area - level data.13 for the latter , the assumption is that area - level associations between sep indicators and mortality mirror associations at the individual level.13 this assumption may often hold , but it could be prone to ecological fallacy . regarding the former , previous studies have demonstrated educational gradients in all - cause mortality in cee / fsu countries.14
19 our study adds to the literature by also focusing on other individual - based measures of sep . to the best of our knowledge , there is only one comparative study on individual - level socioeconomic inequalities , which includes cee / fsu countries and looks beyond education.17 eikemo et al17 have shown that class - related morbidity inequalities in cee / fsu were comparable with those in the rest of europe . in line with these findings , our analyses indicate that inequalities exist according to all sep indicators considered . in other words , education and absolute and relative deprivation all play a part . our pooled analyses have shown that , despite some overlap between the three indicators , the effects of these sep measures were largely independent . we were able to demonstrate an important independent role of absolute and relative material deprivation ( difficulty buying food and amenities ) . these material factors mediated some of the effect of education on mortality . on the other hand , education remained important , demonstrating the relevance of other factors for socioeconomic stratification in mortality . notwithstanding large similarities in inequality patterns across countries and between genders , country- and gender - specific differences were observed . this finding may partially reflect the relatively small burden of mortality in these groups,37 but it also supports previous research that found relatively large relative inequalities in lithuanian mortality.19 as expected , absolute inequalities were largest in russian men , and they were larger in men than in women , reflecting the higher absolute mortality rates.37 the high absolute mortality rates among russian men in every sep group suggest that it is the lower - educated and poor men who are affected by the conditions responsible for the high mortality burden , and that these conditions impinge upon all russian men . on the other hand , absolute inequalities among russian women are comparable with those in other countries . these findings point at the importance of societal characteristics for understanding sep inequalities among russian men . hence , russia may benefit the most from prevention programmes , targeting the socioeconomic gradient and the overall high mortality level , and with a specific focus on men . this study demonstrates large absolute and relative mortality inequalities according to three different sep measures ( education , difficulty buying food and amenities ) . in other words , mortality inequalities in cee / fsu are not an either - or story , but a both - and story : knowledge and skills , absolute and relative deprivation all play a part . the high overall mortality rates in these countries imply the powerful effects of current and past social and economic environment on the health of all societal groups . differences in the magnitude of sep inequalities between countries are likely to reflect differences in societal characteristics . the large within - country inequalities in mortality indicate that lower - sep groups have been disproportionally affected . in addition to promoting and monitoring the health of all , preventive and healthcare policy should pay particular attention to lower - sep groups , and take into account different dimensions of socioeconomic disadvantage . to further inform policy , future research should investigate inequalities in cause - specific mortality and the intermediary mechanisms linking sep to mortality . what is already known on this subject?mortality rates are high in central and eastern europe and the former soviet union , compared with western europe . this study assesses the associations between mortality and absolute and relative deprivation , as well as education , in four countries in this region . what this study adds?this study adds to the literature by demonstrating large absolute and relative mortality inequalities by measures of material deprivation ( amenities and difficulty buying food ) in the czech republic , russia , poland and lithuania . these material differences in mortality are relatively independent from educational mortality differences , hinting at the multifaceted nature of socioeconomic inequalities . preventive and healthcare policies may benefit from taking into account different dimensions of socioeconomic disadvantage . mortality rates are high in central and eastern europe and the former soviet union , compared with western europe . this study assesses the associations between mortality and absolute and relative deprivation , as well as education , in four countries in this region . this study adds to the literature by demonstrating large absolute and relative mortality inequalities by measures of material deprivation ( amenities and difficulty buying food ) in the czech republic , russia , poland and lithuania . these material differences in mortality are relatively independent from educational mortality differences , hinting at the multifaceted nature of socioeconomic inequalities . preventive and healthcare policies may benefit from taking into account different dimensions of socioeconomic disadvantage . | backgroundrelatively large socioeconomic inequalities in health and mortality have been observed in central and eastern europe ( cee ) and the former soviet union ( fsu ) . yet
comparative data are sparse and virtually all studies include only education .
the aim of this study is to quantify and compare socioeconomic inequalities in all - cause mortality during the 2000s in urban population samples from four cee / fsu countries , by three different measures of socioeconomic position ( sep ) ( education , difficulty buying food and household amenities ) , reflecting different aspects of sep.methodsdata from the prospective population - based hapiee ( health , alcohol , and psychosocial factors in eastern europe ) study were used .
the baseline survey ( 20022005 ) included 16 812 men and 19 180 women aged 4569 years in novosibirsk ( russia ) , krakow ( poland ) , kaunas ( lithuania ) and seven czech towns .
deaths in the cohorts were identified through mortality registers .
data were analysed by direct standardisation and cox regression , quantifying absolute and relative sep differences.resultsmortality inequalities by the three sep indicators were observed in all samples .
the magnitude of inequalities varied according to gender , country and sep measure .
as expected , given the high mortality rates in russian men , largest absolute inequalities were found among russian men ( educational slope index of inequality was 19.4 per 1000 person - years ) .
largest relative inequalities were observed in czech men and lithuanian subjects .
disadvantage by all three sep measures remained strongly associated with increased mortality after adjusting for the other sep indicators.conclusionsthe results emphasise the importance of all sep measures for understanding mortality inequalities in cee / fsu . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
regular exercise improves the blood lipids and has a positive effect on endothelial cells
of the blood vessel , eventually slowing down or preventing progress of the arteriosclerosis . as therapies for obesity , dietary therapy , exercise therapy , medicinal therapy , and behavior
therapy have been used and among then exercise therapy is the most economical , safe , and
fundamental treatment of all obesity treatments1 . furthermore , a clinical survey reported that 67.5% of patients with
obesity lacked exercise , and overweight persons were found among those who work for a long
time sitting on a chair2 . it has a big effect on weight - loss in a short period of
time , but this can cause several problems , such as decrease in lean body mass ( lbm ) due to
loss of muscular tissues , a decline in the basal metabolic rate ( bmr ) at rest , and the
induction of myofunctional disorder3 , 4 . resistance weight training was to have a positive effect on the reduction of body fat by
increasing muscle tissues maintaining of muscular strength , increasing in fat - free mass ; and
reducing blood lipids and lipoprotein metabolism , emphasizing the importance of resistance
weight training as an effective method for weight control . furthermore , controlling
inter - set rest times during weight training significantly affected blood lipid
concentrations and body construction4 . weight training also improves the insulin reaction , increases bone density or prevents its
loss , and reduces the loss of muscle mass and muscular strength which accompanies aging5 . in addition , weight training has also been
reported to increase muscle strength and the cross - sectional area of muscle not only in men ,
but also in women in middle and old age . accordingly , it is desirable that an exercise
program for the most safe and efficient weight loss should be composed of a combination
aerobic exercise with resistance weight training tailrored to the subject s level . in a
recent study , a combination of aerobic exercise and resistance weight training performed by
middle - aged women with obesity was found to have a positive effect on body composition and
blood lipids6 , 7 . another study reported the importance of dietary therapy as well as
exercise therapy , and stated that exercise therapy without considering dietary therapy would
not reduce body fat8 . a few findings have recently been reported regarding the effects of exercise on women with
obesity accompanying adult diseases and illnesses . however , they are insufficient and
further , more specific and diverse experiments and researches are necessary into how dietary
exercises can be combined to create an ideal exercise program tailored to personal
characteristics . the purpose of this study was to examine the effects of exercise therapy on
blood lipids of obese women . the subjects were 24 women with no habit of regular exercise ( table 1table 1.characteristics of the subjectsgroupage ( yrs)height ( cm)weight ( kg)(%fat)exercise51.37.34152.28.1165.93.334.49.8control50.58.41154.56.3366.22.633.510.2 ) . they were selected using bioelectrical impedance measures which showed they
had body fat percentages of over 30% . none of the subjects had high blood pressure or
diabetes and none had performed systematic exercise for at least 3 months . the subjects were
divided into an group ( n=12 ) , which performed an exercise program for 10 weeks , and a
control group ( n=12 ) , which performed no exercise . the subjects of the exercise group
performed exercise for 10 weeks diet restriction , and we investigated how this type of
exercise influenced on blood lipids ; consequently aiming at preparing a basic data for
designing appropriate and developmental exercise methods and programs to treat obesity to
reduce the risk of developing coronary diseases . the collected blood was centrifuged at 3,000 rpm for 10 minutes and
the plasma was preserved at 73 c . for hemanalysis , all experiments were reviewed and approved by
the committee of the honam university . the purpose and procedure of the study were explained
to the subjects who voluntarily signed an informed consent agreement before participating in
the experiment . for the exercise load test of this study they performed 10 minutes warm - up and 10 minutes treadmill
workout then took a rest of 20 minutes before the main test . the maximum exercise load test
was conducted at 70% of hrmax using the modified bruce protocol in order to individually set
the exercise intensity to hrmax of 70% . in the treadmill exercise load test , the heart rate
was measured using an electrocardiogram ( ecg ) in real time , and the blood pressure ( bp ) was
recorded by an automatic sphygmomanometer with a bp cuff applied to the arm , and set to
automatically measure bp at 3-minute intervals . in the recovery period after finishing the
treadmill exercise at 70% of hrmax , bp was measured and recorded at intervals of 2 minutes . all the subjects performed
exercise for 30 minutes using a treadmill load speed and gradient corresponding to hrmax of
50% . blood was collected when a stable condition , had been established and the subjects were
prohibited from taking any food , smoke , drinks , or hard exercise from 10 oclock on the
night before the test day . the aerobic - exercise method of this study was determined based on exercise prescriptions ,
of intensity , frequency and time of exercise suggested by acsm ( 2009 ) , after implementing an
exercise load test . the type of exercise was walking at a quick pace , and the intensity of
exercise was low intensity , long - term exercise , rather than high intensity , short - term
exercise , with an hrmax of 4060% . the intensity of exercise was watched by using the polar
heart rate checker in order to check the subject s exercise intensity . the exercise was performed 5 times per week , and the exercise program was composed of 5 min
warm up , 3040 min main exercise and 5 min cool down . ancova was utilized
to test the significance of differences in the variables between before and after the
exercise program lasting 10 weeks . the blood lipid values and statistics of the exercise group and the control group are
presented in table 2table 2.changes in tc ( unit : mg / dl)variabletg ( mg / dl)prepostexercise195.57.4165.98.3*control201.99.3185.206.7 . total cholesterol of the exercise group was 195.57.4 mg / dl before the intervention and
165.98.3 mg / dl after the intervention . total cholesterol of the control group was
201.99.3 mg / dl before the intervention and 185.206.7 mg / dl after the intervention . triglyceride of the exercise group was 157.36.9 mg / dl before the intervention and
135.99.2 mg / dl after the intervention . triglyceride of control group was 154.98.2 mg / dl before the
intervention 158.79.1 mg / dl after the intervention ( table 3table 3.changes in tg ( unit : mg / dl)variabletg ( mg / dl)prepostexercise157.36.9135.99.2*control154.98.2158.79.1values are meansd . * significantly different between pre- and post - test . ) . it is considered that a study to develop an appropriate program in which thorough diet
control and exercise have complementary roles needs to be conducted . there are many studies
which have established the relation between exercise and blood lipid levels1 , 9,10,11 .
in particular , obesity is known to show a higher risk of lipid metabolism disorder than
normal . cholesterol is one of the lipids , and is widely used as a index for verifying ,
treating and determining hyperlipidemia12 . this study which was conducted to measure , tc , and it showed a
significant improve in the exercise group , whereas the control group displayed a
non - significant . an aerobic program for women with obesity was conducted at the maximum
heart rate of 6080% , 5 times a week for 50 minutes , and tc and tg showed a significant
decreases13 . tc and tg are the most
common lipids , covering 9899% of all naturally occurring lipids in nature . they are mainly
stored in the liver and subcutaneous fat ; is produced in fat tissues and the liver . the tg
which is stored in fat tissues is rapidly metabolized when sugar runs short as energy
source . exercises were reported to facilitate fat utilization rate in exercise by increasing
mitochondria in the skeletal muscle , promoting oxidation ability , and inhibiting the use of
glycogen . it reduces body fat by decreasing tg and activating catabolic enzyme for
lipoprotein , thus enabling fat to be used as an energy source . in a study of exercise performed by female college students , both the group of diet therapy
and aerobic exercise and the group of diet therapy and circuit weight training showed a
significant decreases in tg2 . also , in an
obesity treatment program , middle - aged women with obesity showed a significant decrease in
tg , after performing for 4 days a week for 16 weeks to burn aerobic exercise and resistance
weight training at 400 kcal / session14 . in
the present study , this result
suggests that regular exercise should be performed along with an appropriately controlled
diet program in order to improve blood lipid levels15 , 16 . women in middle age
facing menopause are encouraged to not only perform exercises , but also run with weight
training to prevent sharp loss of muscle , increase of body fat mass caused by decrease of
metabolism at rest and osteoporosis resulting from decline in bone density , with a view to
health maintenance and obesity management . these days , weight training is becoming popular ,
and it is a highly proper training method for promoting the physical strength of men and
women of all ages , and children . | [ purpose ] the aim of this study was to examine the effects of exercise therapy on blood
lipids of obese women . [ subjects ] the subjects were 24 clinically obese women . [ methods ]
the subjects were divided into an exercise group ( n=12 ) , and a control group ( n=12 ) .
the
exercise group performed exercise for 10 weeks with diet restriction .
we investigated how
this type of exercise influenced blood lipids .
blood was taken before and after the
intervention .
the collected blood was centrifuged at 3,000 rpm for 10 minutes ; and plasma
was preserved at 73 c .
for hemanalysis , a medical laboratory was asked to analyze total
cholesterol and triglyceride .
the exercise was performed 5 times per week , and an exercise
was performed every two days , and exercise program was composed of warm up , main exercise
and cool down .
[ results ] there were significant differences between the two groups in
blood lipid levels after the intervention . the differences between the two groups in tc
and tg were significant .
[ conclusion ] tc and tg significantly inproved in the experimental
group showing that the exercise was effective at improveing blood lipid levels . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cells from the human retinal pigment epithelial line arpe-19 were obtained ( atcc , manassas , va , usa ) for the study . cells were grown in a 1:1 mixture ( vol / vol ) of dulbecco 's modified eagle 's medium with ham 's f-12 nutrient medium ( dmem f-12 ; gibco , carlsbad , ca , usa ) , nonessential amino acids 10 mm 1 , 0.37% sodium bicarbonate , 0.058% l - glutamine , 10% fetal bovine serum , and antibiotics ( penicillin g 100 u / ml , streptomycin sulfate 0.1 mg / ml , gentamicin 10 g / ml , amphotericin b ( fungizone ) 2.5 g / ml ) . r-28 cells , which are rat embryonic precursor neurosensory retinal cells , were derived from postnatal day 6 rat retina in the laboratory of one of the authors ( gms ) . r-28 cells express genes characteristic of neurons , as well as functional neuronal and glial properties . r-28 cells were cultured in dulbecco 's modified eagle 's medium , high glucose ( dmem high glucose ; invitrogen - gibco , grand island , ny , usa ) with 10% fetal bovine serum , 1 minimum essential medium ( mem ) , 10 mm 1 nonessential amino acids , 0.37% sodium bicarbonate , and 10 g / ml gentamicin . the cells were acquired as proliferating quaternary cultures established from cryopreserved normal human microvascular endothelial cells isolated from adult human dermis . hmvec were grown in medium 131 supplemented with microvascular growth supplement ( mvgs ) to support the plating and proliferation of cells . medium 131 not supplemented with mvgs was used as serum - free medium for hmvec . before use , the tissue culture surfaces were coated with attachment factor ( af ) , a sterile 1 solution containing 0.1% gelatin . the cells were plated onto 6-well and 24-well tissue culture plates ( becton dickinson lab ware , franklin lakes , nj , usa ) at 5 10 and 1.2 10 cells per well for cell viability and caspase-3/7 assay , respectively , and incubated at 37c in 5% carbon dioxide . after incubating the arpe-19 and r-28 cells for 24 h to reach confluence , the media in the wells were replaced with the respective serum - free media containing 0.1% bovine serum albumin ( bsa ) ( sigma - aldrich , st . these cells were then incubated for another 24 h in these serum - free media to render them quiescent ( non - proliferating ) . this step was omitted for hmvec as they did not tolerate additional incubation in serum - free media for 24 h ( even untreated controls had very low viability ) . also , a stable ( non - proliferating ) population of hmvec was achieved even without additional incubation . thus , for the hmvec cultures , the hq was added without the additional 24-h incubation in serum - free media . cells were treated with 500 m , 200 m , 100 m , 50 m concentrations of hq for 24 h. arpe-19 , r-28 , hmvec cultures were also treated with equivalent amount of dmso as control cultures . briefly , cells were harvested from the 35-mm dishes by treatment with 0.2% trypsin - edta and then incubated at 37c for 5 minutes . the cells were centrifuged at 1000 rpm for 5 minutes and then resuspended in 1 ml of culture medium . automated cell viability analysis was performed ( vi cell analyzer ; beckman coulter inc . , the analyzer performs an automated trypan blue dye - exclusion assay and gives the percentage viability of cells . caspase-3/7 activities were detected with the use of detection kits ( carboxyfluorescein flica apoptosis detection kits ; immunochemistry technologies llc , bloomington , mn , usa ) . the flica reagent has an optimal excitation range from 488 to 492 nm and an emission range from 515 to 535 nm . apoptosis was quantified as the level of fluorescence emitted from flica probes bound to caspases . at the designated time period , the wells were rinsed briefly with fresh culture media , replaced with 300 l / well of 1 flica solution in culture media , and incubated at 37c for 1 h under 5% co2 . the following controls were included : untreated arpe-19 , r-28 , hmvec without flica to exclude autofluorescence from cells ; untreated arpe-19 , r-28 , hmvec with flica for comparison of caspase activity of treated cells ; tissue culture plate wells without cells with buffer alone to represent the background levels ; tissue culture plate wells without cells with culture media + dmso to exclude cross - reaction of flica with dmso + culture media ; arpe-19 , r-28 , hmvec with dmso and flica to account for any cross - fluorescence between untreated cells and dmso . quantitative calculations of caspase activities were performed with a fluorescence image scanning unit instrument ( fmbio iii ; hitachi , yokohama , japan ) . the caspase activity was measured as average signal intensity of the fluorescence of the pixels in a designated spot the qiaamp dna mini kit ( qiagen sample and assay technologies , valencia , ca , usa ) was used to extract the dna from the hq - treated cell cultures . , wilmington , de , usa ) was used to determine the dna content of each sample . for the assessment of dna fragmentation , 2.5 g of dna was added to each lane of a 3% agarose gel and electrophoresed for 5 h at 80 v. the gel was stained with 5% ethidium bromide and visualized and photographed with fluorescence image scanning instrument ( fmbio iii ; hitachi ) . , mountain view , ca , usa ) was used to measure the lactate dehydrogenase ( ldh ) enzyme released from the cells as an index of necrosis or nonapoptotic cell death . ldh cytotoxicity assay kit ii utilizes the water soluble tetrazolium salt ( wst ) reagent for detection of ldh released from the damaged cells . the assay uses an enzyme coupling reaction ; ldh oxidizes lactate to generate nadh which then reacts with wst to generate a yellow color . each concentration was performed in triplicate and data were plotted according to manufacturer 's protocol . data were subjected to statistical analysis by analysis of variance ( anova ) ( prism , ver . error bars in the graphs represent standard error of mean ( sem ) with experiments performed in triplicate . cells from the human retinal pigment epithelial line arpe-19 were obtained ( atcc , manassas , va , usa ) for the study . cells were grown in a 1:1 mixture ( vol / vol ) of dulbecco 's modified eagle 's medium with ham 's f-12 nutrient medium ( dmem f-12 ; gibco , carlsbad , ca , usa ) , nonessential amino acids 10 mm 1 , 0.37% sodium bicarbonate , 0.058% l - glutamine , 10% fetal bovine serum , and antibiotics ( penicillin g 100 u / ml , streptomycin sulfate 0.1 mg / ml , gentamicin 10 g / ml , amphotericin b ( fungizone ) 2.5 g / ml ) . r-28 cells , which are rat embryonic precursor neurosensory retinal cells , were derived from postnatal day 6 rat retina in the laboratory of one of the authors ( gms ) . r-28 cells express genes characteristic of neurons , as well as functional neuronal and glial properties . r-28 cells were cultured in dulbecco 's modified eagle 's medium , high glucose ( dmem high glucose ; invitrogen - gibco , grand island , ny , usa ) with 10% fetal bovine serum , 1 minimum essential medium ( mem ) , 10 mm 1 nonessential amino acids , 0.37% sodium bicarbonate , and 10 g / ml gentamicin . the cells were acquired as proliferating quaternary cultures established from cryopreserved normal human microvascular endothelial cells isolated from adult human dermis . hmvec were grown in medium 131 supplemented with microvascular growth supplement ( mvgs ) to support the plating and proliferation of cells . medium 131 not supplemented with mvgs was used as serum - free medium for hmvec . before use , the tissue culture surfaces were coated with attachment factor ( af ) , a sterile 1 solution containing 0.1% gelatin . the cells were plated onto 6-well and 24-well tissue culture plates ( becton dickinson lab ware , franklin lakes , nj , usa ) at 5 10 and 1.2 10 cells per well for cell viability and caspase-3/7 assay , respectively , and incubated at 37c in 5% carbon dioxide . after incubating the arpe-19 and r-28 cells for 24 h to reach confluence , the media in the wells were replaced with the respective serum - free media containing 0.1% bovine serum albumin ( bsa ) ( sigma - aldrich , st . these cells were then incubated for another 24 h in these serum - free media to render them quiescent ( non - proliferating ) . this step was omitted for hmvec as they did not tolerate additional incubation in serum - free media for 24 h ( even untreated controls had very low viability ) . also , a stable ( non - proliferating ) population of hmvec was achieved even without additional incubation . thus , for the hmvec cultures , the hq was added without the additional 24-h incubation in serum - free media . cells were treated with 500 m , 200 m , 100 m , 50 m concentrations of hq for 24 h. arpe-19 , r-28 , hmvec cultures were also treated with equivalent amount of dmso as control cultures . briefly , cells were harvested from the 35-mm dishes by treatment with 0.2% trypsin - edta and then incubated at 37c for 5 minutes . the cells were centrifuged at 1000 rpm for 5 minutes and then resuspended in 1 ml of culture medium . automated cell viability analysis was performed ( vi cell analyzer ; beckman coulter inc . , the analyzer performs an automated trypan blue dye - exclusion assay and gives the percentage viability of cells . caspase-3/7 activities were detected with the use of detection kits ( carboxyfluorescein flica apoptosis detection kits ; immunochemistry technologies llc , bloomington , mn , usa ) . the flica reagent has an optimal excitation range from 488 to 492 nm and an emission range from 515 to 535 nm . apoptosis was quantified as the level of fluorescence emitted from flica probes bound to caspases . at the designated time period , the wells were rinsed briefly with fresh culture media , replaced with 300 l / well of 1 flica solution in culture media , and incubated at 37c for 1 h under 5% co2 . the following controls were included : untreated arpe-19 , r-28 , hmvec without flica to exclude autofluorescence from cells ; untreated arpe-19 , r-28 , hmvec with flica for comparison of caspase activity of treated cells ; tissue culture plate wells without cells with buffer alone to represent the background levels ; tissue culture plate wells without cells with culture media + dmso to exclude cross - reaction of flica with dmso + culture media ; arpe-19 , r-28 , hmvec with dmso and flica to account for any cross - fluorescence between untreated cells and dmso . quantitative calculations of caspase activities were performed with a fluorescence image scanning unit instrument ( fmbio iii ; hitachi , yokohama , japan ) . the caspase activity was measured as average signal intensity of the fluorescence of the pixels in a designated spot the qiaamp dna mini kit ( qiagen sample and assay technologies , valencia , ca , usa ) was used to extract the dna from the hq - treated cell cultures . , wilmington , de , usa ) was used to determine the dna content of each sample . for the assessment of dna fragmentation , 2.5 g of dna was added to each lane of a 3% agarose gel and electrophoresed for 5 h at 80 v. the gel was stained with 5% ethidium bromide and visualized and photographed with fluorescence image scanning instrument ( fmbio iii ; hitachi ) . , mountain view , ca , usa ) was used to measure the lactate dehydrogenase ( ldh ) enzyme released from the cells as an index of necrosis or nonapoptotic cell death . ldh cytotoxicity assay kit ii utilizes the water soluble tetrazolium salt ( wst ) reagent for detection of ldh released from the damaged cells . the assay uses an enzyme coupling reaction ; ldh oxidizes lactate to generate nadh which then reacts with wst to generate a yellow color . each concentration was performed in triplicate and data were plotted according to manufacturer 's protocol . data were subjected to statistical analysis by analysis of variance ( anova ) ( prism , ver . 3.0 ; graphpad software inc . , san diego , ca , usa ) . error bars in the graphs represent standard error of mean ( sem ) with experiments performed in triplicate . arpe-19 cells showed a significant decrease in cell viability after exposure to hq for 24 h. untreated and dmso - treated equivalent cultures of 500 m showed cell viabilities of 96.10 1.84% and 96.25 0.78% , respectively . cell viabilities were 26.60 1.56% ( p < 0.001 ) , 33.50 3.53% ( p < 0.001 ) and 52.95 2.05% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . cell viability of cultured cells ( arpe-19 , r-28 , hmvec ) following hq treatment for 24 h. representative control and hq - treated samples are presented for each cell line . dmso : dimethyl sulfoxide . * * * statistically significant ( p < 0.001 ) ; * * statistically significant ( p < 0.01 ) r-28 cells showed a significant decrease in cell viability after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed cell viabilities of 81.050 6.43% and 78.56 2.90% , respectively . cell viabilities were 14.15 1.20% ( p < 0.001 ) , 26.20 1.13% ( p < 0.001 ) , and 35.70 3.25% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , cell viability was 67.25 2.89% ( p < 0.01 ) . hmvec cultures showed a significant decrease in cell viability after exposure to hq for 24 h. untreated cell culture showed cell viability of 84.00 3.59% . dmso - treated equivalent culture of 500 m and 200 m showed cell viabilities of 55.37 3.76% and 87.50 2.19% , respectively . cell viabilities were 11.73 2.27% ( p < 0.001 ) , 25.93 2.17% ( p < 0.001 ) , and 37.52 1.93% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , cell viability was 84.20 6.78% ( p > 0.05 ) . arpe-19 cells treated with 500 m , 200 m , 100 m , and 50 m of hq showed msi of 6132.27 1011.5 ( p > 0.05 ) , 5733.83 1014.3 ( p > 0.05 ) , 6721.74 901.6 ( p > 0.05 ) , and 6015.19 208.6 ( p > 0.05 ) , respectively . values for untreated cells and dmso - equivalent cultures 500 m of hq were 5861.70 220.7 and 4820.83 83.3 , respectively . r-28 cells treated with 500 m , 200 m , 100 m , and 50 m of hq showed msi of 6514.40 692.1 ( p > 0.05 ) , 7074.35 1357.8 ( p > 0.05 ) , 6777.15 1253.2 ( p > 0.05 ) , and 5280.05 1008.4 ( p > 0.05 ) , respectively . values for untreated cells and dmso - equivalent cultures 500 m of hq were 3580.00 595.3 and 5783.90 1073.5 , respectively . hmvec cultures cells treated with 500 m , 200 m , 100 m , and 50 m of hq showed msi of 4762.00 1153.7 ( p > 0.05 ) , 4831.33 1001.4 ( p > 0.05 ) , 3813.40 1339.8 ( p > 0.05 ) , and 4887.91 1098.3 ( p > 0.05 ) , respectively . values for untreated cells and dmso - equivalent cultures 500 m of hq were 5262.45 793.0 and 4376.02 709.4 , respectively . all three cell lines ( arpe-19 , r-28 , hmvec ) did not show increase in caspase-3/7 activity following 24-h exposure of hq . mean signal intensity ( msi ) is presented for representative control and hq - treated samples none of the cell lines showed any 200 bp dna fragmentation pattern on 3% agarose gels . a , arpe-19 cells ; b , r-28 cells ; c , hmvec cultures arpe-19 cells showed an increase in ldh levels after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed ldh levels of 18.36 1.37% and 18.83 1.74% , respectively . ( p < 0.001 ) , and 41.13 2.05% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , the ldh value was 19.76 4.35% ( p > 0.05 ) . ldh release from the cultured cells ( arpe-19 , r-28 , hmvec ) following hq treatment for 24 h. representative control and hq - treated samples are presented for each cell line . dmso : dimethyl sulfoxide . * * * statistically significant ( p < 0.001 ) ; * * statistically significant ( p < 0.01 ) r-28 cells showed an increase in ldh value after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed ldh levels of 20.36 2.12% and 18.46 3.73% , respectively . ldh values were 53.23 6.10% ( p < 0.001 ) , 46.63 8.76% ( p < 0.001 ) , 44.09 5.29% ( p < 0.001 ) , and 41.96 2.82% ( p > 0.001 ) at doses of 500 m , 200 m , 100 m , and 50 m hq , respectively . hmvec cultures showed an increase in ldh value after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed cell viabilities of 20.37 2.12% and 18.47 3.73% , respectively . < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , the ldh value was 17.63 4.23% ( p > 0.05 ) arpe-19 cells showed a significant decrease in cell viability after exposure to hq for 24 h. untreated and dmso - treated equivalent cultures of 500 m showed cell viabilities of 96.10 1.84% and 96.25 0.78% , respectively . cell viabilities were 26.60 1.56% ( p < 0.001 ) , 33.50 3.53% ( p < 0.001 ) and 52.95 2.05% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . cell viability of cultured cells ( arpe-19 , r-28 , hmvec ) following hq treatment for 24 h. representative control and hq - treated samples are presented for each cell line . dmso : dimethyl sulfoxide . * * * statistically significant ( p < 0.001 ) ; * * statistically significant ( p < 0.01 ) r-28 cells showed a significant decrease in cell viability after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed cell viabilities of 81.050 6.43% and 78.56 2.90% , respectively . cell viabilities were 14.15 1.20% ( p < 0.001 ) , 26.20 1.13% ( p < 0.001 ) , and 35.70 3.25% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , cell viability was 67.25 2.89% ( p < 0.01 ) . hmvec cultures showed a significant decrease in cell viability after exposure to hq for 24 h. untreated cell culture showed cell viability of 84.00 3.59% . dmso - treated equivalent culture of 500 m and 200 m showed cell viabilities of 55.37 3.76% and 87.50 2.19% , respectively . cell viabilities were 11.73 2.27% ( p < 0.001 ) , 25.93 2.17% ( p < 0.001 ) , and 37.52 1.93% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , cell viability was 84.20 6.78% ( p > 0.05 ) . arpe-19 cells treated with 500 m , 200 m , 100 m , and 50 m of hq showed msi of 6132.27 1011.5 ( p > 0.05 ) , 5733.83 1014.3 ( p > 0.05 ) , 6721.74 901.6 ( p > 0.05 ) , and 6015.19 208.6 ( p > 0.05 ) , respectively . values for untreated cells and dmso - equivalent cultures 500 m of hq were 5861.70 220.7 and 4820.83 83.3 , respectively . r-28 cells treated with 500 m , 200 m , 100 m , and 50 m of hq showed msi of 6514.40 692.1 ( p > 0.05 ) , 7074.35 1357.8 ( p > 0.05 ) , 6777.15 1253.2 ( p > 0.05 ) , and 5280.05 1008.4 ( p > 0.05 ) , respectively . values for untreated cells and dmso - equivalent cultures 500 m of hq were 3580.00 595.3 and 5783.90 1073.5 , respectively . hmvec cultures cells treated with 500 m , 200 m , 100 m , and 50 m of hq showed msi of 4762.00 1153.7 ( p > 0.05 ) , 4831.33 1001.4 ( p > 0.05 ) , 3813.40 1339.8 ( p > 0.05 ) , and 4887.91 1098.3 ( p > 0.05 ) , respectively . values for untreated cells and dmso - equivalent cultures 500 m of hq were 5262.45 793.0 and 4376.02 709.4 , respectively . all three cell lines ( arpe-19 , r-28 , hmvec ) did not show increase in caspase-3/7 activity following 24-h exposure of hq . mean signal intensity ( msi ) is presented for representative control and hq - treated samples none of the cell lines showed any 200 bp dna fragmentation pattern on 3% agarose gels . arpe-19 cells showed an increase in ldh levels after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed ldh levels of 18.36 1.37% and 18.83 1.74% , respectively . ( p < 0.001 ) , and 41.13 2.05% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , the ldh value was 19.76 4.35% ( p > 0.05 ) . ldh release from the cultured cells ( arpe-19 , r-28 , hmvec ) following hq treatment for 24 h. representative control and hq - treated samples are presented for each cell line . dmso : dimethyl sulfoxide . * * * statistically significant ( p < 0.001 ) ; * * statistically significant ( p < 0.01 ) r-28 cells showed an increase in ldh value after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed ldh levels of 20.36 2.12% and 18.46 3.73% , respectively . < 0.001 ) , 44.09 5.29% ( p < 0.001 ) , and 41.96 2.82% ( p > 0.001 ) at doses of 500 m , 200 m , 100 m , and 50 m hq , respectively . hmvec cultures showed an increase in ldh value after exposure to hq for 24 h. untreated and dmso - treated equivalent culture of 500 m showed cell viabilities of 20.37 2.12% and 18.47 3.73% , respectively . ( p < 0.001 ) , and 37.16 1.90% ( p < 0.001 ) at doses of 500 m , 200 m , and 100 m hq , respectively . at the lower concentrations of 50 m hq , the ldh value was 17.63 4.23% ( p > 0.05 ) the present study demonstrated that after 24-h treatment with hq , the arpe-19 cells showed no loss of cell viability at 50 m hq but exhibited significant cell loss at doses greater than 100 m . this agrees with the report of chen et al . who found necrotic cell death of bone marrow mononuclear cells at concentrations above 50 m . our findings differ from those of strunnikova et al . who found no loss of rpe cell viability at 100 m hq after 16 h of incubation . however , our results are similar to those of marin - castao et al . who found rpe cell damage at 250400 m hq . a recent study showed the formation of sub - rpe deposits and diffuse thickening of bruch 's membrane in mice after exposing them to cigarette smoke or hq . this is significant because histochemical studies reported the presence of extracellular protein and/or lipid deposits ( drusen ) between the basal lamina of the rpe cells and the inner layer of the bruch 's membrane carries an increased risk of progressing to an advanced form of amd , either geographic atrophy ( dry amd ) or choroidal neovascularization ( wet amd ) . it is becoming apparent that different cigarette smoke components may have different mechanisms of action on the human rpe cells . in a recent study , we have found elevation of caspase-3/7 , caspase-8 , caspase-9 , caspase-12 activities in arpe-19 cells in vitro with benzo(e)pyrene ( b(e)p ) , a polycyclic aromatic hydrocarbon ( pah ) present in cigarette smoke , while hq did not elevate caspase-3/7 activity in this study . r-28 cells had significant loss of cell viability at 50 m hq in addition to the higher doses ( 100 m , 200 m , 500 m ) , indicating that the r-28 cells were more sensitive to hq than the arpe-19 cells . this increased sensitivity to chemicals by r-28 cells has also been reported in cultures treated with 7-ketocholesterol and trypan blue . our findings are consistent with those of haenen et al . who found loss of cell viability and ldh release in renal proximal tubular cells after 250 m and 500 m hq treatment . our findings differ from those of terasaka el al . who reported caspase-3 and caspase-9 activation at 50 m hq in hl60 cells after 6 h of incubation . photoreceptor inner segments have a high content of mitochondria and unsaturated fatty acids , which makes these cells potential targets of oxidative injury ( i.e. blue light , hq ) via apoptotic or non - apoptotic pathways . hmvec cultures showed significant loss of cell viability at hq doses 100 m , 200 m , and 500 m , but not at the lower dose of 50 m hq . found loss of cell viability in a dose - dependent manner starting from 2 m hq in human cd34-positive blood progenitor cells . these findings differ from those of dong - xiao shen et al . who found apoptotic cell death at 100 m hq in human embryonic kidney cells ( hek293 ) . although rpe is the primary target of hq , it can affect other cells in the outer retina , such as photoreceptor cells and choriocapillaries endothelium . sub - rpe deposit formation could be the result of an initial insult to the endothelium , which could contribute to the formation of sub - rpe deposits . the hq concentrations used can not be extrapolated directly to clinical practice , as this study was performed in vitro . however , there are 40% higher levels of hq in smoker 's blood compared to that of non - smoker . therefore , it is not unreasonable to expect that the retina and rpe cells are exposed to higher hq levels in heavy smokers . another drawback of our study is that the cell cultures were still capable of some proliferation , which is different from the normal clinical condition and may limit the interpretation of the results . however , we believe the data presented are significant in light of the present clinical treatment approaches of amd . to the best of our knowledge , this is the first study showing non - apoptotic damage in all three cell types representative of the retina after exposure to the cigarette smoke toxicant , hq . understanding the amd pathogenesis could be helpful for drug development targeting the specific pathways involved . as different groups of compounds have different mechanisms of cell death , to protect the cells from these noxious effects , we need to develop a treatment that can antagonize a variety of pathways . furthermore , it demonstrates that the arpe-19 , r-28 , and hmvec culture systems can be used to generate information of the biochemical mechanisms of chemical toxicants and protective agents . | aim : to explore the molecular pathophysiology that might explain the epidemiologic association between cigarette smoke and age - related macular degeneration ( amd ) by examining the effects of hydroquinone ( hq ) , a toxic compound present in high concentration in cigarette smoke - related tar , on human retinal pigment epithelial cells ( arpe-19 ) , rat retinal neurosensory cells ( r-28 ) , and human microvascular endothelial cells ( hmvec).materials and methods : arpe-19 , r-28 , and hmvec were treated for 24 h with four different concentrations of hq ( 500 m , 200 m , 100 m , 50 m ) .
cell viability , caspase-3/7 activation , dna laddering patterns , and lactate dehydrogenase ( ldh ) levels were analyzed.results:at 50 m hq , r-28 cells showed a significant decrease in cell viability compared with the dimethyl sulfoxide ( dmso)-treated controls . at the 100500 m concentrations , all three cell lines showed significant cell death ( p < 0.001 ) . in the arpe-19 , r-28 , and hmvec cultures ,
the caspase-3/7 activities were not increased at any of the hq concentration.conclusion:our findings suggest that the mechanism of cell death in all three cell lines was through non - apoptotic pathway .
in addition , neuroretinal r-28 cells were more sensitive to hq than the arpe-19 and hmvec cultures . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
affinity purification
of proteins coupled to mass spectrometry
( ap - ms ) has markedly improved our knowledge of protein interactions
and functions , and has become the hallmark for diverse biological
discoveries . in addition , ap - ms has allowed
the characterization of several molecular networks in a variety of
organisms , including mammals . although this approach has proven
very robust and highly reproducible for certain classes of proteins , the same can not be assumed for nuclear proteins . this is particularly the case for transcription factors ( tfs ) that
strongly associate with chromatin . limiting factors for efficient
ap - ms studies are the general low abundance of these proteins and
the technical difficulties associated with the purification of tfs
from mammalian cells . as the elucidation
of the function of tfs is highly relevant to human diseases , a more
detailed understanding of the biological role of tfs tfs have often been found to operate in large , dynamic multiprotein
complexes involved in several different cellular processes . tfs have also been shown to associate with different
interactors that can modulate transcriptional output . in addition , mutations affecting the protein interaction
profile of specific tfs result in aberrant phenotypes as previously
reported for the protein c / ebpalpha . in the hematopoietic system , the tf c / ebpalpha is a master regulator
of the myeloid compartment , and the role of this protein is specifically
required for functional neutrophilic differentiation . deletion of the c / ebpalpha gene results
in the complete absence of mature granulocytes . in addition , mutations in the c / ebpalpha protein have been
identified in patients with acute myeloid leukemia ( aml ) . it has been
proposed that the functions of c / ebpalpha are dependent on the formation
of different protein complexes to promote cell cycle arrest and terminal
differentiation . a global and comprehensive characterization of the
tf c / ebpalpha - containing protein complexes is therefore critical in
understanding the role of this protein . c / ebpalpha was chosen as an
example to demonstrate our new ap - ms methodology in the identification
of protein complexes associated with a selected transcription factor . the cdna for rat c / ebpalpha was stably expressed
in the myeloid progenitor cell line fdcp-1 from a modified bicistronic
pmscv - ires - gfp retroviral vector ( clontech , mountain view , ca , usa )
with a carboxyl - terminal streptavidin ( strep)hemagglutinin
( ha ) tag . transduced cells were isolated by facs - sorting for the gfp - positive
population . cells were cultivated in rpmi ( paa laboratories , clbe ,
germany ) supplemented with 10% fcs ( invitrogen , carlsbad , ca , usa ) ,
penicillin ( 100 u / ml ) ( paa laboratories ) , and streptomycin ( 100 g / ml )
( paa laboratories ) and 5 ng / ml murine il-3 ( peprotech , rocky hill ,
nj , usa ) . all steps
described in the protocol were at 4 c . purifications were performed
from 1 10 freshly harvested cells . after being
washed with pbs , cells were incubated in buffer n ( 300 mm sucrose ,
10 mm hepes ph 7.9 , 10 mm kcl , 0.1 mm edta , 0.1 mm egta , 0.1 mm dtt ,
0.75 mm spermidine , 0.15 mm spermine , 0.1% nonidet p-40 , 50 mm naf ,
1 mm na3vo4 , protease inhibitors ) for 5 min
on ice to lyse the cytoplasm . nuclei were collected by centrifugation
( 500 g for 5 min ) , and the supernatant ( containing
the cytoplasmic fraction ) was removed . the nuclear pellet was washed
( 1 ) with buffer n. for the extraction of nuclear proteins , the
nuclei were resuspended in buffer c420 ( 20 mm hepes ph 7.9 , 420 mm
nacl , 25% glycerol , 1 mm edta , 1 mm egta , 0.1 mm dtt , 50 mm naf , 1
mm na3vo4 , protease inhibitors ) , vortexed briefly ,
and shaken vigorously for 30 min . after centrifugation for 1 h at
100000 g , the supernatant contained the soluble nuclear
proteins , while nuclear membranes and insoluble chromatin remained
in the pellet . the protein concentration of the soluble nuclear
fraction was measured by bradford assay ( using -globin as the
standard ) . fifteen milligrams of nuclear extract was subjected to
either one - step or two - step affinity purifications . prior to purification ,
all nuclear extracts were adjusted to 2 mg / ml and 150 mm nacl with
hepes buffer ( 20 mm hepes , 50 mm naf , 1 mm na3vo4 , protease inhibitors ) . samples were incubated for 20 min at 4 c
on a rotating wheel with rnase a , benzonase , and avidin to remove
rna and nucleic acids ( dna ) and to saturate endogenously biotinylated
proteins , respectively . an aliquot of the sample was retained for
immunoblot ( ib ) analysis ( supporting information ,
supplementary figure 1b , lysate ) . precleared extracts were incubated with 200 l of
streptactin sepharose beads ( iba , gttingen , germany ) and incubated
for 2 h at 4 c on a rotating wheel . the sample was transferred
to a biospin column ( biorad , hercules , ca , usa ) , and the flow - through
was removed by gravity flow ( an aliquot of the flow - through was retained
for ib analysis , supplementary figure 1b , strep - ft ) . beads were washed 3 with tnn - hs buffer ( 50 mm
hepes ph 8.0 , 150 mm nacl , 5 mm edta , 0.5% np-40 , 50 mm naf , 1 mm
na3vo4 , protease inhibitors ) . proteins bound
to the beads were eluted with 3 300 l 2.5 mm biotin
in tnn - hs buffer ( an aliquot of the biotin eluate was retained for
ib analysis , supplementary figure 1b , strep - eluate ) . the biotin eluate was subsequently incubated with anti - ha - agarose
beads ( sigma , st.louis , mo , usa ) for 2 h at 4 c on a rotating
wheel . samples were centrifuged for 3 min at 300 g ( an aliquot of the flow - through was retained for ib analysis , supplementary figure 1b , ha - ft ) , and the beads
were washed 3 with tnn - hs buffer . another two washing steps
with tnn - hs buffer without detergent and inhibitors were performed
to remove traces of detergent that are detrimental to lc for one - dimensional gel - based liquid chromatography mass
spectrometry ( 1d - gel - lc ms ) analysis , bound proteins were eluted
in 100 l of 4 laemmli buffer , boiled for 5 min and centrifuged
for 3 min at 300 g . the supernatant was transferred
to a new eppendorf tube ( 100 l ) and 1/10 was retained for ib
analysis ( supplementary figure 1b , ha - eluate ) .
for one - dimensional gel - free liquid chromatography mass spectrometry
( 1d - lc ms ) , bound material was eluted with 500 l of
100 mm formic acid and immediately neutralized with 125 l of
1 m triethylammonium bicarbonate ( teab ) . from the final eluate , 200
l was retained for ib analysis ( supplementary
figure 1c , ha - eluate ) . for one - step
strep purifications , precleared nuclear extracts were incubated with
200 l of strepttactin sepharose beads and at 4 c incubated
for 2 h on a rotating wheel . samples were centrifuged for 3 min at
300 g , the flow - through was transferred to a new eppendorf
tube ( for ib analysis , supporting information ,
supplementary figure 2a , strep - ft ) , and the beads were washed
3 with tnn - hs buffer , and 2 using tnn - hs buffer without
detergent and inhibitors ( all washes in batch ) . for 1d - gel - lc ms
analysis , bound proteins were incubated with 100 l of 2.5 mm
biotin in tnn - hs buffer 10 min at 4 c , followed by centrifugation
for 3 min at 300 g . the supernatant was transferred
to a new eppendorf tube and 1/10 was retained for ib analysis ( supplementary figure 2a , strep - eluate ) . samples
were then alkylated with iodoacetamide and separated by 1d sds - page
on a 412% bis - tris gel ( nupage , invitrogen ) . proteins were
visualized by silver staining , and the entire gel lane was excised
and the 20 slices digested in situ with modified porcine trypsin ( promega
corp . , madison , wi , usa ) as previously described . ms
was performed using 312.5 l of biotin in tnn - hs buffer for
10 min at 4 c , followed by centrifugation for 3 min at 300 g . from the eluted material , 100 l was retained for
ib analysis ( supplementary figure 2b , strep - eluate ) . the remainder of the samples was digested with trypsin , and 2
5% of the resultant peptides were analyzed as technical duplicates
by lc ms
was separated by off - line reversed - phase liquid chromatography , and
the resultant 10 fractions were analyzed by two - dimensional gel - free
lc ms ( 2d - lc ms ) . for the one - step
ha purification , precleared nuclear extracts were incubated with 200
l of anti - ha sepharose beads for 2 h at 4 c on a rotating
wheel . samples were centrifuged for 3 min at 300 g , the flow - through was transferred to a new eppendorf tube ( for ib
analysis , sup . 2a , ha - ft ) , and beads were washed 3 with tnn - hs
and 2 with tnn - hs buffer without detergent and inhibitors . for
the 1d - gel - lc ms approach , bound proteins were eluted in 100
l of 4 laemmli buffer , boiled for 5 min , and centrifuged
for 3 min at 300 g . the supernatant was then transferred
to a new eppendorf tube ( 100 l ) and 1/10 was retained for ib
analysis ( sup . 2a , ha - eluate ) . the eluted proteins were separated
by 1d - sds - page , and entire lanes were excised in 20 slices , digested
in situ with trypsin , and treated as reported before ( 1d - gel - ms ) .
for the 1d - lc ms , proteins were eluted with 500 l of
100 mm formic acid and immediately neutralized with 125 l of
1 m teab . as described above , 200 l of the final eluate was
retained for ib analysis ( sup . tryptic digests were
concentrated and purified by solid
phase extraction ( spe ) ( ultramicrospin columns 330 g
capacity , nest group inc . , southboro , ma , usa ) prior to injection
onto a phenomenex column ( 150 2.0 mm gemini - nx 3 mc18
110 , phenomenex , torrance , ca , usa ) on an agilent 1200 series
hplc ( agilent biotechnologies , palo alto , ca ) with uv detection at
214 nm . hplc solvent a consisted of 20 mm nh4oh ph 10.5
in 5% acetonitrile and solvent b consisted of 20 mm nh4oh ph 10.5 in 90% acetonitrile . the sample volume was reduced to approximately 2 l
in a vacuum centrifuge and reconstituted to 10 l with 5% formic
acid . all
affinity purifications were analyzed on a hybrid linear trap quadrupole
( ltq ) orbitrap velos mass spectrometer ( thermofisher scientific , waltham ,
massachusetts , usa ) coupled to a 1200 series high - performance liquid
chromatography system ( agilent technologies , palo alto , ca , usa ) via
a nanoelectrospray ion source using liquid junction ( proxeon , odense ,
denmark ) . solvents for hplc separation of peptides were as follows :
solvent a consisted of 0.4% formic acid in water , and solvent b consisted
of 0.4% formic acid in 70% methanol and 20% isopropanol . from a thermostatted
microautosampler , 8 l of the tryptic peptide mixture was automatically
loaded onto a trap column ( zorbax 300sb - c18 5 m , 5 0.3
mm , agilent biotechnologies , palo alto , ca , usa ) with a binary pump
at a flow rate of 45 l / min . after washing , the peptides
were eluted by back - flushing onto a 16-cm fused silica analytical
column with an inner diameter of 50 m packed with c18 reversed
phase material ( reprosil - pur 120 c18-aq , 3 m , dr . the peptides were eluted from the analytical
column with a 27 min gradient ranging from 3 to 30% solvent b , followed
by a 25 min gradient from 30 to 70% solvent b and , finally , a 7 min
gradient from 70 to 100% solvent b at a constant flow rate of 100
nl / min . the analyses were performed in
a data - dependent acquisition mode and dynamic exclusion for selected
ions was 60 s. a top 15 collision - induced dissociation ( cid ) method
were used , and a single lock mass at m / z 445.120024 ( si(ch3)2o)6 ) was employed . maximal ion accumulation time
allowed in cid mode was 50 ms for ms in the ltq and 500
ms in the c - trap . automatic gain control was used to prevent overfilling
of the ion traps and was set to 5000 in ms mode for the
ltq and 10 ions for a full ftms scan . intact peptides
were detected in the orbitrap velos at 60 000 resolution at m / z 400 . peak list information was extracted
from the raw ms files and converted into an mgf format with the msconvert
tool ( proteowizard library v2.1.2708 ) . the mgf files were searched
against the mouse component of the uniprotkb / swissprot database ( www.uniprot.org ; releases 2010 - 09 , 2011 - 12 , and 2012 - 05 ) , including
all protein isoforms plus the rat c / ebpalpha and known contaminant
sequences ( e.g. , human keratin ) . an initial search was performed with
the protein search engine mascot ( www.matrixscience.com , version 2.3.02 ) . mass error tolerances on the precursor and fragment
ions were 10 ppm and 0.6 da , respectively . only fully
tryptic peptides were considered with a maximum of one missed cleavage
site , and carbamidomethyl cysteine and methionine oxidation set as
fixed and variable modifications , respectively . the mascot peptide
ion score threshold was equal to 30 , and at least three peptide identifications
per protein were required . for both the precursor and fragment
ion data , linear recalibration transformations that minimize the mean
square deviation of the measured from theoretical values were deduced
from the initial identifications . recalibrated mgf files were searched
against the same protein database with mascot and phenyx ( genebio ,
sa , version 2.5.14 ) using narrower mass
tolerances ( 4 ppm and 0.3 da ) . mascot and phenyx
output files were processed by internally developed parsers to filter
and integrate protein identifications . for mascot and phenyx identifications , the following peptide score thresholds were used : t1 = 14 , t2 = 40 , and t3 = 10 ; and t1 =
4.2 , t2 = 4.75 , and t3 = 3.5 , respectively ( p - value < 10 ) . proteins with at least two unique peptides above
score t1 or with a single peptide above t2 were selected as unambiguous identifications . the validated
identifications from both algorithms were merged , spectral conflicts
were discarded , and protein groups were defined according to shared
peptides . a false discovery rate ( fdr ) of < 1% for protein identifications
and ( including peptides exported with lower
scores ) was estimated by applying the same filtering procedure against
a database of reversed protein sequences . for each purification strategy ,
proteins identified in the control cells were subtracted from the
proteins identified from the corresponding c / ebpalpha affinity purifications . moreover , contaminants such as keratin , spectrin , plectin , and anti - ha
antibody chains were removed from the list as known nonspecific binders
frequently observed in ap - ms . to determine
the protein interactome of c / ebpalpha , an affinity - tagged
variant of the tf was expressed in the myeloid progenitor cell line
fdcp-1 . a well - established , double - affinity purification tag ( strep ha )
was used throughout . a double - affinity tag enables the enrichment
of a specific protein and associated interactors in two sequential
purification steps . in parallel , nonspecifically binding proteins
are removed from the sample . the first
purification step takes advantage of the strong affinity that the
strep - peptide has for a variant of streptavidin ( streptactin ) . the second
purification consists of an immunopurification step using an anti - ha - antibody . bound proteins are eluted with formic acid or sodium dodecyl sulfate
( sds ) buffer for analysis by 1d - lc ms or 1d - gel - lc because of the predominantly nuclear localization
of c / ebpalpha ,
the standard whole cell extract lysis buffers were not recommended . starting from whole cell extracts , strep - ha purifications of c / ebpalpha
were poorly enriched , and only the selected transcription factor and
a few interactors were identified by ms ( data not shown ) . after several
protocols for extracting nuclear proteins ( data not shown ) were assessed ,
a high - salt extraction approach using 420 mm nacl was chosen . as nuclear extracts are rich in nucleic acids ,
abundant dna- and rna - binding proteins can be preferentially copurified
and identified by lcms . this occurs at the expense of the identification
of the low - abundance proteins that typically constitute transcription
factor complexes . thus , the nuclear extracts were treated with rnase
a and benzonase to remove nucleic acids that are not protected by
bound transcription factors . in parallel , the samples were also treated
with free avidin to remove the majority of the naturally biotinylated
proteins ( e.g. , carboxylases ) prior to affinity purification using
streptactin . as avidin does not display any affinity for strep , this
preclearing step increases the specificity of the purification . standardized two - step strep - ha purifications from 15 mg of pretreated nuclear extracts were conducted
on c / ebpalpha - overexpressing fdcp-1 cells and control mock - infected
cells that do not express any strep - ha - tagged protein . eluates were
analyzed by 1d - gel - lc ms and 1d - lc ms , and the identified
proteins were filtered by subtracting all proteins detected in the
purifications from the control cell line . despite high quantities
of purified c / ebpalpha , only a few protein interactors were observed
( supporting information , supplementary figure
1 ) . mainly ribosomal proteins , chaperones , and the exception was ddit3 , a known c / ebpalpha interactor ( supplementary figure 1a ) . although the results showed that the two - step ap - ms approach correctly
purified c / ebpalpha , the method appeared to be too harsh to retain
and subsequently identify the different c / ebpalpha interactors . this
is most likely due to the transient and/or unstable nature of transcription
factor complexes . following treatment
of the strep - eluate with four different cross - linking reagents , the
presence of several high molecular weight protein complexes associated
with the purified c / ebpalpha was confirmed by anti - ha immunoblot ( supplementary figure 2a , b ) . on the basis of the
immunoblot of the one - step procedure combined with the two - step data
from ap - ms , we surmised that the second purification step of the strep - ha
purification is indeed limiting for the detection of transient c / ebpalpha
protein complexes . in consideration of these findings and to augment
the sensitivity of the ap - ms analyses , our next efforts were focused
on one - step affinity purifications . the caveat with less stringent
purification conditions inherent with a one - step procedure is that
the frequency of nondirect interactors in the purified material increases . to enhance the dynamic range of the lcms analyses
and boost the number of proteins detected , an additional 2d - lcms approach
was introduced . taking advantage
of the strep and ha motifs in the double tag ,
one - step purifications were combined with three lcms approaches . a
total of six independent ap - ms strategies were thus designed to characterize
the c / ebpalpha interactome ( figure 1 ) . the
strep motif allows specific elution of the purified tf complex with
biotin . the eluate is compatible with 1d- , 2d - lc ms and 1d - gel - lc ms . conversely , the ha - bound material was nonspecifically eluted with
either sds for 1d - gel - lc ms or with formic acid for 1d- and
2d - lc ms . although a specific elution with ha - peptides is possible , this approach is not compatible with gel - free
lcms as a large excess of free ha peptide drastically reduces the
dynamic range of the ms analysis ( data not shown ) . the two single step strep and ha purifications
are displayed on the left and right , respectively . finally , each purification
step is visualized by a schematic of the alternative lc ms
analyses . following the affinity purification
protocols described above ,
all one - step purifications were performed as biological replicates ,
and the eluted material was analyzed on an ltq orbitrap velos mass
spectrometer . the quality of the affinity purifications was monitored
by immunoblotting for exogenous c / ebpalpha protein ( supporting information , supplementary figure 3 ) and confirmed
by the number of spectral counts specific for the tf . in all c / ebpalpha
samples , high numbers of nuclear proteins were identified associated
with the tagged tf ( data not shown ) . in addition , residual biotinylated
carboxylases and anti - ha antibody chains originating from the strep-
and the ha - purifications , respectively , were also apparent ( see supplementary table 1 ) . for all proteins
identified in the strep- versus the ha - purifications , subtraction of proteins detected in the
negative controls , however , dramatically reduced the number of common
proteins ( figure 2a ) . the same trend was observed
when the proteins identified by all three different lcms strategies
were compared . after filtering , the only shared protein was exogenous
and endogenous c / ebpalpha ( figure 2b , c ) . interestingly ,
both the qualitative and semiquantitative profile of the proteins
identified with each of the two tags was substantially different . this confirmed the high variability that has previously been reported
in the literature for different tag - based affinity purifications ( figure 2a ) . except for
the 1d - gel - free lc ms analyses of the anti - ha - tag purifications ,
all strategies identified a high number of proteins that specifically
associated with c / ebpalpha . among these , 21 interactions have been
previously reported ( figure 3 ) . in addition , both purification strategies were
characterized by a different set of background proteins that associate
with the tag and/or the affinity resin . as summarized in table s1 , each approach can be preferentially
selected based on a particular experimental design . venn diagrams of proteins
identified in the strep- and ha - purifications
( adapted from biovenn , copyright t. hulsen ) . ( a ) comparison of all
proteins identified by the six ap - ms strategies , in the nonfiltered
and the filtered networks . ( b ) and ( c ) representation of the proteins
identified with the different lcms analyses for both strep- and ha - purifications . representation of previously described c / ebpalpha - interactors
that
were identified by strep- and ha - purifications . the low number of overlapping c / ebpalpha - interacting proteins
from
the affinity purification strategies could be due to inherently different
biophysical properties of proteins bound to c / ebpalpha . in particular ,
the biochemical procedures associated with different tag - based purification ,
various elution protocols , and alternative ms analyses may all preferably
identify certain classes of proteins . therefore , a common network
featuring the proteins identified from all six strategies was created .
according to the interaction data from the literature , all proteins
identified with our approaches were clustered into previously described
multiprotein complexes ( figure 4 ) . c / ebpalpha was found to interact with different protein complexes ,
and nine of these were reproducibly retrieved by the different affinity
purification methods ( figures 4 and 5 ) . for instance , the mll - swi / snf complex was identified
by five out of six strategies , confirming the previously reported
interaction of c / ebpalpha with this complex . on the basis of these data , a total of nine
functional nuclear protein complexes were identified from the intersection
of more than two independent affinity purification approaches ( figure 5 ) . c / ebpalpha network generated from the intersection of
the proteins
identified in the six one - step protein purification approaches . from
this analysis , is possible to identify nine protein complexes associated
with c / ebpalpha . all proteins shown in the figure were identified
in our ap - ms analyses . interaction network of protein complexes associated with c / ebpalpha
identified by the six lcms analyses for both strep- and ha - purifications . the network edges are proportional to the number of protein identified
by each strategy . to confirm the robustness
of the complexes , the interactome of
a previously described c / ebpalpha mutant was analyzed in the same
cellular system . this mutant harbors a duplication of lysine 313 ( c / ebpalpha
kk ) in the basic region - leucine zipper domain . mutations affecting this domain frequently occur in aml
patients and were shown to abolish dna binding of
c / ebpalpha . hence , a 1d - gel - lc ms ap - ms experiment was conducted
using both the strep- and ha - tags . protein interaction network
was generated for the kk mutant ( figure 6 ) .
despite the different number of proteins identified , both c / ebpalpha
and the c / ebpalpha kk mutant were found to associate with the same
protein complexes . for instance , more proteins described as part
of the mll - swi / snf complex were connected to the c / ebpalpha kk mutant . on the other hand , the components of both the sin3a - hdac1 and paf
complexes were less represented ( figure 6 ) .
in the context of the c / ebpalpha kk mutant , these data suggest an
alternative biological function for these protein complexes . interaction
network of protein complexes associated with c / ebpalpha
and c / ebpalpha kk identified by strep 1d - gel - lc ms and ha 1d - gel - lc light blue , shared interactors of c / ebpalpha and c / ebpalpha
kk ; light orange , interactors identified in the c / ebpalpha interactome
of figure 4 ; red , interactors only associated
with c / ebpalpha ; violet , interactors that solely associate with c / ebpalpha
kk ; gray , detected proteins that are not part of the c / ebpalpha complexes .
for graphical reasons , only the numbers of the proteins exclusively
identified by each 1d - gel - lc all proteins
displayed were identified in our ap - ms analysis , and the entire list
of the proteins is available in the supporting
information . tfs are known to dynamically associate with several proteins and ,
depending on the protein partners , tfs can execute different transcriptional
programs . in fact , tfs have been reported
to act as macromolecular machinery complexes . using c / ebpalpha as model , we developed a novel methodology to identify
different molecular complexes associated with tfs in mammalian cells . the use of a double tag for parallel , independent single - step ap - ms
procedures from nuclear extracts markedly boost the number of proteins
detected as compared to sequential two - step ap - ms approaches . ultimately ,
the intersection of the data generated by the different ap - ms strategies
strongly emphasized the specific molecular complexes associated with
the selected tf to the detriment of so - called nonspecifically binding
proteins . a low overlap in the proteins identified by each independent
ap - ms
strategy was apparent , even within protocols adopting the same tag
affinity purification approach ( figure 2b , c ) . in contrast , however , when each protein was considered as a component
of previously described macromolecular complexes , the overlap among
the different ap - ms procedures noticeably increased . interestingly ,
each ap - ms strategy adopted favored the identification of alternative
members that belong to the same protein complex ( figure 4 ) . although determining direct interactors of a tf can be
quite complex , the use of the methodology proposed here can elucidate
the interactome of the tf of interest . in our study , a total of nine
independent protein complexes were identified associating with c / ebpalpha
( figure 5 ) . the same macromolecular complexes
were found to associate with a previously reported c / ebpalpha dna
binding mutant ( c / ebpalpha k313kk ) . more interestingly , however , was that
subtle differences were observed within the composition of some of
the nine protein complexes . this was particularly evident for the
complexes that strongly associate with dna , as observed for the paf
and the sin3a thus , the data are indicative
of alternative biological functions for c / ebpalpha and the c / ebpalpha
kk mutant ( figure 6 ) . hence , the combined
analysis of data sets generated through different
experimental strategies enabled the robust and reproducible identification
of explicit molecular complexes associated with the c / ebpalpha protein . our studies suggest that the adoption of different ap - ms strategies
for a tf is more efficient in detecting specific protein complexes
associated to the protein of interest than increasing the number of
biological replicates for each single ap - ms approach . indeed , different
elution buffers and diverse ms strategies alter the reproducibility
of the proteins complexes identified by the different independent
ap - ms analysis . conversely , the combined
analysis of data generated by at least two different ap - ms approaches
tremendously enhances the robustness of tf molecular networks . taking
into account affordability and depth of analysis required , the six
strategies described here provide the framework for optimization of
the purification procedure ( see supporting information ,
supplementary table 1 ) . the combination of experimental strategies
for the ap - ms - enabled characterization of interactors of the transcription
factor c / ebpalpha represents a dramatic improvement compared to standard
ap - ms protocols . in summary , our systematic analysis showed
that one - step purifications
from nuclear extracts of cells are necessary to analyze the protein
interaction network of a transcription factor . depending on the purification
strategy chosen , the ms analysis must be adjusted accordingly . for
strep - tag purifications , ms
is highly recommended . for anti - ha antibody - based purifications , a
fractionation step at the protein ( 1d - gel - lc ms ) or peptide
level ( 2d - lc ms ) is essential . finally , to increase the robustness
of the analysis of transcription factor complexes , we recommend the
use of a combination of at least two independent tag purifications . overall , this study describes a new methodology to characterize
the c / ebpalpha protein interaction network . we believe this approach
can be robustly and generically extended to other transcription factors
and other common nuclear proteins . | affinity purification ( ap ) coupled
to mass spectrometry ( ms ) has
been successful in elucidating protein molecular networks of mammalian
cells .
these approaches have dramatically increased the knowledge
of the interconnectivity present among proteins and highlighted biological
functions within different protein complexes . despite significant
technical improvements reached in the past years
, it is still challenging
to identify the interaction networks and the subsequent associated
functions of nuclear proteins such as transcription factors ( tfs ) .
a straightforward and robust methodology is therefore required to
obtain unbiased and reproducible interaction data . here
we present
a new approach for tf ap - ms , exemplified with the ccaat / enhancer binding
protein alpha ( c / ebpalpha ) . utilizing the advantages of a double tag
and three different ms strategies
, we conducted a total of six independent
ap - ms strategies to analyze the protein
protein interactions
of c / ebpalpha .
the resultant data were combined to produce a cohesive
c / ebpalpha interactome .
our study describes a new methodology that
robustly identifies specific molecular complexes associated with transcription
factors .
moreover , it emphasizes the existence of tfs as protein complexes
essential for cellular biological functions and not as single , static
entities . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
microfabrication technologies have the potential to facilitate control over the organization of cells ( patel et al 1998 ; michel et al 2002 ; tien and chen 2002 ; hyun et al 2003 ; tan and desai 2003 ; raghavan and chen 2004 ; lin et al 2005 ; rhee et al 2005 ) . geometric control over cell binding on biodegradable substrates is essential for engineering highly organized tissues with precisely defined cellular architectures ( chen et al 1997 ; bhatia et al 1998 ) . spatial organization of cells is also essential for cell - based sensors , cell culture analogs , controlling cell - to - cell interactions , and for developing new understandings of how populations of cells react to spatiotemporal cues ( raghavan and chen 2004 ; flaim et al 2005 ; rhee et al 2005 ; tourovskaia et al 2005 ) . poly ( lactic acid ) ( pla ) and related members of the poly ( alpha hydroxy acids ) polymer family have gained wide acceptance for applications in drug delivery and tissue engineering but lack functional groups that would allow for covalent functionalization of cell adhesive moieties ( quirk et al 2000 ; salem et al 2001 ) . one strategy that has been developed for overcoming this is to surface engineer pla by physically entrapping functional modifying species onto the surface ( quirk et al 2000 ; quirk , briggs , et al 2001 ) . this is an approach that has previously been used to modify the surfaces of polymers such as poly ( ethylene terephthalate ) , poly ( methyl methacrylate ) , poly styrene , and poly ( vinyl acetate ) ( desai and hubbell 1991 , 1992 ) . this modification is achieved by mixing a miscible mixture of solvent and nonsolvent for the polymer with the surface - modifying species . when the polymer is exposed to the partial solvent mixture , it causes rapid polymer gelation at the surface . the surface - modifying species can then diffuse into the gel layer of the polymer . when a large excess of nonsolvent is then added , the gel layer collapses , entrapping the surface - modifying species in the substrate . this methodology can be used to prepare both cell adhesive and cell repellant substrates ( desai and hubbell 1991 , 1992 ; quirk et al 2000 ; quirk , briggs , et al 2001 ; quirk , davies , et al 2001 ) . here we report on a new method for binding cells in spatially defined regions using both cell adhesive and cell repellant cues . poly ( d - lysine ) ( pdl ) , a cationic polymer reported to promote cell attachment , is entrapped on the surface of a degradable polymer substrate in the spatially defined confines of microfluidic channels . this method of microfluidic networking has found utility in a variety of applications from patterning of proteins ( delamarche et al 1997 ) , cells ( patel et al 1998 ) , and nanowires ( salem et al 2004 ) . to fabricate the mold , the prepolymer was cured ( sylgard silicone elastomer 184 , dow corning , rockford , illinois , usa ) on a patterned master which was prepared by spin coating 250 l photoresist ( su8 ) onto a silicone wafer for 55 seconds at 2500 rpm , solvent - baked at 100c for 100 seconds , and then exposed to uv light ( 11mj cm ) from a mercury vapor lamp . the exposed resist was developed in a 4:1 mixture of deionized water , and after drying with nitrogen , the patterned master was then hard - baked for 25 minutes at 125c . the elastomeric mold with the negative imprint on it was peeled off and washed several times with ethanol , hexane , and deionized water . to synthesize pla peg , water impurities were first removed from the meo - peg - oh ( mw , 2000 , sigma - aldrich , st louis , mo , usa ) . this was achieved by dissolving the m - peg ( 200 mg ) in toluene ( 70 ml ) and refluxing with a dean - stark trap and a condenser . residual solvent was removed by drying the polymer under vacuum for 2 days . to prepare the pla peg , lactide ( purac biochem bv , gorinchem , the netherlands ) was graft polymerized onto the meo - peg - oh . first , glassware was silanized by rinsing with a 5% methyltrichlorosilane solution in toluene , rinsing with acetone , and then leaving overnight to dry at 130c . then a 50-ml round - bottom flask was charged with meo - peg - oh ( 0.2 g ) . dl - lactide ( 2.1 g ) was transferred into the round - bottom flask , diluted with 10 ml toluene , and heated to 60c until the contents went into solution . sn(oct)2toluene ( 0.1 g in 1 ml ) was then added and the reaction brought to reflux at 110c for 4 hours under argon . following this , the reaction vessel was equipped with a dean - stark trap and any remaining solvent was removed by vacuum rotary evaporator . the remaining viscous material was heated to 140c ; this melt was then left for 1 hour under argon . the reaction mixture was allowed to cool after which it was dissolved in approximately 10 ml dichloromethane . this polymer solution was then added drop - wise to a cold stirring solution of 100 ml diethyl ether . the final product was isolated by vacuum filtration and lyophilized overnight . based on h - nmr measurements of the integral ratios of the ( ch2-ch2-o ) at 3.51 ppm and the ( ch3 , 5.22 ppm ) and the ( ch , 1.53 ppm ) from the lactic acid units , the mw was calculated to be approximately 23000 . immunofluorescent analysis was performed by fixing cells in 3.7% paraformaldehyde in phosphate - buffered saline ( pbs ) for 10 minutes . the cells were then rinsed in 1x pbs followed by permeabilization for 8 minutes in 0.5% triton x-100 in pbs . following rinsing with 1x pbs , cells were stained with phalloidin - ritc ( 1:500 ) for 45 minutes at 37c after which the samples were washed in 1x pbs for 5 minutes , rinsed in deionized water for 1 minute and mounted with flourosave ( sigma ) . the pla disks were viewed on an olympus ckx41 ( leeds precision instruments , minneapolis , mn , usa ) microscope equipped with epifluorescence optics and a 10x objective ( total magnification 100x ) . measurement of cell attachment was carried out by counting absolute cell numbers , n = 3 per condition . for immunofluorescent analysis , 3 random sites per pla disk were observed . comparisons in cell attachment were statistically analyzed using a one - way anova with a tukey s multiple comparison test . to fabricate the mold , the prepolymer was cured ( sylgard silicone elastomer 184 , dow corning , rockford , illinois , usa ) on a patterned master which was prepared by spin coating 250 l photoresist ( su8 ) onto a silicone wafer for 55 seconds at 2500 rpm , solvent - baked at 100c for 100 seconds , and then exposed to uv light ( 11mj cm ) from a mercury vapor lamp . the exposed resist was developed in a 4:1 mixture of deionized water , and after drying with nitrogen , the patterned master was then hard - baked for 25 minutes at 125c . the elastomeric mold with the negative imprint on it was peeled off and washed several times with ethanol , hexane , and deionized water . to synthesize pla peg , water impurities were first removed from the meo - peg - oh ( mw , 2000 , sigma - aldrich , st louis , mo , usa ) . this was achieved by dissolving the m - peg ( 200 mg ) in toluene ( 70 ml ) and refluxing with a dean - stark trap and a condenser . residual solvent was removed by drying the polymer under vacuum for 2 days . to prepare the pla peg , lactide ( purac biochem bv , gorinchem , the netherlands ) was graft polymerized onto the meo - peg - oh . first , glassware was silanized by rinsing with a 5% methyltrichlorosilane solution in toluene , rinsing with acetone , and then leaving overnight to dry at 130c . then a 50-ml round - bottom flask was charged with meo - peg - oh ( 0.2 g ) . dl - lactide ( 2.1 g ) was transferred into the round - bottom flask , diluted with 10 ml toluene , and heated to 60c until the contents went into solution . sn(oct)2toluene ( 0.1 g in 1 ml ) was then added and the reaction brought to reflux at 110c for 4 hours under argon . following this , the reaction vessel was equipped with a dean - stark trap and any remaining solvent was removed by vacuum rotary evaporator . the remaining viscous material was heated to 140c ; this melt was then left for 1 hour under argon . the reaction mixture was allowed to cool after which it was dissolved in approximately 10 ml dichloromethane . this polymer solution was then added drop - wise to a cold stirring solution of 100 ml diethyl ether . the final product was isolated by vacuum filtration and lyophilized overnight . based on h - nmr measurements of the integral ratios of the ( ch2-ch2-o ) at 3.51 ppm and the ( ch3 , 5.22 ppm ) and the ( ch , 1.53 ppm ) from the lactic acid units , the mw was calculated to be approximately 23000 . immunofluorescent analysis was performed by fixing cells in 3.7% paraformaldehyde in phosphate - buffered saline ( pbs ) for 10 minutes . the cells were then rinsed in 1x pbs followed by permeabilization for 8 minutes in 0.5% triton x-100 in pbs . following rinsing with 1x pbs , cells were stained with phalloidin - ritc ( 1:500 ) for 45 minutes at 37c after which the samples were washed in 1x pbs for 5 minutes , rinsed in deionized water for 1 minute and mounted with flourosave ( sigma ) . the pla disks were viewed on an olympus ckx41 ( leeds precision instruments , minneapolis , mn , usa ) microscope equipped with epifluorescence optics and a 10x objective ( total magnification 100x ) . measurement of cell attachment was carried out by counting absolute cell numbers , n = 3 per condition . comparisons in cell attachment were statistically analyzed using a one - way anova with a tukey s multiple comparison test . first , poly dl lactic acid ( pla , sigma , mw 75 000120 000 ) discs of approximately 25 mm by 0.22 mm were prepared by melt pressing the pla between two glass slides . the pla disks were then uniformly shaved to 2.1 cm in diameter to fit in 12-well plates . pdl solution was prepared by dissolving pdl ( sigma , mw 3070 k ) in a 10%/90% v / v tfe / water at 0.01% , 0.02% , 0.05% , 0.1% , 1% , 5% , and 10% w / v concentrations . tfe was selected as a solvent for pla because it also displays excellent solvent compatibility with poly ( dimethylsiloxane ) ( pdms ) with an s value of 1.01 , where s is the swelling ratio determined by dividing the length of pdms in the solvent by the length of dry pdms ( lee et al 2003 ) . selection of the 10%/90% tfe / water ratio was based on the observation that tfe / water concentrations of 30%/70% result in dissolution of pla , being the dominant polymer solvent interaction , whilst concentrations lower than 10% tfe produce insufficient gel formation for optimum diffusion of surface - modifying species ( quirk et al 2000 ) schematic of localized partial solvent entrapment of pdl on a degradable polymer substrate . abbreviations : pdl , poly ( d - lysine ) ; pdms , poly ( dimethylsiloxane ) ; pla peg , poly ( lactic acid)poly ( ethylene glycol ) . to determine the concentration of entrapped pdl required for optimum cell attachment , 1ml of pdl in tfe twenty ml of excess water ( nonsolvent ) was then added to collapse the gel layer and entrap the pdl . preosteoblast human palatal mesenchymal cells ( hepm 1486 ; atcc , manassas , va , usa ) were grown to confluence in eagle s minimum essential medium ( emem ) supplemented with earle s salts , l - glutamine ( 2 mm ) , nonessential amino acids ( 0.1 mm ) , sodium pyruvate ( 1 mm ) , 10% fetal bovine serum , and 25 g / ml penicillin streptomycin . they were then plated onto the disks in the same culture medium at a seeding density of 110 cells . cultures were allowed to attach for 1 hour before flooding with 1 ml of media . after 2 additional hours , the media was removed from the wells and unattached cells quantitated with the zm model coulter counter . attached cells were observed by fluorescent microscopy . as illustrated in figure 2a , the optimum cell attachment observed was at 0.1% pdl which produced a significant increase in cell attachment from 54.4% for pla with no treatment to 94.2% for pla with 0.1% pdl treatment ( p<0.001 ) . ( a ) summary bar chart of hepm cell attachment assay after 1 hour of incubation on pla surfaces treated with varying concentrations of pdl ( w / v ) in 10%/90% tfe / water solutions . the values are expressed as the mean % of control cell attachment ( sd ) on tcp with n=3 . * control pla substrates with 0% pdl had significantly lower cell attachment than pla substrates treated with pdl ( p<0.001 for 10% pdl , 5% pdl , 1% pdl , 0.1% pdl and p<0.01 for 0.01% pdl , 0.001% pdl treatment ) . above each bar is a representative image of attached cells stained with phalloidin - ritc . ( b ) fluorescent microscopy image of pla substrates patterned by partial solvent entrapment of pdl and then reacted with nhs - rhodamine . representative light microscopy images ( objective 10 ) of hepm cells attaching to ( c ) pdl patterned pla substrate after 1 hour and ( d ) pdl patterned pla abbreviations : hepm , preosteoblast human palatal mesenchymal cells ; pdl , poly ( d - lysine ) ; pdms , poly ( dimethylsiloxane ) ; pla peg , poly ( lactic acid)poly ( ethylene glycol ) ; tcp , tissue culture plastic ; tfe , trifluoroethanol . next , 0.1% w / v pl in 10%/90% tfe / water was entrapped in predefined regions of the pla substrate using a pdms mold with channels ranging from 160 m to 240 m width . the mold was placed onto the pla substrate and 1 ml of the 0.1% pdl in 10/90 tfe / water solution was placed at the entrance of the capillaries . after 30 minutes , the channels were flushed with 3 ml deionized water to collapse the gel layers within the channels and remove excess nonbound pdl . the pdms stamp was then removed and the pla substrate rinsed with excess deionized water several times . the pdl entrapped in the pla within the pdms channels act as localized adhesive substrates for cell attachment . to confirm entrapment of the pdl within the predefined channels , patterned pla disks were incubated with 5(6)-carboxytetramethylrhodamine n - hydroxysuccinimide ester ( sigma , nhs - rhod ) in 0.1 m sodium borate buffer ( ph 8.5 ) overnight . the disks were then washed 7 times with excess deionized water and imaged by fluorescent microscopy ( olympus ckx41 , abs 555 nm , em 580 nm ) . as seen in figure 2b , fluorescence from rhodamine this confirms that pdl can be patterned using the partial solvent swelling procedure and that the free amine groups presented by the pdl could be used for binding a range of moieties from cell adhesive peptides for tissue engineering purposes to other biomolecules such as antigen the fluorescence observed within the channels was patchy , indicating , phase separation of the pdl which is consistent with previous observations of conditions that swell polymer surfaces for extended periods of times ( quirk et al 2000 ; quirk , davies , et al 2001 ) . next , we incubated hepm cells on pdl patterned pla substrates in 35-mm dishes at a seeding density of 110 cells in 1 ml of supplemented mem with 10% fetal calf serum . each sample was incubated for 1 hour and then washed with warmed media to remove unbound cells and imaged by light microscopy ( olympus ckx41 ) . as seen in figure 2c , cells attached preferentially within the patterned regions but also adhered outside of the patterned region . given that pla substrates without treatment display up to 54.4% cell attachment as observed in figure 2b , it follows that hepm cells would still be able to bind to pla regions outside the pdl - patterned regions . peg is well established for its protein- and cell - resistant properties . to ensure that cells bound to the pdl - patterned regions only , we carried out the microfluidic networking of the pdl in tfe peg units from the copolymer are presented at the surface when incubated in aqueous media . when hepm cells were incubated on pdl - patterned pla peg substrates under the same conditions as the pla substrates , cells were found to bind specifically within pdl - patterned channels ( figure 2d ) . the peg presented by the copolymer was , therefore , minimizing cells from binding outside the channels . in summary , we have demonstrated spatial control over preosteoblast cell attachment using cell repellant and cell adhesive cues prepared by partial solvent entrapment of pdl in microfluidic channels on a degradable polymer substrate . the free amine groups that are produced in the patterned regions can be used to conjugate a range of biomolecules or cell adhesive species as demonstrated by the reaction with nhs - rhodamine . peg copolymers ( salem et al 2001 ) in conjunction with this technique has potential to lead to spatial control over different cell types for optimizing activity in tissues such as liver ( bhatia et al 1998 ) . this technique could also be used for other applications such as guided neuronal growth ( patel et al 1998 ) , controlled bone regeneration ( schneider , english , et al 2004 ; schneider , zaharias , et al 2004 ) , and cell - based biosensors . finally , this approach could be extended to spatial control over cell manipulation and biomolecule binding on a nanoscale given the capacity of soft lithography and nanofluidic networking to produce features below 100 nm ( zhao et al 1997 ; ke et al 2005 ) . | we demonstrate spatial control over cell attachment on biodegradable surfaces by flowing cell adhesive poly ( d - lysine ) ( pdl ) in a trifluoroethanol ( tfe)water mixture through microfluidic channels placed on a biodegradable poly ( lactic acid)poly ( ethylene glycol ) ( pla peg ) substrate .
the partial solvent mixture swells the pla peg within the confines of the microfluidic channels allowing pdl to diffuse on to the surface gel layer . when excess water is flowed through the channels substituting the tfe water mixture , the swollen pla surface collapses , entrapping pdl polymer .
results using preosteoblast human palatal mesenchymal cells ( hepm ) indicate that this new procedure can be used for facile attachment of cells in localized regions .
the peg component of the pla peg copolymer prevents cells from binding to the nonpatterned regions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
asymptomatic inflammation ( ai ) ( also known as silent , low - grade , or painless inflammation ) is a concept that describes a scenario in which an etiologic agent is present without clinical evidence of harm or pain . it can be found in different types of cancer , genital tract diseases , cerebral infarction , or diabetic conditions . the oral environment is also vulnerable to suffer ai under certain pathologies , including chronic apical periodontitis and periodontal disease . dental treatments such as deep restorations or orthodontic movements can cause incessant injury to dental tissues that are not identified as noxious . irreversible pulpitis can also occur asymptomatically [ 7 , 8 ] , which may progress to dental pulp necrosis without treatment . vascular , neural , cellular , and biochemical changes from inflammation can be present in the absence of pain . neuropeptides released from primary afferent neurons ( pan ) are crucial factors in provoking inflammation of neural origin or neurogenic inflammation . substance p ( sp ) and calcitonin gene - related peptide ( cgrp ) are capable of inducing vasodilation , plasma extravasation , immune cell chemotaxis , and pain [ 11 , 12 ] . peripherally , opioid - containing immune cells ( ocic ) play the main role due to -endorphins ( -end ) and methionine - enkephalin ( met - enk ) release . these substances induce the activation of opioid receptors ( or ) located in pan , thus causing electrical changes that modulate pain partially via the inhibition of neuropeptide release [ 15 , 16 ] . considering both sides , it is interesting to analyze these two families of peptides within dental pulp , using controlled orthodontic forces that may allow nerve response without causing clinical symptomatology . the aim of this study was to determine the expression levels of sp , cgrp , -end , and met - enk in human dental pulp following orthodontic intrusion . eight patients of both sexes who were between 12 and 16 years old were selected . inclusion criteria were as follows : being systemically healthy and indicated for the extraction of the four first premolars for orthodontic reasons ; teeth without caries , fractures , or periodontal disease ; and teeth with radiographically evident complete radicular formation . exclusion criteria were as follows : patients receiving recent anti - inflammatory , analgesic , or antibiotic treatment ; those who had root resorption ( from any cause ) , permanent or provisional restorations in the first premolars or radicular dilacerations ; smokers ; pregnant patients ; and those who have occlusal disorders . a descriptive comparative pilot study was conducted with the approval of the institutional ethics committee ( approval code number ceife-002 - 010 ) , according to the declaration of helsinki . written informed consent was explained and obtained from parents / legal guardians of each patient . intrusive orthodontic appliances were designed using standard 0.018 orthodontic brackets and double tubes ( sybron / ormco , orange , ca , usa ) , selected for the first premolars and permanent first molars , respectively . both brackets were bonded to each tooth using the adhesive system prime & bond ( 3 m unitek , monrovia , ca , usa ) and composite filtek 350 ( 3 m unitek ) , standardizing their positions with an anderson calibrator ( dentaurum gmbh , ispringen , germany ) . using number 139 orthodontic pliers ( dentaurum gmbh ) , a 1 mm loop was formed with a retentive fold on the opposite side of a stainless steel wire ( 0.018 0.025 ) . the customized wire was placed in the tube slot and adjusted to allow the loop to be bent until an acute angle was achieved . using a dynamometer ( corex , haag - streit , kowniz , switzerland ) , the angulation was standardized at 40 to allow for a 150200 g intrusive force . two premolars from each patient were randomly selected and assigned to two different groups : the asymptomatic inflammation group referred to as experimental group , which would undergo controlled intrusive force for seven days ( expg ) , and the control group ( ctrg ) , used to determine the basal levels of each substance . each patient was scheduled to obtain the samples from the control tooth before any clinical intervention took place . each control tooth was anesthetized with 4% prilocaine ( pricanest , ropsohn therapeutics , bogot , colombia ) . from that moment , the entire sampling procedure was performed within a 10-minute period . after extraction , a second assistant created a 1 mm longitudinal groove over the vestibular tooth surface using a high - speed diamond bur with copious irrigation to facilitate the mechanical fracture of the tooth and the intact acquisition of pulpal tissue , which was immediately stored in a tagged cryovial containing 1.8 ml of 4% paraformaldehyde . after its activation , each patient received instructions to call if any problem or severe discomfort was experienced and , if necessary , to take 400 mg of ibuprofen as a rescue analgesic . for the following six days , the patients were contacted by telephone to evaluate their progress along the experimental period . information on their symptoms , analgesic usage , or orthodontic device displacement was recorded . at day seven , patients were scheduled to obtain the dental pulp sample from expg , as described above . a radioimmunoassay ( ria ) was performed to quantify the amount of each substance obtained from each sample , according to previous investigations reported . sp , cgrp , -end , and met - enk release were determined by competition ria binding assays using a human sp ria - kit ( reference rk-061 - 05 ) , a human cgrp ria - kit ( reference rk-015 - 02 ) , a human -end ria - kit ( reference rk-022 - 14 ) ( phoenix peptide pharmaceuticals , burlingame , ca , usa ) , and a human met - enk ria - kit ( reference s-2119 ) ( peninsula laboratories llc , bachem group , san carlos , ca , usa ) . for each kit , 100 l of antiserum and 100 l of various neuropeptide / opioid concentrations ( 1128 pg l ) or 100 l of dental pulp tissue extracts were incubated in polypropylene tubes at room temperature for 20 hours . then , 100 l of radioactive 125i tracer was added and left to incubate for another 24 hours . bound fractions were precipitated by the addition of 100 l of a secondary antibody ( goat anti - rabbit immunoglobulin g serum ) , 100 l normal rabbit serum , and 500 l ria buffer containing 1% polyethylene glycol 4,000 . after 2 hours of incubation at room temperature , the suspensions were spun at 3,500 rpm ( 4,000 g ) for 40 minutes at 4c to precipitate the bound fractions . the supernatants were carefully aspirated , and pellet radioactivity was read on a gamma counter ( model b5002 , packard instrument international , zurich , switzerland ) . all samples were assayed in duplicate , and the mean values were calculated . finally , scatchard analysis of the binding data was used to assess the amount of neuropeptide / opioid present in each sample . the results were analyzed by the mann - whitney u test to compare the differences among groups for continuous variables . a difference was considered to be significant if the probability of its occurring by chance alone was < 5% ( p < 0.05 ) in a two - tailed test . basal levels of both neuropeptides and endogenous opioids were observed . in the expg , sp and cgrp exhibited statistically significant different levels ( p < 0.05 ) . although none of the endogenous opioids showed statistically significant differences ( p > 0.05 ) , they all expressed increasing trends in the expg . none of the patients enrolled were eliminated from the study because no one reported severe pain episodes or the need to take the rescue analgesic treatment . all patients reported tolerable discomfort localized in the tooth assigned to expg , for the two or three days after orthodontic activation . by day seven , all of the symptoms were absent , and all of the orthodontic devices were still active . mechanisms related to neurogenic inflammation and pain modulation in ai are not fully understood . in this study , the expression of two somatosensory neuropeptides and two ops in dental pulp ai caused by orthodontic intrusion was determined . this clinical model allowed us to obtain a biphasic inflammatory transition , which began with discomfort during the acute phase and finally achieved an asymptomatic state . since the intrusion period of the experiment was seven days , it was considered not objective to make a clinical measurement of the distance . in this experiment , although the majority of available evidence is focused on the biochemistry of painful conditions , the study of ai is a promising field that may help explain how important diseases appear after the development of anonymous inflammation . in this study , the presence of an initial inflammatory tenderness was required to assess the beginning of the asymptomatic phase ; it was a requirement for this study that all patients report no presence of pain when the samples were obtained . previous studies have demonstrated , within dental pulp , the expression of markers of neurogenic inflammation ( substance p and cgrp ) using the model of inflammation employed in this study ; this controlled orthodontic movement was selected as a well - standardized available model for human clinical trials focused on inflammation [ 6 , 1921 ] . chemotaxis of the macrophage population induced by neuropeptides in late orthodontic inflammation is crucial to establish the neuropeptidergic and op relationship . furthermore , nerve fiber sprouting and neurogenic inflammation are common during pulpal insult , including early force application during orthodontic tooth movement . macrophages express nk1 and cgrp1/2 receptors , which are activated by sp and cgrp , respectively , favoring their activation [ 15 , 24 ] . these cells are the main secretors of op , including -end and met - enk . interestingly , under inflammatory conditions , pan , the main source of local sp and cgrp release , exhibits an upregulation expression of or [ 13 , 27 ] , which can be targeted by macrophage analgesic products ( figure 1 ) . controversy surrounds the fact that macrophages are also capable of secreting somatostatin ( a substance able to cause analgesia ) ; thus , pain control may not be exclusively caused by op . these results demonstrate an important increase of sp and cgrp levels in expg ( p < 0.05 ) . the release of sensory neuropeptides occurs almost immediately , in a manner described as an axonal reflex . such a response supports the role of neurogenic inflammation of the dental pulp after low - grade orthodontic continuous movement [ 20 , 22 , 28 ] . both neuropeptides are frequently associated with pain from pulpal origin [ 2931 ] ; however , they have also been identified in asymptomatic irreversible pulpitis . the importance of the role of neuropeptides in inflammation was previously studied by determining their absence , not their presence . different denervation experiments showed how the deprivation of the sensory nerve supply can attenuate the local inflammatory response . both ops are postulated to play the leading role in endogenous antinociception due to their action as negative regulators of neurogenic inflammation by the inhibition of sp and cgrp release [ 14 , 15 ] . however , this study shows that , after orthodontic intrusion , low levels of op were not enough to attenuate neuropeptide expression . it is important to consider why late neurogenic inflammation can develop in the absence of pain . first , dental pulp is able to adjust slowly to low - grade inflammation , assimilating higher levels of proalgesic mediators in the absence of pain . second , experimental tooth movement is capable of activating central trigeminal pain modulation mechanisms , causing a reduction in the local recruitment of ocic to peripheral injured tissues ; thus , the net effect will be the control of pain and lower peripheral opioid peptide concentration [ 15 , 25 , 3537 ] . third , new evidence explores the dual effects of neuropeptides in relation to pain experience . sp enhances opioid release , and it is possible that its n - terminal fragment may act as a miu - opioid receptor ( mor ) agonist once its expression is upregulated during inflammation . for cgrp , the antinociceptive effect is related to the upregulation of mor when it is applied centrally and peripherally by the local suppression of interleukin-2 production , causing an anti - inflammatory effect . finally , though both neuropeptides are strong vasodilators , this effect may be masked by low blood flow after orthodontic intrusion , thus avoiding the increase of inner pressure in a low compliance pulpal environment [ 3941 ] . all of these hypotheses must be evaluated in further studies , including more patients in order to confirm these findings , as well as new complementary experiments including pulp tissue immunostaining to evaluate neurons , peptides activity , and immune and inflammatory cells participation . also , it is necessary to include peptides measurement at different time points in order to elucidate the possible mechanism of asymptomatic inflammation . in this preliminary report , sp and cgrp were identified in dental pulp after seven days of controlled orthodontic intrusion movement , even in the absence of pain . at the same time , endogenous opioids exhibited no statistical differences compared with control levels ; however , an increase tendency was appreciable for both . | purpose .
this study quantified the expression of substance p ( sp ) , calcitonin gene - related peptide ( cgrp ) , -endorphins ( -end ) , and methionine - enkephalin ( met - enk ) in human dental pulp following orthodontic intrusion . methods .
eight patients were selected according to preestablished inclusion criteria . from each patient , two premolars ( indicated for extraction due to orthodontic reasons )
were randomly assigned to two different groups : the asymptomatic inflammation group ( expg ) , which would undergo controlled intrusive force for seven days , and the control group ( ctrg ) , which was used to determine the basal levels of each substance .
once extracted , dental pulp tissue was prepared to determine the expression levels of both neuropeptides and endogenous opioids by radioimmunoassay ( ria ) .
results .
all samples from the ctrg exhibited basal levels of both neuropeptides and endogenous opioids . by day seven , all patients were asymptomatic , even when all orthodontic - intrusive devices were still active . in the expg ,
the sp and cgrp exhibited statistically significant different levels .
although none of the endogenous opioids showed statistically significant differences , they all expressed increasing trends in the expg .
conclusions .
sp and cgrp were identified in dental pulp after seven days of controlled orthodontic intrusion movement , even in the absence of pain . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
neuromyelitis optica ( nmo ) is a complex severe demyelinating disorder of central nervous system that was primarily considered to be characterized by optic neuritis ( on ) and myelitis . nmo was considered a disease without brain involvement , which was part of major diagnostic criteria proposed by wingerchuk et al . in 1999 . ever since the discovery of nmo - igg / anti - aquaporin-4 ( aqp-4 ) antibody in a proportion of patients with clinically proven nmo and in patients with recurrent , isolated , longitudinally extensive spinal cord lesions ( lecs ) or on as well as patients with lecs or on associated with systemic autoimmune disease or with brain lesions , it has resulted in the identification of a spectrum of disorders called nmo spectrum disorders ( nmosd ) . although positivity of aqp-4 antibody and presence of brain lesions have been introduced in the revised nmo criteria , the presence of on and lecs is still mandatory [ table 1 ] . in addition , a separate spectrum for aqp-4 antibody positive patients not fitting into the nmo clinical criteria has been proposed [ table 2 ] . revised criteria for the diagnosis of neuromyelitis optica neuromyelitis optica spectrum isolated and asymptomatic brain findings are now increasingly identified at presentation in these cases ; hence , it is imperative to be aware of these brain lesions which might be specific enough to prompt correct diagnosis . in addition , as the symptoms may be dramatic and may not be neurological , we need to be aware of this entity . we herein present a case of an adult woman who had a past history of on and presented with recent onset hiccups and intractable vomiting . a 45-year - old woman came to the emergency department of our hospital with a history of intractable vomiting and hiccups for 2 days . she was admitted and extensively evaluated in the form of blood investigations and endoscopy . on enquiry , she gave a vague history of loss of vision in the left eye which improved gradually after taking some medication . small hyperintense specks were seen symmetrically in axial fluid attenuation inversion recovery images in the dorsal aspect of the upper medulla at the caudal end of the fourth ventricle ( area postrema ) [ figure 1 ] . on sagittal t2-weighted images , thin streak - like hyperintensity was seen [ figure 2 ] . no restriction of diffusion or definite contrast enhancement was noted [ figures 3 and 4 ] . fluid attenuation inversion recovery axial image at the level of upper medulla shows tiny hyperintense foci in the dorsal aspect of medulla at the caudal end of fourth ventricle - area postrema ( arrows ) mid sagittal t2-weighted image shows faint hyperintense linear streak in the dorsal aspect of upper medulla near the caudal end of fourth ventricle ( arrow ) diffusion weighted image shows no restriction no enhancement seen on post contrast scan these lesions were so tiny and nondescript that we had missed them on first analysis , however on review , we came to a conclusion that these indeed could be lesions related to nmosd . the history of vision loss and recovery which could be suggestive of on also proved to be corroborative . as the patient can not be classified as nmo , at present , due to lack of cord symptoms , she definitely fits the criteria for nmosd . lack of brain involvement was traditionally one of the major supportive diagnostic criteria ; however , later it was established that asymptomatic brain abnormalities may be seen in up to 60% of the patients with clinically defined nmo . a number of studies have identified a defined spectrum of brain lesion types in up to 93% of the patients with nmo- and aqp-4 antibody - positive nmosd . now , with identification of nmosd , as it is increasingly recognized that some patients present with brain symptoms as their first manifestation or develop recurrent brain symptoms without on or myelitis , these brain abnormalities have been called to clinicians and radiologists attention . nonspecific punctate or small ( 3 mm ) lesions in the deep or , less commonly , subcortical white matter are frequent and usually asymptomatic . specific lesion types that are helpful in the radiologic diagnosis of nmo / nmosd are as follows :
typical lesions in the peri - ependymal regions surrounding the third ventricle , cerebral aqueduct , and fourth ventricle , wherein the aqp-4 antigen is in abundance . such lesions within the thalamus and hypothalamus may present with a variety of symptoms such as syndrome of inappropriate antidiuretic hormone secretion , narcolepsy , behavioral change , and hypothermia , hypotension , hypersomnia , and obesity . brain stem lesions can result in a variety of bulbar symptoms , among which intractable hiccups , nausea , and vomiting are relatively specific for nmo and attributable to the involvement of the area postrema and the nucleus tractus solitariusour patient had similar symptoms attributable to tiny foci of demyelination in area postremaperiependymal / periventricular and corpus callosum lesions situated in proximity to the lateral ventricles , which need to be differentiated from multiple sclerosis ( ms ) plaquesunilateral or bilateral , longitudinally extensive lesions involving the corticospinal tract especially seen in aqp-4 antibody - positive korean populationextensive hemispheric lesions : extensive and confluent hemispheric white matter lesions are tumefactive ( > 3 cm in longest diameter ) or configured as long spindle - like or radial - shaped signal changes following white matter tracts such as the longitudinal fasciculuscortical involvement and leptomeningeal enhancement has been described , but it is very rare . typical lesions in the peri - ependymal regions surrounding the third ventricle , cerebral aqueduct , and fourth ventricle , wherein the aqp-4 antigen is in abundance . such lesions within the thalamus and hypothalamus may present with a variety of symptoms such as syndrome of inappropriate antidiuretic hormone secretion , narcolepsy , behavioral change , and hypothermia , hypotension , hypersomnia , and obesity . brain stem lesions can result in a variety of bulbar symptoms , among which intractable hiccups , nausea , and vomiting are relatively specific for nmo and attributable to the involvement of the area postrema and the nucleus tractus solitarius our patient had similar symptoms attributable to tiny foci of demyelination in area postrema periependymal / periventricular and corpus callosum lesions situated in proximity to the lateral ventricles , which need to be differentiated from multiple sclerosis ( ms ) plaques unilateral or bilateral , longitudinally extensive lesions involving the corticospinal tract especially seen in aqp-4 antibody - positive korean population extensive hemispheric lesions : extensive and confluent hemispheric white matter lesions are tumefactive ( > 3 cm in longest diameter ) or configured as long spindle - like or radial - shaped signal changes following white matter tracts such as the longitudinal fasciculus cortical involvement and leptomeningeal enhancement has been described , but it is very rare . in addition , these lesions have to be differentiated from ms as in about 5% of the patients with ms may also have the nmo antibody and a subgroup of a nmo patients may be negative for the antibody . more importantly , some of the treatment options of ms may be useless and may actually worsen nmo . apart from clinical presentations which are usually more fulminant in nmo , initial involvement of cord and optic nerves also point to the diagnosis . different patterns of spinal cord involvement are noted in the two diseases , long segment cord involvement in nmo ( > 3 segments ) while short segment involvement is seen in ms . periventricular lesions can be seen in both ms and nmo ; however , typical ms , lesions are discrete , ovoid , perpendicular to the ventricles , and perivenular extended ( e.g. , dawson 's fingers ) , while nmosd lesions are located immediately next to the lateral ventricle , following the ependymal lining in disseminated pattern and are often edematous and heterogeneous . in our case , the patient had a past history of on , and in the current episode , presented with non - neurological symptoms . thus , emphasizing that it is important to know the brain manifestations of nmo / nmosd as these may be the first manifestations of this disease and though many findings may be nonspecific , their characteristic locations and configurations are helpful . a thorough understanding of diverse brain manifestations is now crucial for early and correct diagnosis of nmosd . | neuromyelitisoptica ( nmo ) and multiple sclerosis ( ms ) were once considered to be differing manifestation of same auto immune disease , nmo predominantly involving the optic nerve and cord .
now with discovery of nmo antibody the concept has changed and a spectrum of disorders with lesions in brain has been identified . occasionally , brain may be the first or the only site of involvement in these disorders hence it is essential to be aware of this spectrum .
the brain lesions in nmo / nmosd may be located in characteristic regions and present with symptoms mimicking non neurological disease .
we herein present a case of an adult female who was admitted with intractable vomiting and hiccups ; subsequently on mri brain found to have very tiny demyelinating foci in area postrema . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 42-year - old woman ( gravida 7 , para 2 ) visited our hospital at the 14th gestational week and was diagnosed as placenta previa in the posterior wall of the uterus by ultrasonography at 28 weeks of gestation . her pregnant course was uneventful until she had massive bleeding amounting 700 g with uterine contractions at 35 + 6 weeks of gestation . cesarean section was performed under general anesthesia , and a healthy female infant weighing 2520 g was delivered with apgar score of 8 in 1 minute and 9 in 5 minutes . blood loss during the operation was 2730 ml and six units of red cell concentrates and ten units of fresh frozen plasma were administered . as continuous bleeding from the uterine cavity was recognized after the operation , and since atony of uterus might have accelerated external hemorrhage , we decided to perform uterine artery embolization ( uae ) . the vital signs , blood tests , and amount of transfusion at each occasion are shown in table 1 . after giving the appropriate amount of transfusion to maintain maternal circulatory status , uae was safely completed , hemostat was confirmed by the angiography and also vaginal inspection ( fig . bleeding was recognized after 1 hour of uae , leading us to decide to perform hysterectomy . the patient recovered smoothly after the hysterectomy , and she left the hospital on the 17th day . although we observed only one gelatin sponge particle in 16 slices of uncoagulated uterus , there was no thrombotic reaction around the particle ( fig . this report has shown the pathological findings in a case of failed uae for placenta previa complicating hypovolemic shock with disseminated intravascular coagulation ( dic ) . success rates of uae for postpartum bleeding have been reported to be over 90%.16 however , some reports have shown lower success rates of uae in cases of abnormal placentation , uterine myometrial injury due to placenta accreta and delayed catheterization.5 despite the fact that we easily and completely separated the placenta and performed uae immediately , continuous effect of hemostatic embolization was not observed . hypovolemic shock caused by postpartum hemorrhage immediately induces vasoconstriction in peripheral vessels.7 moreover , one of the vascular characteristics observed during interventional radiology is arterial spasm caused by insertion of the catheter.4 these circumstances might strongly affect the behavior of the uterine arteries and disturb the visualization of contrast extravasation by angiography , suggesting shortening of the arterial diameter . from this point of view 1 ) . the presence of dic would interfere with coagulant effects of gelatin sponge in this case . in addition , normalization of the vital signs owing to transiently effective transfusion would result in dilation of the arterial diameter , leading to washout of the gelatin sponge to the uterine cavity . it is reported that particles would be found in almost all uterine tissue specimens of post - uae cases.8 our speculation would be supported by the fact that almost no gelatin sponge was found in the removed uterine specimen . in severe coagulopathic condition where we should refrain from adding more stress such as hysterectomy , n - butyl cyanoacrylate ( nbca ) may be one management strategy option , if the patient does not wish further pregnancy . nbca acts as permanent embolic material and has immediate self - coagulant effects without interference of dic.9,10 in conclusion , this case strongly supports the mechanisms that might interfere with the hemostatic process in the effect of gelatin sponge in cases complicated with vital shock and disseminated intravascular coagulation . | the reported success rate of uterine artery embolization ( uae ) for obstetrical hemorrhage is more than 90% .
we experienced a case of failed uae for postpartum hemorrhage , although an embolic particle was found pathologically in the uterine vessels without coagulation . a 42-year - old woman ( gravida 7 , para
2 ) with placenta previa had genital bleeding at 35 weeks of gestation , and cesarean section was performed .
we immediately added uae aiming to reduce massive bleeding after the cesarean section , successful embolization of the bilateral uterine arteries and internal iliac arteries were confirmed by angiography regardless the vital sign was recovered with an appropriate amount of transfusion ; the massive bleeding recurred after 1 hour of uae .
hysterectomy was performed and pathological findings of the uterus showed that there was no coagulation in the vessels , which was supposed to be observed by the effect of gelatin sponge .
in addition , despite the fact that no coagulation was found , only one gelatin sponge was found in 16 slices of the uterine wall specimens .
we speculate that thrombotic materials were caught in vasoconstricted vessels triggered by hypovolemic shock due to acute blood loss , and then the gelatin sponge could be washed out after recovering to normalized circulation status leading to recurrent massive hemorrhage . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
drosophila exhibits complex mating behavior with frequent wing vibration and copulation attempts by males . the successful mating is achieved by communications between males and females using chemical , acoustic , and visual signals ( reviewed in ) . subtle differences in these signals may accumulate during or after the formation of reproductive isolation . once reproduction isolation is established to a certain extent , the correct mate recognition is essential to avoid costly hybridization and wasting time on unsuccessful courtship . indeed , a certain degree of premating isolation or mating incompatibility is commonly observed between closely related species of drosophila [ 2 , 3 ] . in some cosmopolitan species of drosophila , for example , d. ananassae and d. elegans [ 5 , 6 ] , widely observed mating incompatibilities between populations from different locations exist . another cosmopolitan species , d. melanogaster , also harbors incompatible combinations of populations [ 711 ] . the degree of incompatibility between populations is also variable , and many intermediate strains are typically observed . these within species incompatibilities suggest that there are many intraspecific variations in mating signals and preferences . those variations could either fix in isolated populations or become targets of sexual selection under some conditions and consequently result in divergent mating - associated characters among different populations . it is important to understand the precise features of such variations in signals and perceptions that could potentially lead to an incipient speciation . cuticular hydrocarbons are known to play an important role as a contact pheromone in drosophila mate recognition ( reviewed in [ 12 , 13 ] ) . they are used to recognize conspecific mate [ 1416 ] , as well as to distinguish sex [ 1719 ] and to evaluate the mating history of the females by males [ 2022 ] . in d. melanogaster , many studies have shown that some female specific long chain hydrocarbons , especially c27 dienes , are attractive substances for males , and some of the male components , cis - vaccenyl acetate ( cva ) and 7-tricosene ( 7:c23 ) , are shown to reduce the female attractiveness [ 12 , 13 ] . pheromone - free females were courted by males more rigorously than wild - type females [ 16 , 23 ] , which highlights the importance of both attractive and inhibitory components for the courtship induction . the quantity of each cuticular hyrdrocarbon component varies among closely related species of d. melanogaster and even within this species . also , the profile could be modified by different food conditions as shown in cactophilic d. mojavensis . therefore , making correct decisions based on variable contents of cuticular hydrocarbons may not be a trivial task . thus , the differential sensitivity to different hydrocarbon components may evolve relatively fast and could be a source of variations for differential mate choice . in this study , we analyze within - species variations in mate preference using d. melanogaster , whose mating - associated characters and their genetic bases are extensively studied . we particularly focus on one combination of conspecific strains that show low mating frequency , and investigate the role of cuticular hydrocarbon on this intraspecific mating incompatibility . also , by comparing gas chromatograms of different strains , we attempt to identify candidate components in female cuticular hydrocarbon that have an inhibitory effect on mating . five d. melanogaster inbred strains , 4 d. simulans inbred strains , and 3 d. simulans isofemale lines were used in this study . mel6(g59 ) , tw1(g23 ) , ky02001(g20 ) , bz1(g23 ) , and vav1(g15 ) are wild - derived d. melanogaster inbred strains originated from benin ( west africa ) , taiwan , japan , brazil , and tonga , respectively [ 3032 ] . w86(g15 ) , sim ch1(g65 ) , sim 5(g69 ) , and sey4(g51 ) are wild - derived d. simulans inbred strains originated from madagascar , usa . , congo , and seycheleis islands , respectively . numbers in the parentheses indicate numbers of generations sibmated in the laboratory . s2 is a d. simulans isofemale line from japan , which has been reported to be highly crossable to d. melanogaster . mel7 and mel8 are d. simulans isofemale lines originated from benin ( west africa ) . flies were fed with regular sugar - yeast food and cultured at 2325c under a natural laboratory light condition . interspecific no - choice mating experiment was conducted by placing females and males of different species together in a test vial . unmated females and males were collected after lightly anesthetized with co2 and were used 2 days after eclosion . ten females from one species and 10 males from another species were put into a test vial ( 2.7 cm diameter 10 cm height ) filled with ~2.5 cm food at the bottom and capped with a sponge plug . the females were dissected after 24 hours to score the presence or absence of sperm in the spermatheca and/or seminal duct . up to 2 occasional losses of samples all the mating tests were done in the morning hours in a room temperature ( ~23c ) under a natural laboratory light condition . double - choice mating experiment was conducted by placing females and males from 2 different strains together in a test vial . unmated females and males were collected after lightly anesthetized with co2 and were used 4 days after eclosion . ten females and 5 males each from both strains were placed in a test vial ( 2.7 cm diameter 10 cm height ) filled with ~2.5 cm food at the bottom and capped with a sponge plug . the copulated pairs were aspirated out of the vial during the 3-hour test period and kept until the combinations of the mated strains were scored . the identification of strains was done using thoracic trident pigmentation intensity or abdominal pigmentation pattern . all the mating tests were done in the morning hours in a room temperature ( ~23c ) under a natural laboratory light condition . intraspecific no - choice mating experiment was conducted by placing one type of females and another type of males into a test vial . unmated females and males were collected after lightly anesthetized with co2 and were used 4 days after eclosion . ten females and 10 males were placed in a test vial ( 2.7 cm diameter 10 cm height ) filled with ~2.5 cm food at the bottom and capped with a sponge plug . the number of copulated pairs was counted by aspirating them out of the vial during the 1-hour test period . all the mating tests were done in the morning hours in a room temperature ( ~23c ) under a natural laboratory light condition . cuticular hydrocarbon transfer experiment was done by rub - off method as in coyne et al . . cuticular hydrocarbon was transferred from tw1 to mel6 by crowding 100 tw1 virgin females and 10 mel6 virgin females in a limited space ( 2.7 cm diameter 1 cm height ) of a food vial for 4 days . the efficient transfer of cuticular hydrocarbon by this method was confirmed by gas chromatography ( gc , data not shown ) . the control sets of females were obtained by crowding 110 mel6 virgin females in the same limited space for the same period of time . cuticular hydrocarbons were extracted from 4-day - old virgin females by n - hexane and analyzed by gas chromatography ( gc ) . cuticular hydrocarbons were extracted by washing 5 individuals in a glass culture tube with 500 l n - hexane for 5 min at room temperature . then , n - hexane solution was transferred to a glass spits tube and stored in 20c after the solvent was fully evaporated . immediately before gc analyses , 100 l n - hexane was added to the tube , and 2 l of the resultant solution ( equivalent to extract from ~0.1 individual ) was used for the analyses . gc analyses were performed with a shimazu gc-14a equipped with a db-1 apolar column ( length , 30 m ; diameter , 0.25 mm ; film thickness , 0.25 m ; agilent technology inc . ) and flame ionization detector . injection was made in splitless mode for 1 minute at 300c with a detector temperature of 300c . the oven was programmed to hold at 80c for 1 minute , and increased at 10c / minute to 320c , and held for 5 minutes . premating isolation among d. melanogaster sibling species is not complete . for example , a certain level of mating occurs between d. melanogaster and d. simulans in the laboratory . if there are slight intraspecific differences in visual , acoustic , or chemical signals during the mating and differences in perception and response to those signals , they would show up as differential mating frequencies to a closely related species . in order to unveil these differences , we surveyed mating frequencies between different strains of d. melanogaster and d. simulans . the experiments were done by interspecific no - choice design , which involves placing 10 females and 10 males from different species into a test vial . the mating frequencies were assessed by scoring the number of inseminated females after 24 hours . for each cross , 2 vials were tested each day for 2 days , which gave 4 replicate data in total . mating frequencies within 24 hours between the 2 species were not very high , but varied among strains ( figure 1 ) . among those interspecific crosses , most notable differences were found between tw1 and mel6 . tw1 females readily mated with males from most of the d. simulans strains tested ( figure 1(a ) ) , whereas females from mel6 as well as those from vav1 rarely mated with males from d. simulans strains . tw1 males also mated frequently with females from many of the d. simulans strains tested ( figure 1(b ) ) , but mel6 males seldom mated with d. simulans females . the mating patterns in most of other strains fell in between those two strains ( figures 1(a ) and 1(b ) ) . by the same experimental setting with 10 females and 10 males in each of the two test vials , 18 ( 90% ) out of 20 mel6 females mated with mel6 males and 16 ( 84% ) out of 19 tw1 females mated with tw1 males within 2 hours . the results indicated that individuals from mel6 strain mated readily with individuals from their own strain but seemed to avoid mating with d. simulans . taken together , these results indicated that tw1 and mel6 indeed have differential mating signals or responses to those signals or both . we also noticed during the experiments that mel6 males rarely exhibited courtship behavior to d. simulans females when placed together in a same vial . this observation suggested that the male mate preference could be different between tw1 and mel6 . since frequencies of successful mating with d. simulans differed between tw1 and mel6 , we suspected that the difference in mate preference may affect the mating between the two strains . in order to investigate whether the mating occurs randomly between the two strains , we first conducted mate choice experiment by double - choice design , which involves placing females and males from both strains together in a test vial ( figure 2(a ) ) . as we suspected , the mating pattern deviated from random choice ( figure 2(b ) , cochran - mantel - haenszel exact test ( p < 10 ) , and indicated that the mating between tw1 female and mel6 male occurred at a very low frequency . together with the observation that mel6 males rarely courted d. simulans females , we decided to focus our attention to mate preference by mel6 male . first , the no - choice design was adopted , where only one type of females and one type of males were placed together in a mating vial ( figure 2(a ) ) . the result showed that even by the no - choice experiment , the number of matings occurred within 1 hour between tw1 females and mel6 males remained to be very small compared to that between mel6 females and males ( figure 2(c ) ) . the low frequency mating between tw1 and mel6 could be due to either male refusal or female rejection . in order to ask if there is mel6 male refusal of tw1 female , we conducted the no - choice experiment by mel6 female perfumed with cuticular hydrocarbons of tw1 female . cuticular hydrocarbons can be transferred to other females by crowding the flies with the donor flies . in order to see if cuticular hydrocarbons of tw1 have an inhibitory effect on mating , they were transferred to mel6 females before conducting no - choice experiment . the experiment showed that mel6 females coated with cuticular hydrocarbons from tw1 females mated less frequently with mel6 males compared to the control mel6 females ( figure 2(d ) ) . this indicated that cuticular hydrocarbons of tw1 females have an inhibitory effect on mel6 male mating behavior . we then compared the profiles of cuticular hydrocarbon components between the two strains by gc ( figure 3 ) . the identities of the corresponding cuticular hydrocarbon components of the peaks were inferred from the previous studies [ 28 , 29 ] . the peaks , which showed qualitative differences ( presence / absence or extreme high / low ) between the two strains , were marked by numbers in figure 3 . their relative quantities ( % area of the peaks ) are shown in table 1 . inseparable peaks and peaks with less than 2% of the whole peak area were not included in the comparison . mel6 females had a relatively simple content of cuticular hydrocarbons with almost no trace of peaks in the c23 group ( around peaks # 1 and # 2 ) , whereas the overall complexity of the tw1 female profile was similar to the typical wild type strains of d. melanogaster [ 12 , 25 ] . the cuticular hydrocarbon profile of mel6 females resembled that of tai y strain originated also from west africa ( ivory coast ) with only traces of c23 hydrocarbons [ 12 , 25 ] . the peaks # 5 and # 6 were inferred to be 7,11:c27 and 5,9:c27 , respectively . however , 5,9:c27 peak is likely to be confounded with comigrating 2-methyl - hexacosane [ 24 , 34 ] . the polymorphism in the ratio of these two c27 dienes has been well documented in the worldwide samples of d. melanogaster [ 24 , 34 , 35 ] . although there is an association of desat2 genotype , which is responsible for the polymorphism , with a sexual isolation between zimbabwe and cosmopolitan populations of this species , this polymorphism does not seem to induce assortative mating pattern in general . next , we used two other types of females with different cuticular hydrocarbon profiles to test how mate preference of mel6 males changes ( figure 4 ) . mel6 males did not discriminate between mel6 and bz1 females , which showed similar cuticular hydrocarbon profiles to tw1 females in peaks # 16 except a smaller peak in peak # 3 ( figures 4(a ) and 4(c ) , table 1 ) . we also tested f1 females from mel6 tw1 cross , which also showed a smaller peak in peak # 3 compared to that of tw1 female , and intermediate height peaks of # 5 and # 6 ( figures 4(b ) and 4(d ) , table 1 ) . mel6 males clearly favored these f1 females over tw1 females ( figure 4(b ) ) , which gave a mating pattern similar to figure 2(b ) . previously known polymorphism in the ratio of 7,11:c27 ( peak # 5 ) and 5,9:c27 ( peak # 6 ) does not seem to affect the mate preference of mel6 males . taken together , these comparisons are consistent with the notion that the component in the tw1 female cuticular hydrocarbon , which has an inhibitory effect on mating with mel6 males , is in the peak # 3 . the component of this peak is likely to be a c25 diene and is inferred to be 7,11:c25 from the previous literatures [ 28 , 29 ] . in order to ask how general is this mate discrimination of mel6 males against tw1 females , we tested 2 other strains originated from the same collection point of mel6 in west africa ( mel7 and mel8 ) and strains from brazil ( bz1 ) and tonga ( vav1 ) to investigate whether their males show nonrandom mate choice between mel6 and tw1 females . in order to avoid the effect of other preference factors , the male mel6 was substituted by the test strain male in the double - choice experiment identical to figures 2(a ) and 2(b ) . the results in figure 5 indicated that males from two other strains originated from the same collection site as mel6 in west africa mated more with mel6 females than with tw1 females ( figures 5(a ) and 5(b ) ) giving the similar pattern as in figure 2(b ) , whereas strains from brazil ( bz1 ) and tonga ( vav1 ) did not show a clear refusal of mating with tw1 females ( figures 5(c ) and 5(d ) ) . these patterns suggest that mel6-type mate discrimination is endemic to individuals from its collection site in west africa . in order to analyze within species variations in mate preference , we first performed a survey of mating frequency between different strains of d. melanogaster and its sibling species , d. simulans . crossability between these two species has been reported to be asymmetric ; d. melanogaster females mate relatively easily with d. simulans males , but the reciprocal cross is more difficult [ 37 , 38 ] . our results did not follow this pattern ( figure 1 ) . not many d. melanogaster females mated with d. simulans males except those of tw1 ( figure 1(a ) ) . in the reciprocal cross , in addition to s2 that has been documented as a highly crossable strain to d. melanogaster males , there was another strain w86 from madagascar that mated well with d. simulans males ( figure 1(b ) ) . our results suggest that the asymmetry in crossability may depend highly on the strains tested . what was more notable in our survey was that the crossability between the two sibling species was highly variable among strains ( figure 1 ) , which indicated that the signals presented by either or both sexes and the perception and response to those signals are not completely fixed within each species . these intraspecific variations may have become more apparent in our survey using inbred strains ( except s2 ) , because some of the recessive alleles that affect those traits may have become homozygous during the inbreeding process . this inbreeding effect may have affected the asymmetry in interspecific crossability to some extent as well . because of the differential mating frequencies of tw1 and mel6 against d. simulans strains ( figure 1 ) , we predicted that their differences in courtship signals and perceptions may cause partial incompatibility between these strains . as predicted , low mating frequency between tw1 females and mel6 males was observed ( figures 2(b ) and 2(c ) ) . mel6 males were choosy in both interspecific and intraspecific crosses . the factors responsible for the low mating frequency between tw1 females and mel6 males turned out to be a difference in cuticular hydrocarbon component and its perception . since c25 dienes are not reported in the cuticular hydrocarbons of d. simulans females , different factors may be responsible for the interspecific mating frequency differences between these two strains . it is certainly of our interest to identify the factors involved in differential mate preferences against interspecific individuals . there are several cases of partial incompatibility in mating between strains or populations of d. melanogaster . one is between populations from zimbabwe ( z ) and cosmopolitan ( m ) areas , in which case there is a strong behavior incompatibility between z females and m males . tw1 female - mel6 male incompatibility is not part of this z - m system , because the compatibility in the former is between a non - african female and an african male , which is opposite of the latter . similarly , us and caribbean populations exhibit partial incompatibility [ 10 , 11 ] and there are also cases reported in brazzaville , congo and at the evolution canyon in israel where two closely located populations show certain amount of premating isolation . to determine whether our observation of mating incompatibility between tw1 and mel6 is another case of interpopulational sexual isolation or not , we should await a larger survey of strains , especially since we currently have found only one tw1 type strain . however , our study demonstrates that a single cue , a particular cuticular hydrocarbon blend , could produce differential responses of males from different strains within d. melanogaster . the cuticular hydrocarbon transfer experiment showed that it is not the female rejection , but the male refusal of females , which brings about the reduced mating frequency between tw1 females and mel6 males ( figure 2(d ) ) . it is generally thought that females drive sexual isolation in drosophila , because males are observed to court females largely indiscriminately while females seem to be able to effectively reject unpreferable males . however , our experiment clearly indicated that , in some cases , males actually do choose females according to the cuticular hydrocarbon profiles of females . this is not surprising since it is known that the female cuticular hydrocarbons contain components that exhibit both stimulatory and inhibitory effect on mating [ 16 , 23 , 24 ] . a known inhibitory sex pheromone for d. melanogaster males , 7-tricosene , is predominant in male cuticular hydrocarbon and perceived as a bitter stimulus for the males . this molecule is at a normal quantity in tw1 females ( peak # 1 , table 1 ) . our interpretation that cuticular hydrocarbons of tw1 contain inhibitory factors instead of lacking stimulatory components comes from the fact that the only detectable peaks that had higher quantity in mel6 were peaks # 4 and # 6 ( figure 3 ) and that both peaks were not present in bz1 females that mated well with mel6 males ( figure 4(a ) , table 1 ) . however , a subtle balance between the quantities of excitatory and inhibitory components may be critical for the decision making by males . future assays using purified hydrocarbons should elucidate the combined effects of different components . under the assumption that cuticular hydrocarbon blend from tw1 female has inhibitory effect on mating in mel6 males , we identified a candidate cuticular hydrocarbon component , a c25 diene , that has a deterrent effect on mel6 males . the component is inferred to be 7,11:c25 from the previous literature [ 28 , 29 ] . a large increase in 7,11:c25 ( + 13.2% of the total hydrocarbon amount ) was reported as a consequence of an rnai knockdown of an elongase gene , elof , in d. melanogaster female . this observation is consistent with our conclusion that 7,11:c25 may serve as an inhibitory effect on the mate recognition of males . we should note that elof knockdown females also showed marked decrease in 7,11:c29 , which was not apparent in tw1 females ( figure 3 ) . males from 3 strains originated from benin ( west africa ) , mel6 , mel7 , and mel8 , did not readily mate with tw1 females , whereas 2 other strains from outside africa showed no such discrimination ( figures 2 and 5 ) . the cuticular hydrocarbon profiles of mel6 ( figure 3 ) , and another isofemale line from west africa , tai y , were similar with only traces of c23 hydrocarbons [ 12 , 25 ] . females of mel7 showed a similar profile to that of mel6 as well ( data not shown ) . these observations suggest that d. melanogaster in regions of west africa may have different sensitivity or response to chemicals on the female cuticles . there are some identified olfactory and gustatory receptors mediating male courtship behavior in response to sex pheromones [ 4044 ] . the differential expression of these receptors among males from different strains could be a cause of the differential mate choice . courtship behavior is affected by conditioning prior to courtship ; unsuccessful courtship reduces subsequent courtship in males [ 45 , 46 ] . it has been shown that flies can have memory of at least one cuticular hydrocarbon component , cis - vaccenyl acetate , during the conditioning . in our experiments , males were kept in groups prior to the mating experiments , which may have affected the memories of unsuccessful male - male courtship . however , an elevated level of the c25 diene was not observed in mel6 nor tw1 males ( data not shown ) , which suggests that there was no differential learning associated with the candidate inhibitory factor . our study was the first case to suggest that a c25 diene produced by a wild - derived strain has an inhibitory effect on mating behavior of males and to show that the sensitivity to this chemical varies among strains . further investigation of the precise mechanisms and genetics underlying these intraspecific variations may help entangle the evolution of complex intersexual communication and mating behavior in flies . | intraspecific variation in mating signals and preferences can be a potential source of incipient speciation .
variable crossability between drosophila melanogaster and d. simulans among different strains suggested the abundance of such variations .
a particular focus on one combination of d. melanogaster strains , tw1(g23 ) and mel6(g59 ) , that showed different crossabilities to d. simulans , revealed that the mating between females from the former and males from the latter occurs at low frequency .
the cuticular hydrocarbon transfer experiment indicated that cuticular hydrocarbons of tw1 females have an inhibitory effect on courtship by mel6 males .
a candidate component , a c25 diene , was inferred from the gas chromatography analyses .
the intensity of male refusal of tw1 females was variable among different strains of d. melanogaster , which suggested the presence of variation in sensitivity to different chemicals on the cuticle .
such variation could be a potential factor for the establishment of premating isolation under some conditions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
collapsing glomerulopathy ( cg ) is being increasingly recognized as a cause of end - stage renal disease . it is currently classified as one of the pathological variants of focal segmental glomerulosclerosis ( fsgs ) . the exact cause of this lesion is still not known , but the list of associated genetic and acquired diseases has been growing . cg is characterized by focal to diffuse , segmental to global , implosive collapse of the glomerular capillary tufts associated with marked proliferation and swelling of overlying podocytes resulting in the formation of pseudo crescents on light microscopy . immunofluorescence study is usually negative or shows only focal segmental positivity of immunoglobulin m ( igm ) , c3 and occasionally c1q . electron microscopy shows collapse and wrinkling of glomerular basement membrane ( gbm ) and greatly hypertrophied overlying podocytes with diffuse foot process effacement . cg associated with certain infections such as human immunodeficiency virus ( hiv)-1 infection , parvovirus b19 , cytomegalovirus ( cmv ) infection , human t - cell lymphotropic virus-1 , hepatitis c virus ( hcv ) , leishmaniasis and febrile illness has been documented . a 40-year - old man with diabetes and hypertension for 5 years presented with prolonged fever , cough and hemoptysis for 6 weeks duration and anasarca with breathlessness and oliguria ( urine output < 200 ml / day ) of 2 weeks duration . he denied smoking , alcohol consumption and intravenous ( iv ) drug abuse . on clinical examination , he was febrile , pale , edematous , tachypneic ( respiration rate 26/min ) , tachycardic ( pulse rate 104 bpm ) and hypertensive ( blood pressure 160/100 mmhg ) with absent diabetic retinopathy . he had few crepitations and cavernous type of bronchial breath sounds in the infraclavicular and axillary region of the right lung . urine analysis showed protein 3 + , blood 3 + and pus cells 1 - 2/hpf . complete blood count revealed a total white cell count of 10400/mm ( polymorphs 58% , lymphocytes 36% , others 6% ) , hemoglobin of 8.3 g / dl and a platelet count of 3.69 lakhs / mm . serum urea was 124 mg / dl , and creatinine was 6.4 mg / dl . his fasting lipid profile was deranged with elevated total cholesterol ( 369 mg / dl ) and triglyceride ( 542 mg / dl ) . liver tests showed normal bilirubin and transaminase levels with low total protein ( 4.9 g / dl ) and albumin ( 2.0 g / dl ) levels . anti - nuclear antibodies , anti - neutrophil cytoplasm antibodies , anti - gbm antibody tests were negative . after stabilizing him with three hemodialysis sessions , renal biopsy was performed . on light microscopy , 6 out of 9 glomeruli showed the collapse of capillary tuft with florid hyperplasia of the overlying podocytes [ figure 1 ] . tubular epithelial cells showed signs of acute injury , interstitial edema with inflammatory cell infiltrate . immunofluorescence microscopy was negative for antisera to igg , igm , iga , c3 , c1q , kappa , and lambda light chains . some podocytes contain protein resorption droplets , a common finding in collapsing lesion ( pas , 400 ) occasional microcystically dilated tubules containing proteinaceous casts were seen in the edematous interstitium ( pas , 200 ) our patient presented with nephrotic proteinuria , severe renal failure , and sputum positive pulmonary tb . the absence of lambda and kappa light chains in the immunofluorescence of renal biopsy and normal serum protein electrophoretic pattern ruled out multiple myeloma . hence , after excluding all other possible causes , we surmise that the most probable cause of cg in our patient could be pulmonary tb . at present disturbance in the immune system , coupled with genetic susceptibility , likely contribute to the changes in glomerulus . coventry and shoemaker reported a case of cg in a 16-year - old girl who presented with steroid - resistant nephrotic syndrome and pulmonary tb . in the absence of the usual associations ( adult age group , african - american race , or history of iv drug abuse ) , this lends support to the hypothesis that immune dysregulation due to infection per se , rather than infection by specific viral agents , may lead to cg in susceptible individuals . rodrigues et al . reported an hiv - negative patient with tb - related cg who needed dialysis for 5 months but presented full renal recovery after tb treatment and corticotherapy . light microscopy picture of our patient showed podocyte hyperplasia with the collapse of glomerular tuft . the therapeutic approaches empirical and analogous to those used for noncollapsing fsgs , i.e. , use of steroids or immunosuppressive agents . our patient was started on category i anti - tuberculous treatment ( att ) as per directly observed treatment strategy and oral prednisolone 1 mg / kg / day . we stopped oral steroids after tapering at the end of 2 months as his blood sugars became uncontrollable with insulin . he became sputum negative for mycobacterium tb and dialysis - independent at the end of 2 months . his serum creatinine and 24 h urine protein were 3.4 mg / dl and 2 g / day during the last follow - up . long - term follow - up is needed to assess the progression of renal disease in this patient . | collapsing glomerulopathy ( cg ) usually presents with reduced glomerular filtration rate , heavy proteinuria and has unfavorable prognosis .
numerous associations with cg are found .
we encountered a case of cg associated with pulmonary tuberculosis presenting with proteinuria and dialysis - requiring severe renal failure .
our patient made partial recovery of his renal function and became dialysis - independent after antituberculous therapy and oral steroids .
long - term follow - up is needed to assess the progression of the disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
epithelial ovarian cancer is the leading cause of death from gynecologic cancers in western countries.1,2 most patients present with advanced disease ( ie , stage iii and iv ) , and are managed with surgical resection followed by platinum - based chemotherapy.3 during the past decade , advances in chemotherapy have resulted in improved survival and in more effective treatment of relapsed disease . however , five - year overall survival remains relatively low , at around 30%.4 the most important prognostic factors at primary diagnosis are international federation of gynecologists and obstetricians ( figo ) stage and complete resection of disease ( microscopic residual disease following primary surgery ) . the time point of relapse following the completion of chemotherapy defines the category of platinum sensitivity , ie , the longer the interval , the longer the duration of response likely to be achieved by platinum retreatment . patients whose disease responds to first - line therapy but relapses 12 months after completion of initial platinum - based therapy are considered to have platinum - sensitive disease . patients who relapse 612 months after primary therapy have intermediate or partial platinum - sensitive disease . patients who relapse shortly ( < six months ) after the completion of primary therapy , chemotherapy retreatment is an important aspect in the overall management of patients with platinum - sensitive relapse of recurrent ovarian cancer . platinum is the backbone of chemotherapy for patients with advanced ovarian cancer , and carboplatin and paclitaxel have emerged as standard in the first - line setting . this combination is also regarded as a valid option for rechallenge in patients with platinum - sensitive recurrent ovarian cancer . a pooled analysis of three phase iii trials from the arbeitsgemeinschaft gynakologische onkologie studiengruppe ovarialkarzinom and international collaborative ovarian neoplasm collaborators demonstrated significant improvements in progression - free survival and overall survival in patients with platinum - sensitive recurrent ovarian cancer treated with platinum - paclitaxel versus conventional , mainly single - agent , platinum - based therapies.5 however , rechallenge with carboplatin and paclitaxel has been limited by the risk of cumulative peripheral neuropathy . other carboplatin - based combinations , such as gemcitabine and carboplatin , have been explored with the aim of improving both efficacy and tolerability . carboplatin and gemcitabine significantly improved progression - free survival versus carboplatin alone in a phase iii trial ( hazards ratio [ hr ] 0.72 , p = 0.0031).6 overall survival , however , was not significantly improved ( hr 0.96 , p = 0.735 ) , although the trial was not powered to detect a survival difference . grade 34 hematologic toxicities were significantly more frequent in the combination arm . more recently , pujade - lauraine et al reported a phase iii trial comparing carboplatin and paclitaxel with carboplatin and pegylated liposomal doxorubicin ( pld ) in patients with ovarian carcinoma relapsing more than six months after first- or second - line platinum- and taxane - based therapy.7 in this trial , the largest in recurrent ovarian cancer , treatment with carboplatin and pld was associated with improved progression - free survival ( 11.3 versus 9.4 months , p = 0.005 ) and a favorable safety profile . treatment options for patients with partial platinum - sensitive disease ( six months platinum - free interval < 12 months ) include carboplatin - based doublets ( either with paclitaxel or gemcitabine ) , which achieve progression - free survival durations of approximately eight months,8 and pld.9 in this subset of patients , pld was shown to be superior to topotecan in terms of both progression - free survival and overall survival,10 although it has never been compared overall survival in patients with partial platinum - sensitive disease recurrence is approximately 1315 months . an emerging strategy in these patients is to artificially increase the platinum - free interval by using a nonplatinum - containing regimen upon relapse , with the aim of reversing platinum resistance.11 in patients with platinum - resistant or refractory recurrent ovarian cancer , treatment options are limited , and this patient subgroup has a poor prognosis . agents that can be considered include pld , topotecan , gemcitabine , paclitaxel , oral etoposide , and vinorelbine . because the reported response rate for each of these drugs is in the 10%20% range in patients with platinum - resistant disease , the choice is often driven by the side effect profile and the convenience of administration.12 topotecan and pld have been more extensively studied in this setting , and seem to provide some benefit in progression - free survival , although rarely associated with an improvement in overall survival . trabectedin ( et743 , yondelis ; pharmamar , madrid , spain ) , a tetrahydroisoquinoline alkaloid , is a natural product derived from the marine tunicate ecteinascidia turbinate . trabectedin ( et743 ) binds to the minor groove of dna and alkylates guanine at the n2 position , whereas most alkylating agents bind guanine at position n7 or o6 in the major groove . binding of trabectedin has been shown to be dna sequence - specific , with guanine - cytosine rich triplets more frequently bound.13 covalent binding of trabectedin induces dna bending towards the major groove and a widening of the dna minor groove.14 modification of the dna conformation leads to inhibition of activated transcription , while constitutive transcription seems unaffected.15 et743 has shown potent antitumor activity in pre - clinical studies both in vitro and in vivo in several solid tumors , including ovarian and breast cancer , melanoma , and sarcoma.16,17 these preclinical data have been confirmed in several phase ii trials in soft tissue sarcoma , and breast and ovarian carcinoma . trabectedin is approved in the european union and several other countries for the treatment of relapsed soft tissue sarcoma which has progressed despite previous treatment with anthracyclines and ifosfamide , or in those who are unable to receive these agents . it is also approved in the european union in combination with pld for the treatment of platinum - sensitive recurrent ovarian cancer . in addition , trabectedin holds orphan drug status for the treatment of advanced recurrent soft tissue sarcoma in the us , switzerland , and korea , and for the treatment of advanced recurrent ovarian cancer in the us and switzerland . trabectedin is under development for prostate cancer , breast cancer , and pediatric soft tissue sarcoma . several reports have underlined the importance of nucleotide - excision repair in the cytotoxicity of et743 , and more precisely the cell killing ability of this drug has been linked to transcription - coupled nucleotide - excision repair.13,14,18 the dna bending induced by the binding of trabectedin to the minor groove is detected by the transcription - coupled nucleotide - excision repair machinery , which in the repair process makes single - strand breaks on each side of the lesion.13 these breaks are then made irreversible by the dna - protein crosslinking capacities of trabectedin.19 recently herrero et al18 suggested a slightly different model based on their observations in the yeast model , schizosaccharomyces pompe . in this model , cells deficient for rad13 ( the yeast equivalent to human xpg , an endonuclease of the nucleotide - excision repair system ) , were resistant to trabectedin , while those with an inactive rad51 ( a protein of the homologous recombination repair pathway , involved in the repair of double - strand breaks ) were more sensitive to trabectedin than wild - type cells . based on these observations , herrero et al suggested the following sequence : trabectedin binds covalently to the dna minor groove , the resulting adduct is recognized by the nucleotide - excision repair machinery , and then the recruited rad13 ( xpg ) protein binds to dna and interacts with the minor groove - bound drug by means of an arginine residue located in the cooh terminus . other proteins of the nucleotide - excision repair machinery trying to repair the damage are then hijacked , forming larger , more toxic complexes . lastly , during the s phase , the aforementioned complexes give rise to double - strand dna breaks , explaining the sensitivity of cells deficient for homologous recombination repair pathway proteins three phase ii studies have investigated the activity of trabectedin in patients with recurrent advanced ovarian cancer ( tables 1 and 2 ) . based on preclinical data showing that trabectedin was active in xenograft models with low sensitivity to cisplatin or paclitaxel , sessa et al20 reported the results of a phase ii study of trabectedin in patients with ovarian cancer failing platinum- and taxane - based therapy . fifty - nine patients were enrolled and stratified according to platinum sensitivity , ie , 30 patients with platinum - resistant disease ( no change after at least four cycles of platinum or taxane , progressive disease after two cycles , or relapse within an interval of less than six months after discontinuation of chemotherapy ) and 29 patients with platinum - sensitive disease ( relapse after a progression - free interval of six months after completion of platinum - based chemotherapy ) . twenty - two ( 37% ) patients had received at least two prior lines of treatment . trabectedin was administered as a three - hour infusion every three weeks , initially given at the dose of 1650 g / m based on the recommended phase ii dose found in phase i trials . the dose in this study was subsequently decreased to 1500 g / m , and then to 1300 g / m , because of toxicity ( essentially liver toxicity ) . systemic antiemetic prophylaxis with intravenous 5-hydroxytryptamine-3 antagonists and 10 mg of dexamethasone intravenously was mandatory , and patients took 4 mg of dexamethasone bid for prophylaxis against liver toxicity . fifty - one patients were assessable according to recist ( response evaluation criteria in solid tumors ) criteria . the overall response rate in the 23 assessable patients with platinum - sensitive disease was 43.5% , ( one complete response lasting 8.7 months and nine partial responses ) and an additional nine patients had stable disease . median time to progression for patients who achieved a partial response was 7.9 months . in the platinum - resistant stratum , the overall response rate was 7% , and two of 28 patients achieved a partial response lasting 4.0 and 4.6 months . stable disease was achieved by eight additional patients ( 28.6% ) . at the higher dose level of 1650 g / m grade 4 elevation of liver transaminases , asthenia , and nausea and vomiting were seen in 83% , 82% , and 50% of patients . at the 1300 g / m dose level , two patients ( 3% ) in this study experienced febrile neutropenia ( one at the 1650 g / m dose level and the other at the 1300 g / m dose level).20 the results of the second phase ii trial of trabectedin in patients with ovarian carcinoma were reported by krasner et al.21 this study enrolled 147 patients who had received no more than two prior platinum - containing regimens . trabectedin was administered as a three - hour infusion weekly for three weeks of a four - week cycle at 580 g / m , after premedication by 10 mg of intravenous dexamethasone . one hundred and forty - one patients were evaluable by recist criteria , ie , 62 in the platinum - sensitive cohort ( defined as relapse after a disease - free interval six months from the end of the last platinum - based chemotherapy ) and 79 in the platinum - resistant cohort ( defined as disease progression < six months from the end of the last platinum - based treatment ) . the overall response rate ( by recist ) was 29% in the platinum - sensitive cohort ( four complete responses and 14 partial responses ) , and the median progression - free survival was 5.1 months . in the platinum - resistant cohort , the overall response rate was 6.3% ( five partial responses ) and the median progression - free survival was two months . toxicity was much more manageable than in the european phase ii study , as a result of the weekly schedule and the lower initial dose intensity delivered . nausea , vomiting , and fatigue were seen in 50%60% of patients . the most common grade 34 toxicities were elevated alanine transaminases ( 11% ) , neutropenia ( 6% ) , and nausea , vomiting , and fatigue ( 5% each ) . del campo et al reported on a randomized phase ii study comparing two schedules of trabectedin , ie , 1500 g / m over 24 hours every three weeks ( arm a ) and 1300 g / m over three hours every three weeks ( arm b ) , the primary endpoint being the response rate.22 patients received the recommended antiemetic prophylaxis with setron and dexamethasone . one hundred and eight patients were randomized between the two arms , and 107 received treatment . the intent to treat analysis showed comparable response rates between the two arms ( 38.9 in arm a , 35.8 in arm b , p = 0.8422 ) . likewise , the progression - free survival was similar in both arms ( 6.2 months in arm a , 6.8 months in arm b , p = 0.3127 ) suggesting that the two schedules have similar activity . the most common adverse events were nausea , vomiting , and fatigue , in most cases grade 1 or 2 . febrile neutropenia was seen in five patients ( 5% ) , and two patients died of possible drug - related adverse events . mcmeekin et al reported a pooled analysis of three phase ii studies , including 294 patients , in which three different schedules of administration were compared , one with 1300 g / m over three hours , one with 1500 g / m over 24 hours , both every three weeks , and one with 580 g / m weekly , for three weeks of a 28-day cycle.23 however , no significant differences in efficacy were seen between the two every three - week schedules , as was seen in patients with sarcoma.24 these two schedules were significantly superior to the weekly schedule , with a better response rate ( 33% versus 16% , p 0.0001 ) and longer median time to progression ( 5.8 months versus 2.8 months , p = 0.0001 ) . overall , these phase ii studies show that trabectedin has single - agent activity in patients with platinum - sensitive relapsed ovarian carcinoma , with a manageable toxicity profile . the activity of trabectedin in platinum - resistant disease seems more disappointing ( table 1 ) , with reported response rates lower than those reported for other agents currently available , such as pld , topotecan,9 or gemcitabine.25,26 several phase i trials of trabectedin - based combinations have been reported , and showed that trabectedin could be safely combined with doxorubicin,27,28 pld,29 gemcitabine,30 taxanes,31,32 and capecitabine.33 a recently published article has reported on a phase i trial investigating the combination of trabectedin and cisplatin.28 there is a strong preclinical rationale for this combination based on the mechanisms of action of both drugs which target different pathways of dna repair ( nucleotide excision repair for trabectedin and homologous recombination for cisplatin ) and on synergistic activity against human tumor xenografts . sessa et al conducted a phase i trial of trabectedin and cisplatin , both given on days 1 and 8 of a 21-day cycle.28 trabectedin was given as a three - hour infusion , starting at 300 g / m ( with 100 g / m increments ) , and cisplatin at a fixed dose of 40 mg / m . persistent neutropenia was the most common dose - limiting toxicity in this study , and several patients had not recovered from grade 3 neutropenia by day 35 . the recommended phase ii dose of trabectedin was 500 g / m on days 1 and 8 in pretreated patients and 600 g / m on days 1 and 8 in treatment - naive patients ( combined with cisplatin 40 mg / m on days 1 and 8) . although antitumor activity was seen with this combination , the results were lower than expected , especially in patients with ovarian carcinoma , and the response rate was comparable with that of single - agent trabectedin ( with limitations due to the small sample size of n = 13 ) . one of the hypotheses raised by the authors to explain these deceiving results is that the trabectedin dose intensity was insufficient due to prolonged dose delays.28 development of a three - week schedule was therefore suggested . however , it is noteworthy that these findings are in line with a previous phase i trial of a combination of trabectedin and carboplatin where hematologic toxicity precluded a dose increase of trabectedin beyond 800 g / m every three weeks and carboplatin beyond an area under the concentration - time curve ( auc ) of 4 mg / ml / min.34 other interesting candidates for combination with trabectedin in patients with ovarian cancer include gemcitabine , pld , and the taxanes . messersmith et al conducted a phase i trial exploring the combination of trabectedin and gemcitabine.30 both drugs were administered on days 1 , 8 , and 15 of a 28-day cycle . two dose levels were planned for gemcitabine ( 800 and 1000 mg / m ) and five were planned for trabectedin ( 300 , 400 , 475 , 535 , and 580 g / m ) . fifteen patients were enrolled , of whom five had sarcomas , three had non - small - cell lung cancer , two had colorectal cancer , and two had renal cell carcinoma . all patients but one were pretreated with chemotherapy and 12 patients had received at least two prior regimens . this study was terminated early because of an unacceptable frequency of dose adjustments due to hepatic toxicity . the dose - escalation scheme was stopped at level 3 ( trabectedin 400 g / m and gemcitabine 1000 mg / m ) where four of six patients required dose hold / cycle delay . overall cycle delays and dose holds were required in 11 ( of 15 ) patients , in most cases during the two first cycles and most often related to liver toxicity . dose - limiting toxicity was defined as any of the following during the first cycle : grade 4 neutropenia ( absolute neutrophil count < 500/ml ) for > five days ; febrile neutropenia ( absolute neutrophil count < 500/ml with fever [ body temperature 38.5c ] or sepsis ) ; thrombocytopenia ( platelets < 25,000/ml ) ; any grade 3 nonhematologic toxicity ( except nausea / vomiting and grade 3 transaminitis lasting < one week ) ; or delay of continuation of therapy > three weeks . no dose - limiting toxicities were seen in any of the cohorts . the most frequently reported grade 3 or 4 although the study was terminated without reaching the maximum tolerated dose , toxicity appeared potentially manageable without evidence of a significant pharmacokinetic interaction with this combination . no objective response was noted , but two patients in this study had stable disease for more than six months . the recommended dose for future trials investigating this combination was trabectedin 400 g / m combined with gemcitabine 1000 mg / m weekly for three weeks every four weeks . von mehren et al conducted a phase i study to assess the maximum tolerated dose , safety , and potential pharmacokinetic interactions of trabectedin in combination with pld.29 thirty - six patients with normal liver function , prior doxorubicin exposure < 250 mg / m , and normal cardiac function were enrolled . a broad range of advanced malignancies was represented , the most common being sarcoma ( n = 16 ) , ovarian cancer ( n = 4 ) , and pancreatic cancer ( n = 2 ) . twenty - seven patients ( 75% ) were pretreated with chemotherapy , with a median of three prior regimens . pld was administered at the dose of 30 mg / m with a one - hour infusion , and followed immediately by one of six trabectedin doses ( 400 , 600 , 750 , 900 , 1100 , and 1300 g / m ) infused over three hours and repeated every 21 days . all patients received dexamethasone 4 mg / day orally on the day before chemotherapy and on days 2 and 3 of each cycle , as well as 20 mg intravenously on day 1 . dose - limiting toxicity was defined as the following during cycle 1 : an absolute neutrophil count < 500/ml for > five days or with fever or sepsis ; platelet count < 25,000/ml ; any grade 3 or 4 nonhematologic toxicity ( except for nausea / vomiting despite appropriate antiemetic treatment or grade 3 transaminase elevations lasting < one week ) ; or a delay of therapy for > three weeks . the maximum tolerated dose was pld 30 mg / m + trabectedin 1100 g / m . dose - limiting toxicities occurred in two patients in the 1300 g / m cohort during cycle 1 , consisting of grade 3 or 4 transaminase elevations lasting > seven days . the most frequent grade 3 or 4 drug - related events were alanine transaminase elevations ( 31% ) and neutropenia ( 31% ) . post - treatment liver biopsies were carried out in eight patients who had elevations in liver function tests , and nonalcoholic steatohepatitis was present in seven of eight biopsies . six patients had an asymptomatic reduction of left ventricular ejection fraction of 20% versus baseline . only one of these six patients had received a prior anthracycline - based regimen , although all six had a cumulative exposure to anthracyclines of 300 mg / m ( range 365690 mg / m ) when noted to have a change in the left ventricular ejection fraction . finally , one complete response and five partial responses ( overall response rate 16.7% ) were seen and 14 patients had stable disease . the majority of responses occurred in the 1100 g / m and the 1300 g / m cohorts . overall , these data show that trabectedin combined with pld is feasible with encouraging activity . the regimen comprising pld 30 mg / m plus trabectedin 1100 g / m was selected for a phase iii trial comparing pld alone with pld plus trabectedin in patients with advanced ovarian cancer failing one prior platinum - based regimen . von mehren et al reported the results of a phase i trial of docetaxel 60 mg / m combined with trabectedin as a three - hour infusion on day one of a three - week cycle.31 six dose levels ( 400 g / m through to 1300 g / m ) and two independent cohorts , ie , restricted ( one prior regimen ) and unrestricted ( no limits as to the number of previous regimens ) were planned . five patients developed dose - limiting toxicity at the 600 g / m dose level , ie , grade iv neutropenia and/or febrile neutropenia requiring institution of prophylactic filgrastim . after institution of filgrastim , only one dose - limiting toxicity ( fatigue ) was observed at the 1300 g / m dose level . the most frequent grade 12 adverse events were fatigue ( 68% ) , nausea ( 58% ) , and neutropenia ( 53% ) . preliminary data suggest activity for this combination in patients with advanced cancer , with one patient achieving a complete response and 17 maintaining prolonged stable disease . a subsequent phase ii trial in patients with recurrent ovarian cancer used doses of 60 mg / m for docetaxel and 1100 g / m of trabectedin given every three weeks . in the preliminary report of this trial , the response rate was 30% , and the median progression - free survival and overall survival were 4.4 months and 12.5 months , respectively.35 in their phase i study , chu et al administered escalating doses of paclitaxel ( 80120 mg / m ) over one hour on day 1 and trabectedin ( 525775 g / m ) as a three - hour infusion on day 2 every two weeks.32 twenty - nine patients were enrolled , including 23 patients with soft tissue sarcoma , and 27 patients were evaluable . two doses were planned for paclitaxel ( 80 mg / m or 120 mg / m ) and four doses for trabectedin ( 525 , 580 , 650 , or 775 g / m ) , and five schedules were tested . there were four dose - limiting toxicities due to neutropenia delaying therapy for more than one week , two of which occurred on paclitaxel 120 mg / m + trabectedin 775 g / m . therefore , the recommended dose was paclitaxel 120 mg / m + trabectedin 650 g / m . the most common toxicities were neutropenia ( 24% ) , nausea ( 51% ) , vomiting ( 24% ) , transaminitis ( 23% ) , myalgia ( 24% ) , and alopecia ( 20% ) . evidence of antitumor activity and clinical benefit was seen , with one patient who had a primitive neuroectodermal tumor showing an ongoing complete response at 19 + months , one patient with breast cancer ( prior paclitaxel failure ) having an unconfirmed partial response , and eight patients having stable disease for more than three months . based on the activity of both pld and trabectedin in patients with relapsed ovarian carcinoma , together with a favorable safety profile described in phase i investigations , a phase iii trial comparing a combination of pld and trabectedin with pld alone in patients with recurrent ovarian cancer was initiated . six hundred and seventy - two patients progressing after initial response to first - line platinum - based therapy and with measurable disease were randomized to a combination of pld 30 mg / m over 60 minutes and trabectedin 1100 g / m over three hours every 21 days ( pld + t , with 10 mg intravenous dexamethasone 30 minutes prior to trabectedin infusion ) or standard pld 50 mg / m once every four weeks . patients experiencing disease progression during platinum - based front - line therapy were excluded.36 progression - free survival was the primary study endpoint and was assessed by independent radiologic review . baseline characteristics were comparable between arms , ie , median age was 57 years , 421 patients ( 63% ) had platinum - sensitive disease ( platinum - free interval for more than six months ) . the median number of cycles was five for pld and six for pld + t. median progression - free survival for the combination arm was 7.3 months ( 95% ci 5.97.9 ) and 5.8 months ( 95% ci 5.57.1 ) for single - agent pld ( hr = 0.79 , p = 0.019 ) . for patients with platinum - sensitive disease ( platinum - free interval more than six months ) , the median progression - free survival was 9.2 months ( 95% ci 7.411.1 ) for the combination arm versus 7.5 months ( 95% ci 7.09.2 ) for pld alone ( hr 0.73 , p = 0.017 ) . objective response rate for all patients was 28% versus 19% ( p = 0.008 ) and 35% versus 23% ( p = 0.0042 ) for patients with platinum - sensitive disease . in the platinum - resistant subgroup , there was no benefit in progression - free survival ( 4.0 versus 3.7 months for pld + t and pld , respectively ) nor in response rate ( overall response rate 16% versus 15% for pld + t and pld , respectively ) . there was no overall survival difference between the two arms , ie , 20.5 months for pld + t versus 19.4 months for pld alone ( hr 0.85 , p = 0.15 ) . however , follow - up was insufficient at the time of reporting . sixteen percent of patients in the combination arm and 10% in the single - agent pld arm discontinued treatment because of adverse events . grade 3 and grade 4 adverse events included neutropenia ( 63% versus 22% ) , elevated alanine transaminase ( 31% versus 1% ) , and hand - foot syndrome ( 4% versus 20% ) for pld + t versus pld alone , respectively . on the basis of these results , the authors concluded the superior efficacy the pld + t combination , which also demonstrates competitive efficacy compared with previously described platinum - based combinations in patients with platinum - sensitive relapsed ovarian cancer . despite these conclusions , the fda denied approval for the combination of trabectedin and pld in patients with relapsed ovarian carcinoma . one of the reasons was that the fda panel felt that the six - week benefit in progression - free survival shown in this trial did not justify approval of the drug . progression - free survival has not been proven to be a valid surrogate for overall survival in patients with relapsed ovarian cancer , and the increment itself is relatively low given the added toxicity . furthermore , although pld is an option in patients with relapsed platinum - sensitive disease , platinum - based therapy may be regarded as the preferred treatment in this patient subgroup . therefore , given the fact that this study included a majority of patients with platinum - sensitive disease , the validity of the comparator may be questioned . another point of discussion is the lack of benefit in patients with platinum - resistant disease , although this is in line with previous data showing that trabectedin has little efficacy in this patient subgroup.2022 finally , there was an increase in the rate of nonfatal congestive heart failure - related events in the trabectedin group ( six events for pld + t versus one for pld alone).36 interestingly , a subgroup analysis of this study , reported at the 2010 asco meeting , suggested that patients with partial platinum - sensitive disease may benefit the most from this combination.37 indeed , 214 patients in this trial had partial platinum - sensitive disease . in this subgroup , the median progression - free survival was 7.4 months for patients treated in the combination arm ( t + pld ) versus 5.5 months for patients treated with pld alone . furthermore , this benefit translated into an overall survival advantage of 3.5 months ( 20.7 versus 17.2 , p = 0.009 ) . first , because there was no crossover in this study , one can not rule out that giving sequential single - agent pld followed by trabectedin at progression may be as or even more effective than the combination . second , we still need more follow - up to assess overall survival in the whole cohort . in another subgroup analysis of this trial , investigators sought to identify predictive factors for patients receiving trabectedin.38 this study focused on proteins of the nucleotide - excision repair and homologous recombination repair pathways because these pathways are important for trabectedin activity in vitro . the markers studies included ercc1 , xpg ( both part of the nucleotide - excision repair machinery ) , and brca1 ( homologous recombination repair pathway ) , and their expression was studied using real - time polymerase chain reaction on prechemotherapy tumor blocks . patients with low brca1 mrna levels had significantly longer overall survival ( p = 0.0297 ) and progression - free survival ( p = 0.0427 ) than those with high brca1 levels , thereby confirming the prognostic value of brca1 expression in patients with ovarian carcinoma.39 a trend ( p = 0.0765 ) for longer overall survival ( but not progression - free survival ) was found for patients with high ercc1 expression levels . no significant differences in progression - free survival or overall survival emerged for low or high xpd expression levels . no significant differences in progression - free survival or overall survival were observed with the combined expression of brca1 and ercc1 . caveats of these analyses include low numbers of patients with samples available and/or of adequate quality ( 139 of 672 patients , 20% ) , prior platinum - based therapy in all patients ( and 80% prior taxanes ) which might have modified the tumor rna expression levels . several agents are currently in development in ovarian cancer , and can be grouped into three classes , ie , antiangiogenic agents , cell surface - targeted agents , and poly - adenosine triphosphate ( adp ) ribose polymerase inhibitor . bevacizumab has shown promising results in several phase ii trials , and the gynecologic oncology group gog218 phase iii trial was recently reported at the 2010 asco meeting , showing improved progression - free survival for patients receiving first - line carboplatin - paclitaxel and bevacizumab , with bevacizumab maintenance therapy . interestingly , the progression - free survival in the chemotherapy and bevacizumab without maintenance bevacizumab arm was not significantly different from that of the standard arm ( carboplatin - paclitaxel alone ) . this trial therefore raises the question as to whether bevacizumab should be given as a maintenance therapy only , or whether it really needs to be combined in the initial chemotherapy regimen . furthermore , the improvement in progression - free survival is limited , especially given that maintenance bevacizumab was given every three weeks for 16 cycles ( approximately 11 months ) , and there is currently no overall survival advantage for patients receiving bevacizumab ( insufficient follow - up ) . therefore , it seems reasonable to wait for the overall survival data to mature , as well as data from other randomized trials ( icon7 trial ) , before we incorporate bevacizumab as part of standard practice . several antiangiogenic tyrosine kinase inhibitors ( tkis ) are currently under active investigation in the treatment of advanced ovarian cancer . cediranib , an oral tki of vascular endothelial growth factor receptor ( vegfr)-1 , vegfr-2 , vegfr-3 , and c - kit , showed interesting single - agent activity in a recently published phase ii trial in patients with relapsed ovarian carcinoma.40 bibf1120 , a tki targeting the vegf , the platelet - derived growth factor , and the fibroblast growth factor receptor , has shown promising activity as maintenance therapy in a randomized phase ii trial.41 pazopanib , another tki targeting the vegf and platelet - derived growth factor receptor , has shown some activity in patients with biochemical relapse of ovarian cancer.42 both of these agents are currently being evaluated in phase iii trials , either in combination ( bibf1120 ) or as maintenance therapy ( pazopanib).4 cell surface targets in ovarian carcinoma include ca-125 and epithelial cell adhesion molecule . however , the current role of the relevant agents ( oregomovab , abagomovab , and catumaxomab ) in the management of patients with advanced ovarian cancer remains unclear , owing to the lack of a specific trial . the most recent class of drug developed for patients with advanced ovarian cancer includes the poly-(adp - ribose)-polymerase ( parp ) inhibitors . preclinical experiments have shown synthetic lethality in cells deficient in brca 1 or bcra 2.43,44 a single - agent phase i trial showed interesting activity in tumors from brca 1 or brca 2 mutation carriers , with a favorable toxicity profile.45 gelmon et al reported a phase ii trial in triple - negative breast and high - grade serous ovarian carcinoma demonstrating significant activity of single - agent olaparib in non - brca - mutated patients with advanced high - grade ovarian carcinoma.46 however , an analysis of the expansion cohort of the phase i study of olaparib in brca mutation carriers showed a correlation between response and duration of the platinum - free interval , suggesting that parps may not be as active in patients with platinum - resistant disease.47 parp inhibitors can also be combined with standard chemotherapy , most notably with dna - damaging agents , with which they are most likely to be synergistic . only phase i trials have been reported to date for patients with ovarian carcinoma . trabectedin , a new marine - derived compound , has shown interesting activity in patients with platinum - sensitive relapsed ovarian carcinoma . however , several agents are currently approved for this indication , including paclitaxel , gemcitabine , and pld . the standard of care in this setting remains the combination of carboplatin and paclitaxel , and a recent phase iii study showed improved progression - free survival and overall survival with weekly paclitaxel coupled with carboplatin for patients with platinum - sensitive recurrent ovarian cancer.48 when combined with pld , trabectedin improved progression - free survival over pld alone , although no overall survival advantage has yet emerged.36 furthermore , the progression - free survival benefit is numerically small ( six weeks ) and comes at the price of a significant increase in toxicity , although somewhat different from those seen with platinum or platinum - taxane regimens which are standard for this indication . another drawback of this study is that single - agent pld can not be considered as standard in patients with platinum - sensitive relapsed ovarian cancer . based on these observations , the use of trabectedin in the management of patients with platinum - sensitive disease can not be clearly defined , and more studies are needed . however , recent data indicate that patients with partial platinum - sensitive disease benefit from the combination of trabectedin and pld compared with pld alone , with superior progression - free survival and overall survival for the combination.37 | trabectedin is a new marine - derived compound that binds the dna minor groove and interacts with proteins of the dna repair machinery .
trabectedin has shown promising single - agent activity in pretreated patients with soft tissue sarcoma , and ovarian and breast cancer , and combination with various other chemotherapeutic drugs seems feasible .
toxicities are mainly hematologic and hepatic , with grade 34 neutropenia and thrombocytopenia observed in approximately 50% and 20% of patients , respectively , and grade 34 elevation of liver enzymes observed in 35%50% of patients treated with trabectedin .
the recently reported results of a large phase iii trial comparing pegylated liposomal doxorubicin ( pld ) alone with a combination of pld and trabectedin in patients with recurrent ovarian cancer showed improved progression - free survival with the combination of trabectedin and pld , albeit at the price of increased toxicity .
current research focuses on the identification of predictive factors for patients treated with trabectedin , as well as the development of other combinations . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
children who are frequently exposed to sugary liquids , breast milk , formula , fruit juices , and other sweet liquids for long periods run at a great risk of suffering from early childhood caries ( ecc ) . the american academy of pediatric dentistry ( aapd ) defines ecc as the presence of one or more decayed teeth , missing teeth ( resulting from caries ) , or filled tooth surfaces in any primary tooth in a child of 6 years or younger . problems encountered by children with ecc are not just pain and infection , also affects speech and communication , eating and dietary nutrition , playing and overall quality of life . there could also be insufficient physical development ( in terms of height and weight ) . many children often require multiple comprehensive treatments , frequently requiring hospitalization , and treatments under general anesthesia . most children with ecc have a complaint of pain indicating bacterial involvement of the dental pulp . there is a cytokine cascade that induced in response to bacterial infection of the dental pulp which includes interleukin-1 ( il-1 ) , il-6 , il-8 , il-10 , il-12 , and tumor necrosis factor - alpha ( tnf- ) . cytokines play a major role in the inflammatory and immune responses , several of them displaying inflammatory and others anti - inflammatory . il-6 has both proinflammatory and anti - inflammatory properties , and understanding its possible role as a marker for dental caries will prove very useful , especially while dealing with children with ecc . found that serum il-6 could be used as serologic marker for chronic periapical lesions as il-6 concentrations were significantly higher in patients with chronic periapical lesions . another study measured and compared the levels of cytokines il-12 , il-6 , il-8 , il-10 , tnf- , and interferon - gamma ( ifn- ) in pulpal blood from teeth affected with irreversible pulpitis , asymptomatic caries exposure , and those with normal pulps and found that significantly higher levels of il-6 , il-8 , il-10 , tnf- , and ifn- were detected in caries exposed pulp and irreversible pulpitis as compared to normal teeth . most interestingly , ratios of il-6/il-10 and il-8/il-10 were significantly higher in irreversible pulpitis when compared to caries - exposed and normal teeth . periodontitis showed that these teeth when compared to normal healthy teeth stimulated c - reactive protein and il-6 , thereby significantly increasing their levels . a study conducted by gornowicz et al . was a baseline study comparing the levels of various cytokines in children and adolescents with dental caries and a control group with good oral health . their study included assessing the levels of salivary il-6 , which was significantly higher in children with dental caries . varma and fathima assessed the levels of il-1 in children with down syndrome after full mouth rehabilitation and found that the levels of il-1 significantly decreased after treatment . from the above - mentioned studies , it is clear that there is a strong correlation between levels of these inflammatory mediators and the presence of dental caries , and therefore , children with ecc are also at risk of having higher levels of these cytokines . hence , the aim of this study was to assess and compare the level of salivary il-6 in children with ecc before and after full mouth rehabilitation of children with ecc . the inclusion criteria were children between 36 years of age and those with type ii ecc by wayne 's criteria ( labio - lingual carious lesions on maxillary incisors with / without involvement of molars and unaffected mandibular anterior ) . the exclusion criteria were type iii severe ecc , type i ecc , presence of any abscess , sinus , or fistula , medically compromised children , and those with special health care needs . the study was carried out in the department of pedodontics and preventive dentistry of our institute after obtaining approval from the institutional ethical committee . informed consent was also obtained from each parent prior to the commencement of the study . patients were asked to refrain from eating 60 min before saliva sample collection , and they were then asked to rinse their mouths 2030 min before sample collection . samples were then immediately stored at a low temperature of 4c and transported to a laboratory within 2 h. the saliva samples were then centrifuged at 1500 g ( 3000 rpm ) for 15 min to remove mucosal and other constituents . the clear supernatant was then transferred to another eppendorf tube , was labeled and arranged in an eppendorf tube rack , and stored at 80c ultra - cold storage unit until subjected to enzyme - linked immune sorbent assay ( elisa ) tests . salivary il-6 assessment was done using the salimetrics elisa kit ( salimetrics llc , state college , pa , usa ) , specific for salivary il-6 in the department of biochemistry [ figures 1a , 1b , 2a , 2b , 3a and 3b ] . ( b ) plates placed on mini - rotator shaker which mixes constantly ( a ) blue color obtained after adding 100 l tetramethylbenzidine solution . ( b ) yellow color obtained after adding stop solution ( a and b ) optical density is read on a standard plate reader at 450 nm based on examination , history , and investigations , a treatment plan was formulated to be carried out as a chairside procedure . treatments carried out were oral prophylaxis , restorations , pit and fissure sealants , fluoride application , pulp therapies , and extractions . follow - up appointments included reinforcement of oral hygiene measures , and oral prophylaxis was done if required . oral hygiene measures were also shown to parents and guardians to assist the child efficiently . the second salivary sample was collected 3 months after the completion of comprehensive dental treatments in a similar manner as explained earlier , for il-6 estimation . oral health education sessions were also conducted for both child and parent to ensure and reinforce good oral hygiene measures . the mean values of the levels of salivary il-6 of the pretreatment ( sample a ) and 3 months posttreatment ( sample b ) were 100.46 112.47 and 21.46 35.80 , respectively [ table 1 ] . wilcoxon signed - rank test compared the pretreatment values with 3 months posttreatment values . the reduction in levels of salivary il-6 this clearly indicated postdental rehabilitation of children with ecc , and there is a statistically significant reduction in salivary il-6 levels . mean value and standard deviation of salivary interleukin-6 and the p value obtained the mean gi values of both sample a ( prior to treatment ) and sample b ( 3 months posttreatment ) were 0.68 0.22 and 0.55 0.21 , respectively [ table 2 ] . the paired t - test compared the pre- and post - treatment gi values ( p < 0.002 ) , and the values were statistically significant . il-6 is known to have a strong correlation with severity and extent of carious lesions in the oral cavity , and therefore , minimizing its levels will help in improving the inflammatory condition in the oral cavity . this was a pioneering approach to assess the levels of salivary il-6 in children with ecc and to evaluate the difference in levels of salivary il-6 after full mouth dental rehabilitation . this study included 22 healthy children diagnosed with type ii ecc , excluded to be from any systemic disease , medically compromised condition , etc . , these exclusion criteria were decided as such because many studies done by various authors have shown that levels of il-6 may be increased in many systemic conditions . studies done by erta et al . suggest that il-6 has a key role in the central nervous system and its expression may be enhanced in multiple sclerosis , psychiatric disorders such as depression , autism , and schizophrenia . showed that pediatric oncology patients who have higher levels of il-6 showed risk of developing septicemia . , , similarly , saliva was used as the diagnostic fluid for il-6 estimation in this study . although gcf is considered as the main source of periodontitis associated cytokines , it only reflects periodontal inflammation at each specific site sampled and these agents eventually enter into saliva and mix with salivary il-6 as suggested by gursoy et al . have stated that saliva , unlike gcf , is an easily and noninvasively collected specimen which can be used for the detection of immune components . seyberth et al . demonstrated that saliva sampling is a very effective technique in children due the following reasons such as it is both noninvasive and painless ; minimal patient discomfort when compared to venous blood sampling ; repeated samples are easy to obtain , and good correlation has been found with blood concentrations of various parameters . prior to saliva collection , a general physical examination and a thorough oral examination were carried out . patients were asked to refrain from eating 60 min before saliva sample collection and were asked to rinse their mouths 2030 min before sample collection so as to clear the oral cavity of any debris , similar to the methodology used by gornowicz et al . polythene pipettes do not traumatize the patient , even if the patient bites onto the pipette , no harm is done , it can be easily cleaned , and it has longer life than ordinary bulb pasteur pipette . after collection of saliva , the samples were centrifuged at 1500 g ( 3000 rpm ) . centrifuging removes mucins and other particulate matter which may interfere with antibody binding , ultimately leading to falsely elevated results . the saliva supernatant was separated and stored at low temperature in an ultra - cool temperature storage unit at 80c so as to prevent microbial growth and avoid degeneration of cytokines . the posttreatment saliva samples were collected and handled in a fashion similar to the pretreatment samples . in our study , the samples were subjected elisa analysis to measure the levels of il-6 in saliva using salimetrics il-6 kit . this kit is a sandwich immunoassay , specifically designed for the measurement of salivary il-6 . based on the clinical examination and investigations , a tailor - made treatment plan was formulated for each patient . dental treatment was carried out either as a chairside procedure or under general anesthesia , depending on patient compliance . according to the pediatric oral health policy by aapd in 2012 , conducting comprehensive dental rehabilitation under general anesthesia for children with ecc has many additional benefits to children as well as their families . some of them are improvement in the quality of life of child and parent , facilitating dental access for very young patients , improved positive oral health behaviors and oral health outcomes . in this study , 6 out of 22 children required treatment under general anesthesia . after the full mouth comprehensive treatments were completed , the children were followed up for 3 months as performed in other studies . during those 3 months , children and respective parents were instructed and demonstrated the brushing techniques and other oral hygiene instructions . the gi ( loe and silness , 1967 ) was recorded first before the treatment commenced and 3 months after completion of full mouth rehabilitation to evaluate the difference in oral health . the gi has been used by many authors to assess the oral health of children as in studies conducted by gopinath et al . and al - haddad et al . the mean pretreatment gi was 0.68 0.22 which reduced to 0.55 0.21 after 3 months . the mean salivary il-6 as estimated in this study was 100.46 112.47 which reduced to 21.46 35.80 after 3 months posttreatment . , there was a reduction in il-1 levels in children with down syndrome after full mouth dental rehabilitation , but the reduction was not statistically significant because of delayed response or the defective neutrophil chemotaxis and prolonged t - cell activation seen in individuals with downs syndrome . this was a pioneer effort to evaluate the relation between salivary il-6 and ecc and also to analyze the effect of dental rehabilitation on reducing it in the oral cavity . further studies with larger sample size and longer follow - up period may help to conclusively establish the efficacy of dental treatments in minimizing the levels of these inflammatory markers . this study also showed that after full mouth rehabilitation significantly contributed to reducing salivary il-6 levels . | background : the role of cytokines as a marker in the oral inflammatory process in ecc has not been fully explored before and after full mouth rehabilitation.aims:the aim of this study was to assess the level of salivary interleukin-6 ( il-6 ) in children with ecc and to compare its levels before and after comprehensive full mouth rehabilitation.methods and materials : saliva samples were collected from children with ecc prior to dental treatment and 3-month post treatment .
the salivary il-6 levels were analyzed using the elisa method .
the gingival index was also timely recorded .
oral health awareness sessions were conducted for children and their parents at regular intervals during the 3-month study period . statistical analysis used :
wilcoxon signed rank test compared the levels of salivary il-6 while , the paired t test compared the values of gingival index before and after treatment.results:the mean level of salivary il-6 before and 3 months after treatment had reduced and this reduction was statistically significant ( p < 0.000 ) .
the gingival index scores had also reduced significantly 3-months post treatment ( p < 0.002).conclusions : children with ecc when completely rehabilitated and kept under frequent follow up , which includes reinforcement of oral hygiene measures and maintaining a low caries activity state , the level of inflammation ( il-6 ) can definitely be minimized and thereby improving the quality of life of affected children . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
fine - tuning of urine concentration occurs in the renal collecting duct by the actions of the antidiuretic hormone arginine vasopressin ( avp ) . avp binds to arginine vasopressin receptor 2 ( avpr2 ) on the basolateral plasma membrane of renal collecting duct principal cells , thereby inducing apical plasma membrane insertion of aquaporin-2 leading to increased water uptake and urine concentration [ 1 , 2 ] . nephrogenic diabetes insipidus ( ndi ) , which can be either inherited or acquired , is characterized by the excretion of large volumes of dilute urine and resistance to the action of vasopressin . almost 90% of congenital ndi is inherited in an x - linked recessive manner due to mutations in the avpr2 gene residing in the xq28 region , while 10% is autosomal ndi caused by mutations in the aquaporin 2 gene ( aqp2 ) . more than 200 putative disease - causing mutations within the avpr2 gene have been reported and functional characterization of some of these mutant receptors have revealed receptor malfunction at different levels such as receptors with drastically reduced binding affinity for vasopressin ( type 1 ) , defective intracellular trafficking ( type 2 ) or reduced receptor transcription ( type 3 ) . in the present report , we describe a novel mutation in the avpr2 gene in a danish male with ndi . we propose that , in ndi , the accumulation of the misfolded protein is non - toxic since other functions of the principal cell of the collecting duct are intact . a 30-year - old caucasian male patient had a history of polyuria and polydipsia from infancy . during early childhood the patient is normally developed without cognitive deficits and is gainfully employed . after referral , further investigations revealed a daily urine output of typically 13 l with low osmolality , 75 mosm / kg , despite high plasma avp concentration . a water deprivation test showed an inability to produce concentrated urine before and after administration of exogenous avp . due to high mictional volumes suggesting distended urinary bladder , he was instructed to void at regular intervals , irrespective of whether urine had accumulated or not . none of the patient s relatives ( figure 1 ) had a similar history of polyuria and polydipsia . the patient s mother and sister agreed to be genetically tested for the mutation . the father is adopted and healthy . the mother s sister and her three sons are clinically healthy and have therefore not been genetically tested . the mother was diagnosed as a heterozygous carrier of the mutation , while the sister was not . the mother did not wish to participate in further investigations and therefore we were not able to conduct urine sampling in order to test for possible skewed x - chromosome inactivation . however , it was reported that she as a child had extraordinary thirst and suffered from enuresis nocturna until the age of 10 ( tomas m. christensen , personal communication ) . the daughter of the patient is an obligate carrier of the mutation but due to her young age ( 1 year ) , genetic testing and urine analysis has not been performed . roman numerals , the generation ; circles with a central dot , obligatory carriers ; closed squares , affected subjects . sequence analysis of the avpr2 gene was performed as previously described and revealed a novel missense mutation ( l170p ) in the fourth transmembrane domain of avpr2 . the l170p mutation was introduced into the pegfp - v2r construct using ( forward ) ccttctcgctccttcccagcctgccccagc and ( reverse ) gctggggcaggctgggaaggagcgagaagg primers and the quikchange site - directed mutagenesis kit ( stratagene ) . the mutation was confirmed by sequencing . for transient transfections , madin - darby canine kidney ( mdck ) gii cells were transfected , stained 24-h post - transfection , imaged and analysed as previously described . to generate a cell line stably expressing avpr2-l170p - gfp , a tetracycline / doxycyclin - inducible mdck cell line was generated using the flp - in t - rex core kit ( invitrogen ) according to the manufacturer s protocol . mdck type ii cells were maintained in dulbecco s modified eagle s medium ( gibco ) supplemented with 5% fetal calf serum ( paa laboratories ) , ciproxin , l - glutamin and 1% non - essential amino acids . to stably introduce an flp recognition target ( frt ) recombination site , pfrt - laczeo ( invitrogen ) was linearized with xmni and transfected into the mdck cells . stable transfectants were selected using 0.5 mg / ml zeocin , and insertion into the frt site was confirmed by blue staining using the -gal staining kit ( invitrogen ) . to stably introduce a tet - repressor , cells were transfected with fspi - linearized pcdna6-tr ( invitrogen ) and cells were selected using 5 g / ml blasticidin . to identify a single clone with minimal leakiness and to identify the optimal time of induction , cell lines stably expressing green fluorescent protein ( gfp ) were generated by co - transfection of pcdna5-frt - to - gfp plasmid with pog44 ( encoding the flp recombinase ; invitrogen ) in a ratio of 1:9 . transfectants were isolated using selection with 0.1 mg / ml hygromycin and analysed via western blotting and fluorescence microscopy to determine induction . avpr2-l170p - gfp was subcloned into the pcdna5/frt / to ( invitrogen ) and cells were co - transfected with pcdna5-frt - to - avpr2-l170p - gfp plasmid and pog44 using lipofectamine 2000 . transfectants were isolated using selection with 0.1 mg / ml hygromycin and blasticidin and analysed via fluorescence microscopy to determine induction . following 16 h of 10 g/l tetracycline , lysomal degradation was inhibited by the lysosomal protease inhibitor chloroquine ( 100 m ) for 4 h , or the proteasome was inhibited by a 4-h incubation with the proteasome inhibitor mg-132 ( 10 m ; sigma ) , control cells were incubated with dimethyl sulfoxide ( dmso ) . primary antibodies were polyclonal gfp ( a11122 ; molecular probes ) , polyclonal calreticulin ( affinity bioreagent ) , monoclonal cathepsin d ( trichem aps ) and monoclonal clone 58k-9 ( sigma aldrich ) . for western blotting , cells were lysed in sodium dodecyl sulfate sample buffer and western blotting was perfomed via a standard protocol . imaging was performed on a zeiss 200 m microscope using the metamorph software and analysis was performed using imagej . in mdck cells transiently transfected with avpr2-l170p - gfp or wild - type avpr2-gfp , wild - type avpr2-gfp was localized to the plasma membrane , with some avpr2-gfp localized to the golgi as visualized by labelling with the golgi marker golgi 58k protein ( figure 2a ) . ( a ) wild - type avpr2-gfp transiently expressed in mdck cells and stained with the golgi marker g58k . wild - type avpr2-gfp localizes to cell cell contacts of mdck cells and to the golgi region . avpr2-l170p - gfp transiently expressed in mdck cells and stained with the golgi marker g58k . ( c ) avpr2-l170p - gfp transiently expressed in mdck cells and stained with the er marker calreticulin . avpr2-l170p - gfp localizes to intracellular structures with some overlap with the er marker calreticulin . cells were loaded with lysotracker red before fixation , which shows that cells expressing avpr2-l170p - gfp had larger lysosomes than surrounding cells , although avpr2-l170p - gfp did not colocalize , which could be due to degradation of the gfp - tag in lysosomes . please note that samples b , c and d have been stained with antibody against the gfp tag since they were otherwise not bright enough for imaging . avpr2-l170p - gfp could not be detected following transient transfections by normal epi - fluorescence microscopy , suggesting that the avpr2-l170p - gfp was dramatically downregulated compared to the wild type . increasing the signal of the mutant avpr2-l170p - gfp with a gfp antibody revealed that the mutant was localized intracellularly but did not colocalize with the golgi marker ( figure 2b ) . co - staining with calreticulin , a marker for the endoplasmic reticulum ( er ) , revealed a large degree of colocalization between avpr2-l170p - gfp and the er ( figure 2c ) . moreover , cells transfected with avpr2-l170p - gfp had greatly increased lysosomes as detected by lysotracker red ( figure 2d ) ; however , there was no colocalization between avpr2-l170p - gfp and lysosomes . normally , wild - type avpr2-gfp is localized to the plasma membrane , from which it is internalized and degraded in the lysosome [ 8 , 9 ] . the lack of colocalization between avpr2-l170p - gfp and lysosomes could be due to degradation of the gfp tag . the increase in lysosomal size could be due to degradation of avpr2-l170p - gfp or could be a secondary effect of avpr2-l170p - gfp accumulation in the er , which could disturb trafficking of other proteins . to determine the cellular fate of the unstable avpr2-l170p , inhibition of lysosomal degradation was investigated in the cell line stably expressing avpr2-l170p - gfp under a tetracycline - inducible promoter . some avpr2-l170p - gfp expression was observed even without tetracycline ( figure 3b ) , indicating a leakiness of the promoter . avpr2-l170p - gfp expression was induced by 16-h incubation with 10 g / ml tetracycline , followed by a 4-h incubation with either dmso or the lysosome inhibitor chloroquine ( 100 m ) . ( a ) representative images of avpr2-l170p - gfp stably expressed in mdck cells 16 h after induction with tetracycline followed by 4 h of incubation with dmso or chloroquine ( 100 m ) . there is a marked accumulation of avpr2-l170p - gfp in cells treated with chloroquine compared to controls ( dmso ) . moreover , following chloroquine treatment , avpr2-l170p - gfp is localized in larger structures , which colocalize with the lysosomal marker cathepsin d. ( b ) western blot analysis of equal amount of protein from cells stably expressing avpr2-l170p - gfp , either not induced or induced by tetracycline , and transiently expressing wild - type avpr2-gfp probed with a gfp antibody . a 68-kda band was observed in all samples as well as a 46-kda band corresponding to the lysosomal degradation product . the 68-kda band was decreased in intensity and the 46-kda degradation product was increased in intensity in avpr2-l170p - gfp compared to wild - type avpr2-gfp ; however , this was reversed by inhibition of lysosome degradation by chloroquine . moreover , a broad 57-kda band in wild - type avpr2-gfp was completely absent from avpr2-l170p - gfp . cells not induced by tetracycline still show significant levels of avpr2-l170p - gfp , indicating a leaky promoter . inhibition of lysosomal degradation by chloroquine resulted in increased intracellular accumulation of avpr2-l170p - gfp ( figure 3a ) . moreover , cells treated with chloroquine had larger lysosomes ( figure 3 , stained with cathepsin d antibodies ) and inhibition of lysosomal degradation resulted in colocalization of avpr2-l170p - gfp with lysosomes ( figure 3 , overlays ) . western blot analysis of wild - type avpr2-gfp showed bands at 68 kda and a broad 57-kda band corresponding to the glycosylated forms of the protein and a 46-kda band corresponding to the lysosomal degradation product . interestingly , western blot analysis of avpr - l170p - gfp ( figure 3b ) revealed a 68-kda band corresponding to the full - length glycosylated protein and a 46-kda band corresponding to the degradation product , but no bands around 57-kda were observed , indicating that there might be a deficiency in glycosylation of avpr2-l170p - gfp . the lack of avpr2-l170p - gfp glycosylation could be the primary cause for er accumulation , or more likely , it could be a secondary effect due to receptor misfolding , resulting in er retention and subsequent degradation in the lysosome . compared to wild - type avpr2-gfp , the intensity of the 46-kda degradation product was larger than the 68-kda band , indicating rapid degradation of avpr2-l170p - gfp . this was reversed by treatment with lysosomal inhibitor chloroquine , which resulted in increased intensity of the 68-kda band compared to the 46-kda band ( figure 3b ) since er - retained v2r mutants are often degraded in the proteasome , we also tested if avpr2-l170p - gfp could be degraded in this organelle . following incubation with an inhibitor of proteasomal degradation , mg-132 , there was a significant change in the localization of avpr2-l170p - gfp , which relocated from the er to the plasma membrane ( figure 4a ) ; however , there was no change in the expression levels of avpr2-l170p - gfp following mg-132 treatment ( figure 4b ) and unlike lysosomal inhibition , we did not see a change in the ratio between the 68-kda full - length protein and the 46-kda degradation product following proteasome inhibition . this indicates that avpr2-l170p - gfp is not degraded via the proteasome , but inhibition of proteasome degradation could lead to a general release of proteins from the er . ( a ) representative images of avpr2-l170p - gfp stably expressed in mdck cells 16 h after induction with tetracycline followed by 4 h of incubation with dmso or mg-132 . there is a marked relocalization of avpr2-l170p - gfp from the er to the plasma membrane following inhibition of the proteasome with mg-132 compared to dmso . mdck cells stably expressing avpr2-l170p - gfp induced by tetracycline followed by a 4-h treatment with either dmso or the proteasome inhibitor mg-132 . a 68-kda band corresponding to the non - glycosylated form of avpr2-l170p - gfp was present in all lanes as well as a 46-kda band presumed to be a degradation product . there was no significant difference in the intensity of the bands between dmso and mg-132-treated cells . the l170p mutation was introduced into the pegfp - v2r construct using ( forward ) ccttctcgctccttcccagcctgccccagc and ( reverse ) gctggggcaggctgggaaggagcgagaagg primers and the quikchange site - directed mutagenesis kit ( stratagene ) . for transient transfections , madin - darby canine kidney ( mdck ) gii cells were transfected , stained 24-h post - transfection , imaged and analysed as previously described . to generate a cell line stably expressing avpr2-l170p - gfp , a tetracycline / doxycyclin - inducible mdck cell line was generated using the flp - in t - rex core kit ( invitrogen ) according to the manufacturer s protocol . mdck type ii cells were maintained in dulbecco s modified eagle s medium ( gibco ) supplemented with 5% fetal calf serum ( paa laboratories ) , ciproxin , l - glutamin and 1% non - essential amino acids . briefly , to stably introduce an flp recognition target ( frt ) recombination site , pfrt - laczeo ( invitrogen ) was linearized with xmni and transfected into the mdck cells . stable transfectants were selected using 0.5 mg / ml zeocin , and insertion into the frt site was confirmed by blue staining using the -gal staining kit ( invitrogen ) . to stably introduce a tet - repressor , cells were transfected with fspi - linearized pcdna6-tr ( invitrogen ) and cells were selected using 5 g / ml blasticidin . to identify a single clone with minimal leakiness and to identify the optimal time of induction , cell lines stably expressing green fluorescent protein ( gfp ) were generated by co - transfection of pcdna5-frt - to - gfp plasmid with pog44 ( encoding the flp recombinase ; invitrogen ) in a ratio of 1:9 . transfectants were isolated using selection with 0.1 mg / ml hygromycin and analysed via western blotting and fluorescence microscopy to determine induction . avpr2-l170p - gfp was subcloned into the pcdna5/frt / to ( invitrogen ) and cells were co - transfected with pcdna5-frt - to - avpr2-l170p - gfp plasmid and pog44 using lipofectamine 2000 . transfectants were isolated using selection with 0.1 mg / ml hygromycin and blasticidin and analysed via fluorescence microscopy to determine induction . following 16 h of 10 g/l tetracycline , lysomal degradation was inhibited by the lysosomal protease inhibitor chloroquine ( 100 m ) for 4 h , or the proteasome was inhibited by a 4-h incubation with the proteasome inhibitor mg-132 ( 10 m ; sigma ) , control cells were incubated with dimethyl sulfoxide ( dmso ) . primary antibodies were polyclonal gfp ( a11122 ; molecular probes ) , polyclonal calreticulin ( affinity bioreagent ) , monoclonal cathepsin d ( trichem aps ) and monoclonal clone 58k-9 ( sigma aldrich ) . for western blotting , cells were lysed in sodium dodecyl sulfate sample buffer and western blotting was perfomed via a standard protocol . imaging was performed on a zeiss 200 m microscope using the metamorph software and analysis was performed using imagej . in mdck cells transiently transfected with avpr2-l170p - gfp or wild - type avpr2-gfp , wild - type avpr2-gfp was localized to the plasma membrane , with some avpr2-gfp localized to the golgi as visualized by labelling with the golgi marker golgi 58k protein ( figure 2a ) . ( a ) wild - type avpr2-gfp transiently expressed in mdck cells and stained with the golgi marker g58k . wild - type avpr2-gfp localizes to cell cell contacts of mdck cells and to the golgi region . avpr2-l170p - gfp transiently expressed in mdck cells and stained with the golgi marker g58k . ( c ) avpr2-l170p - gfp transiently expressed in mdck cells and stained with the er marker calreticulin . avpr2-l170p - gfp localizes to intracellular structures with some overlap with the er marker calreticulin . cells were loaded with lysotracker red before fixation , which shows that cells expressing avpr2-l170p - gfp had larger lysosomes than surrounding cells , although avpr2-l170p - gfp did not colocalize , which could be due to degradation of the gfp - tag in lysosomes . please note that samples b , c and d have been stained with antibody against the gfp tag since they were otherwise not bright enough for imaging . avpr2-l170p - gfp could not be detected following transient transfections by normal epi - fluorescence microscopy , suggesting that the avpr2-l170p - gfp was dramatically downregulated compared to the wild type . increasing the signal of the mutant avpr2-l170p - gfp with a gfp antibody revealed that the mutant was localized intracellularly but did not colocalize with the golgi marker ( figure 2b ) . co - staining with calreticulin , a marker for the endoplasmic reticulum ( er ) , revealed a large degree of colocalization between avpr2-l170p - gfp and the er ( figure 2c ) . moreover , cells transfected with avpr2-l170p - gfp had greatly increased lysosomes as detected by lysotracker red ( figure 2d ) ; however , there was no colocalization between avpr2-l170p - gfp and lysosomes . normally , wild - type avpr2-gfp is localized to the plasma membrane , from which it is internalized and degraded in the lysosome [ 8 , 9 ] . the lack of colocalization between avpr2-l170p - gfp and lysosomes could be due to degradation of the gfp tag . the increase in lysosomal size could be due to degradation of avpr2-l170p - gfp or could be a secondary effect of avpr2-l170p - gfp accumulation in the er , which could disturb trafficking of other proteins . to determine the cellular fate of the unstable avpr2-l170p , inhibition of lysosomal degradation was investigated in the cell line stably expressing avpr2-l170p - gfp under a tetracycline - inducible promoter . some avpr2-l170p - gfp expression was observed even without tetracycline ( figure 3b ) , indicating a leakiness of the promoter . avpr2-l170p - gfp expression was induced by 16-h incubation with 10 g / ml tetracycline , followed by a 4-h incubation with either dmso or the lysosome inhibitor chloroquine ( 100 m ) . ( a ) representative images of avpr2-l170p - gfp stably expressed in mdck cells 16 h after induction with tetracycline followed by 4 h of incubation with dmso or chloroquine ( 100 m ) . there is a marked accumulation of avpr2-l170p - gfp in cells treated with chloroquine compared to controls ( dmso ) . moreover , following chloroquine treatment , avpr2-l170p - gfp is localized in larger structures , which colocalize with the lysosomal marker cathepsin d. ( b ) western blot analysis of equal amount of protein from cells stably expressing avpr2-l170p - gfp , either not induced or induced by tetracycline , and transiently expressing wild - type avpr2-gfp probed with a gfp antibody . a 68-kda band was observed in all samples as well as a 46-kda band corresponding to the lysosomal degradation product . the 68-kda band was decreased in intensity and the 46-kda degradation product was increased in intensity in avpr2-l170p - gfp compared to wild - type avpr2-gfp ; however , this was reversed by inhibition of lysosome degradation by chloroquine . moreover , a broad 57-kda band in wild - type avpr2-gfp was completely absent from avpr2-l170p - gfp . cells not induced by tetracycline still show significant levels of avpr2-l170p - gfp , indicating a leaky promoter . inhibition of lysosomal degradation by chloroquine resulted in increased intracellular accumulation of avpr2-l170p - gfp ( figure 3a ) . moreover , cells treated with chloroquine had larger lysosomes ( figure 3 , stained with cathepsin d antibodies ) and inhibition of lysosomal degradation resulted in colocalization of avpr2-l170p - gfp with lysosomes ( figure 3 , overlays ) . western blot analysis of wild - type avpr2-gfp showed bands at 68 kda and a broad 57-kda band corresponding to the glycosylated forms of the protein and a 46-kda band corresponding to the lysosomal degradation product . interestingly , western blot analysis of avpr - l170p - gfp ( figure 3b ) revealed a 68-kda band corresponding to the full - length glycosylated protein and a 46-kda band corresponding to the degradation product , but no bands around 57-kda were observed , indicating that there might be a deficiency in glycosylation of avpr2-l170p - gfp . the lack of avpr2-l170p - gfp glycosylation could be the primary cause for er accumulation , or more likely , it could be a secondary effect due to receptor misfolding , resulting in er retention and subsequent degradation in the lysosome . compared to wild - type avpr2-gfp , the intensity of the 46-kda degradation product was larger than the 68-kda band , indicating rapid degradation of avpr2-l170p - gfp . this was reversed by treatment with lysosomal inhibitor chloroquine , which resulted in increased intensity of the 68-kda band compared to the 46-kda band ( figure 3b ) since er - retained v2r mutants are often degraded in the proteasome , we also tested if avpr2-l170p - gfp could be degraded in this organelle . following incubation with an inhibitor of proteasomal degradation , mg-132 , there was a significant change in the localization of avpr2-l170p - gfp , which relocated from the er to the plasma membrane ( figure 4a ) ; however , there was no change in the expression levels of avpr2-l170p - gfp following mg-132 treatment ( figure 4b ) and unlike lysosomal inhibition , we did not see a change in the ratio between the 68-kda full - length protein and the 46-kda degradation product following proteasome inhibition . this indicates that avpr2-l170p - gfp is not degraded via the proteasome , but inhibition of proteasome degradation could lead to a general release of proteins from the er . ( a ) representative images of avpr2-l170p - gfp stably expressed in mdck cells 16 h after induction with tetracycline followed by 4 h of incubation with dmso or mg-132 . there is a marked relocalization of avpr2-l170p - gfp from the er to the plasma membrane following inhibition of the proteasome with mg-132 compared to dmso . mdck cells stably expressing avpr2-l170p - gfp induced by tetracycline followed by a 4-h treatment with either dmso or the proteasome inhibitor mg-132 . a 68-kda band corresponding to the non - glycosylated form of avpr2-l170p - gfp was present in all lanes as well as a 46-kda band presumed to be a degradation product . there was no significant difference in the intensity of the bands between dmso and mg-132-treated cells . congenital x - linked ndi is a rare disease affecting 8.8 of 1 000 000 male live births . we have identified a danish male patient with congenital x - linked ndi due to a missense mutation in the fourth transmembrane domain of the avpr2 ( l170p ) . when expressed in cell cultures , the present avpr2-l170p mutant was shown to be trapped intracellularly and colocalized with er markers suggesting that avpr2-l170p mutant is misfolded and degraded . the intracellular retention has been characterized as a type 2 mutation and functional studies conducted to date have shown that the majority of mutant avpr2 receptors are of this type . we are proposing to classify the inherited diseases characterized by the accumulation of misfolded proteins into two groups : in the first group , there is toxic accumulation of the misfolded protein and a gain - of - toxic function mechanism now extensively explored in alpha-1-antitrypsin deficiency and in familial neurohypophyseal diabetes insipidus , both dominant disorders [ 12 , 13 ] . in the second group , the function of the cell where this accumulation takes place remains intact ; this is the case with avpr2 mutations where the other important function of the principal cell of the collecting tubule , namely the reabsorption of na through the epithelial sodium channel ( enac ) channel , remains intact since there is no evidence of loss of function of the enac channel in male patients bearing avpr2 mutations . ndi is associated with a large urine production and if not recognized in early childhood , it may result in mental retardation due to dehydration . when diagnosed , urine volumes can be somewhat reduced by administering thiazide diuretics along with prostaglandin inhibitors [ 2 , 4 ] ; however , at present , no cure for congenital ndi is available . in working toward a potential cure for ndi , a great advance in potentially treating they successfully used in vivo gene therapy to transfer aqp2 to rat collecting ducts , which temporarily and partially rescued lithium - induced ndi . this is the first time a gene has successfully been incorporated into the renal collecting duct and this technique shows great promise for potentially treating patients with different forms of ndi caused by mutations in avpr2 or aqp2 . recent studies in cell cultures have shown that different pharmacological chaperones are able to rescue some avpr2 folding mutants by restoring their plasma membrane expression or inducing their intracellular activation . the list of specific chemical chaperones is rapidly expanding and chaperones able to rescue avpr2 folding mutants from both the er ( type a ) and the er / golgi intermediate compartment ( type b ) have been identified and potentially , these chaperones can be used in vivo to rescue patients carrying avpr2 mutations leading to ndi [ 20 , 21 ] . since avpr2-l170p - gfp relocalized from the er to the plasma membrane upon treatment with the proteasome inhibitor mg-132 , it is very likely that chaperones could aid in correct folding of the mutant , thereby bypassing lysosomal degradation leading to a rescue of the mutant receptor . | mutations in the arginine vasopressin receptor 2 ( avpr2 ) gene can cause x - linked nephrogenic diabetes insipidus ( ndi ) characterized by the production of large amounts of urine and an inability to concentrate urine in response to the antidiuretic hormone vasopressin .
we have identified a novel mutation in the avpr2 gene ( l170p ) located in the fourth transmembrane domain in a danish ndi male .
analysis of the mutant receptor in madin - darby canine kidney cell culture revealed that avpr2-l170p was retained in the endoplasmic reticulum , and the expression was dramatically downregulated compared to wild - type avpr2 .
inhibition of the lysosome resulted in increased intracellular accumulation of avpr2-l170p , indicating that avpr2-l170p is downregulated via the lysosome .
inhibition of the proteasome resulted in plasma membrane localization of avpr2-l170p , although the overall levels of avpr2-l170p were unchanged . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
based on the general census of population and housing in iran in 2006 , aged people over 65 years comprise about 5.19% of the total population of iran ( 70 million ) . old age is a period during which changes occur in shape and function of internal and external organs and they impair individuals adaptation with the environment . various studies also emphasized on an increase in burden of diseases and disability in the elderly . it comprises a noteworthy portion of health care and treatment service receivers in geriatric health system . high prevalence of diseases and disability among aged people creates a higher demand for the care given to this group by experienced and professional staff , which is mostly provided by nurses . experts have stated that the best way to fulfill aged people 's needs is through promotion of nurses knowledge concerning the needs of geriatric group . if less experienced and untrained nurses are hired to take care of the aged people , the quality of care becomes less . some evidences show that the attitude toward aged people is among the elements determining the quality of care they are given such that individuals more positive and emotional attitude toward the aged people brings about a more satisfactory life for them . therefore , some researchers tried to investigate nurses attitude toward the aged people and its association with various factors . for instance , hosseini seresht showed that the first year nursing students had negative , third year students had neutral , and working nurses had a positive attitude toward aged people . mellor , in a study on nurses attitude toward the aged people , reported a significant difference between education level and the attitude toward the aged people . various factors , mentioned in some of the aforementioned studies , seem to explain the differences in individuals attitudes toward the aged people . if we refer to psychological background of individuals behavior and attitudes , the role of their personality characteristics in prediction of their specific behavior and attitudes toward various phenomena is highlighted . based on definition , personality is a pattern of thoughts , feelings , and behavior , resulting from personal characteristics , accompanied with hidden and observable strategies that are masked by that pattern . nowadays , the big five personality dimensions , introduced by goldberg , have been widely accepted and adopted to define most of the personality aspects of individuals . selection of the appropriate personality can improve a better occupational function for the organization and affect the staff 's attitude toward their own work . in fact , individuals personality plays a key role in their occupational function as it frames their motivation and attitude toward their occupation and the way they respond to occupational demands . although the determining role of individuals personality characteristics in their behaviors and attitudes has been emphasized , this important issue has not been mentioned in nursing texts . on the other hand , despite the warnings about the existence of a negative attitude toward the aged people , even among the health system staff , this issue has not been taken seriously and their determinants have not been detected yet . finally , despite discovering the important role of individuals personality in prediction of their specific behaviors and attitudes , no study has been conducted on the predictive role of nurses personality characteristics in determination of their attitude and , consequently , their function in provision of health services to the aged people . therefore , the present study aimed to investigate the association between nurses personality characteristics and their attitude toward the aged people . subjects comprised 261 nurses working in selected university hospitals in isfahan , who were selected through random stratified sampling . after calculation of sample size , the number of subjects in each hospital , as well as their number in each ward ( according to the number of hospitalized aged people in that center and its wards ) was determined . researcher 's access to the subject was made possible after obtaining respective official permission and by coordinating with the head nurses of the wards . nurses with a bachelor 's degree or above were selected , and after receiving necessary information about the goals of the study and its process , they signed an informed consent form . researcher referred to the wards in different shifts and collected the data by a questionnaire . this questionnaire contains 44 items scored in a five - point likert 's scale ( absolutely disagree = 1 to absolutely agree = 5 ) , divided into five sub - scales ( representing the five dimensions of personality ) , including extroversion ( 8 items ) ; agreeableness ( 9 items ) , consciousness ( 9 items ) , neuroticism ( 8 items ) , and openness ( 10 items ) . the scoring was done by adding up the scores of the items in each sub - scale . validity and reliability of the persian version of kogan 's attitudes toward older people scale ( kaops ) were confirmed by karshki and garavand . its content validity was reported to be 0.88 ( by experts indications ) , and its internal consistency was established by cronbach alpha ( = 0.81 ) . validity and reliability of five personality dimension model questionnaire were established by fossati et al . among italian subjects . reported cronbach alpha of over 0.75 for all its dimensions and reliability of over 0.70 ( r = 0.70 ) for this questionnaire . to investigate the demographic characteristics of the study population , a demographic and occupational questionnaire including age , sex , work experience , type of employment , educational degree , marriage , history of living with an older adult , and the nurses related ward of hospital was adopted . collected data were analyzed by descriptive and inferential statistical tests ( correlation coefficient , multiple linear regression analysis ) through spss 17 . in regression analysis , personality dimensions and personal and occupational characteristics as predictive variables and nurses attitude as criterion variable were entered in the model . the present study was approved by the ethics committee of isfahan university of medical sciences and all ethical considerations including subjects volunteer participation and confidentiality of their data were respected . the present study was approved by the ethics committee of isfahan university of medical sciences and all ethical considerations including subjects volunteer participation and confidentiality of their data were respected . results showed that out of 261 nurses , 193 ( 73.9% ) and 68 ( 26.1% ) were female and male , respectively . subjects mean [ standard deviation ( sd ) ] age and work experience were 34.92 ( 7.19 ) and 10.86 ( 7.33 ) years , respectively . about 62.1% of the subjects were married , 0.8% were widowed , 0.4% were divorced , and 36.8% were single . most of the subjects were either a permanent staff ( 35.6% ) or a casual staff ( 35.6% ) and had the history of living with an older adult ( 53.3% ) , while most of them had no history of professional care of an older adult ( 67% ) . mean ( sd ) of subjects attitude scores are presented in table 1 , and mean ( sd ) of five personality dimensions scores are presented in table 2 . for multiple regression analysis assumptions provision , the data were evaluated and skewness and kurtosis values were proved in an appropriate range of 2 , revealing the normal distribution . tolerance and volume of inflation ( vif ) values were also in appropriate range , revealing absence of linearity of predictive variables . results showed that predictive model of nurses attitude , based on their five personality dimensions , was significant ( p = 0.001 , f12,243 = 2.992 ) . the entered predictive variables explained 13% of variations related to attitude in the model ( r=0.13 ) . the obtained results of multiple regression analysis evaluating the association of predictive variable with attitude are briefly presented in table 3 . results showed that none of the subjects personal or occupational characteristics were correlated with nurses attitude toward the aged people . among the variables of personality , two variables of agreeableness and neuroticism significantly predicted nurses attitude toward the aged people . mean and standard deviation ( sd ) scores of nurses attitude toward the aged people ( n=261 ) mean ( sd ) scores of five dimensions of nurses personality ( n=261 ) multiple regression analysis results to evaluate the predicting variables of attitude the present study was conducted with the goal of defining the association between nurses personality characteristics and their attitude toward aged people in the university hospitals of isfahan . in general , the results showed that among the variables associated with personality characteristics , two variables of agreeableness and neuroticism could significantly predict nurses attitude toward aged people . existence of a positive and significant association between agreeableness in nurses and their attitudes toward aged people showed that nurses with the personality characteristic of agreeableness were more appropriate to work with the clients . in addition to having a more positive attitude toward aged people , they have more desire to work with them and are able to make a more efficient communication with the old patients , which is in line with other studies . believe that individuals with more agreeableness have a spirit of cooperation , are more reliable , have a more positive approach toward their function , and even understand the negative aspects of working environment . they also believe that a person with agreeableness has more philanthropy and likes to have empathy , cooperation , and supportiveness in his / her interpersonal communications . daff , singh and singh , and van emmerlik and euwema showed that agreeableness is positively and significantly associated with citizens organizational behavior . it seems that existence of such specifications in people with agreeableness can reveal their positive attitude toward the aged people , which is consistent with the present study . results also showed that neuroticism had a significant negative association with nurses attitude toward aged people , which is in line with some other studies . believe that individuals with neuroticism experience signs such as anxiety , insecurity , anger , and negative attitude toward others , which leads to their reduced personal success and , consequently , results in negative effects on their treating the clients . some evidences show that high scores of neuroticism are accompanied with lack of emotional stability and negative emotions such as fear , sadness , confusion , anger , guilt , and hatred , and people with neuroticism are more prone to impulsiveness , aggression , and vulnerability . therefore , existence of such characteristics in nurses with neuroticism can result in their negative attitude toward the specific and vulnerable clients , including the aged people . although the present study did not focus on investigation of psychological and behavioral outcomes of neuroticism in nurses , some other existing studies investigated the psychological and behavioral outcomes of neuroticism in nurses and reported miserable outcomes among these people . for instance , van emmerik and euwema reported a significant negative association between neuroticism and citizens organizational behavior dimensions . regression analysis carried out in the study of alizadeh goradel showed that neuroticism is a significant predictor of occupational burnout . all these evidences support the conclusion that nurses with neuroticism are not an appropriate choice to be hired to work with the aged people , as these clients have more complicated needs , compared to others . in the present study , three variables of extroversion , conscientiousness , and openness were not significantly associated with nurses attitude toward the aged people , which is not in line with the findings of other studies . as the positive emotions of extrovert people can make them hopeful about their future occupational function , they are expected to have lower levels of emotional burnout and , consequently , more appropriate function and attitude toward the aged people . they also reported a significant negative association between conscientiousness and all dimensions of occupational burnout . as people with conscientiousness are conscious and accountable with a positive occupational motivation , they are expected to have a more positive attitude and desire to play a role in different situations , including working with the aged people . in fact , people with a high level of openness are more curious and creative toward their environment and , consequently , they have fewer levels of the anxiety and confusion . therefore , they are expected to have a more appropriate approach toward the aged people . this result is also inferred from other studies including swider , shimizutani , and azeem . meanwhile , the results of the present study showed no significant association between the three variables of extroversion , conscientiousness , and openness . the difference in results might have originated from the different socio - cultural factors of the study populations . it should be noted that some limitations could have affected the results , including the fact that five - factor personality measurement does not contain all personality characteristics affecting the attitude toward the aged people . moreover , the multiple regression model , ignore measurement error and , consequently , can not clarify all factors and specifications associated with nurses attitude toward the aged people . the results showed that the variable of agreeableness was significantly and positively associated with nurses attitude toward the aged people , and neuroticism had a negative significant association with their attitude toward the aged people . thus , nurses with higher agreeableness and lower neuroticism can be an appropriate option for the aged people . therefore , nurse managers are suggested to take steps toward creating a more positive attitude toward the aged people among nurses , in addition to holding educational programs for them with the goal of agreeableness empowerment . | background : administration of quality care in the aged people requires having a positive attitude toward them .
numerous factors including nurses personality characteristics may play a role in their attitude toward the aged people .
therefore , the present study investigated the association between nurses personality characteristics and their attitude toward the aged people.materials and methods : this is a cross - sectional study conducted on 261 nurses selected through random stratified sampling .
kogan 's attitudes toward older people scale ( kaops ) was adopted to measure nurses attitude toward the aged people , and five - factor personality inventory was used to detect their personality dimensions .
the data were analyzed by descriptive and inferential statistical tests ( pearson correlation coefficient and multiple linear regression ) .
p < 0.05 was considered significant.results:results showed that the predictive model of nurses attitude toward aged people based on their five - factor personality dimensions was significant ( p = 0.001 ) .
overall , the variables , entered in the model , predicted 13% of variance of nurses attitude toward aged people . among the predicting variables , two dimensions of personality , including agreeableness ( p = 0.046 ) and neuroticism ( p = 0.003 ) , significantly predicted nurses attitude toward aged people.conclusions:the results showed that nurses with higher agreeableness and lower neuroticism can be an appropriate option in caring for the aged people .
therefore , nurse managers are suggested to take steps toward creating a more positive attitude toward the aged people among nurses , in addition to holding educational programs for them with the goal of agreeableness empowerment . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
african animal trypanosomiasis ( aat ) is caused by trypanosoma congolense , trypanosoma vivax , and trypanosoma brucei . trypanosomiasis is a debilitating disease of man and domestic and wild animals which is often characterized by anemia , reduced productivity , and high mortality [ 13 ] . it is a major constraint to the development of livestock in sub - saharan africa [ 2 , 4 ] . the chemotherapy of african trypanosomes is beset with several problems ; these include limited repertoire of trypanocides , resistance to drugs , and toxicity to a protracted treatment protocol [ 57 ] . decades of attempts to create a vaccine against trypanosomes have failed due to the development of variable surface glycoprotein , a defense mechanism against the immune system . economic considerations of the pharmaceutical industry outweigh all others , because of the very low return of the developmental costs . these factors emphasize the need for research into better and cheaper and eco - friendly trypanocides . plants are an important part of the culture and traditions of africa as most rural communities in african are highly reliant on medicinal plants for their health care needs ; this is due to the accessibility and affordability of these plants . the search for new drugs from natural sources is a widely used approach that has been successful in the detection of compounds for the treatment of some parasitic diseases [ 10 , 11 ] . extracts as well as pure compounds obtained from plants have been reported to possess significant antiprotozoan activities with no side effects [ 12 , 13 ] . ximenia americana is a plant used in traditional medicine for the treatment of malaria , leproutic ulcers , and infectious diseases [ 1417 ] . the plant has been reported to show antimicrobial , antifungal , anticancer , antitrypanosomal , antioxidant , analgesic , and antipyretic properties [ 1721 ] . the crude extracts consist of complex mixture of compounds which include flavonoids , saponins , alkaloids , quinines , terpenoids , glycosides , and steroids [ 14 , 16 , 19 ] . we have previously reported the trypanocidal activity of ximenia americana aqueous extract against the bloodstream form of trypanosoma congolense . the studies were done to determine if the extracts of ximenia americana had any effect on the dna of trypanosoma congolense in vitro . trypanosoma congolense ( federe strain ) was obtained from the nigerian institute of trypanosomosis research , vom , plateau state , nigeria , and passaged into rat which was subsequently maintained by passages in mice . two hundred ( 200 gm ) grams of the stem bark powder was weighed into a thimble and then transferred into a soxhlet extractor and extracted sequentially with petroleum ether , methanol , and water . the extracts were individually collected after each extraction and concentrated using a rotary evaporator ( buchi , switzerland ) at 50c under reduced pressure and then dried . the solvent free extracts were then weighed and stored in brown bottles at 4c until use . briefly , slurry was prepared by shaking 120 g of silica gel ( qualikems , 60120 mesh powder ) with 200 ml of water and methanol in the ratio of ( 1 : 1 ) and then packed in a column ( 1.5 30 ) at a flow rate of 0.2 ml / min . the column was loaded with 20 ml of the aqueous extract that had been previously adsorbed from distilled water on 4 g of the silica gel and then eluted with four solvent mixtures ( ethyl acetate / methanol 19 : 1 ; benzene / methanol 19 : 1 ; acetic acid / methanol 1 : 1 ; water / methanol 1 : 1 ) in order of increasing polarity . a total of 5 mls of the eluents were collected in separate beakers and dried at 50c using a water bath . the fractions were tested for antitrypanosomal activity and fraction iv ( water / methanol 1 : 1 ) which had the highest activity was used for the experiment . three apparently healthy rats were infected with t. congolense at peak parasitemia ( 10 parasite / ml of blood ) , the animals were sacrificed , and blood was immediately collected in heparinized tubes containing three ( 3 ) ml of phosphate buffer saline glucose . the blood containing parasites was divided into three replicates of three groups ; each tube containing 2 ml of blood was incubated with the extract at 37c in a water bath as follows . group a1 : incubated with aqueous extract ( 300 mg / ml ) for 30 minutes . group b1 : incubated with fraction iv ( 25 mg / ml ) for 30 minutes . group a2 : incubated with aqueous extract ( 300 mg / ml ) for 1 hour . group b2 : incubated with fraction iv ( 25 mg / ml ) for 1 hour . group a3 : incubated with aqueous extract ( 300 mg / ml ) for 2 hours . group b3 : incubated with fraction iv portion ( 25 mg / ml ) for 2 hours . group a1 : incubated with aqueous extract ( 300 mg / ml ) for 30 minutes . group b1 : incubated with fraction iv ( 25 mg / ml ) for 30 minutes . group a2 : incubated with aqueous extract ( 300 mg / ml ) for 1 hour . group b2 : incubated with fraction iv ( 25 mg / ml ) for 1 hour . group a3 : incubated with aqueous extract ( 300 mg / ml ) for 2 hours . group b3 : incubated with fraction iv portion ( 25 mg / ml ) for 2 hours . at the end of the time intervals the trypanosomes were washed 3 times with pbsg by centrifugation and decantation to concentrate and store at 4c prior to use . the parasite dna was extracted using zr genomic dna kits from zymo research south africa according to the manufacturers recommended protocol . after isolation of the dna from the treatment groups , the groups a , b , and c were each divided into two portions , to the first portion it was the uncut dna ( groups a1 , b1 , and c1 ) , to the second portion ( groups a2 , b2 , and c2 ) , it was 5 l portions of the genomic dna incubated with 5 l of ecor1 concentration 10 /l in 10 l ecor1 buffer in a water bath at 37c for 1 hour . the amplification of the dna was carried out according to manufacturers protocol ( fermentas ) ; briefly , pcr master mix 2x was gently vortexed after thawing . then 25 l of maxima hot start green pcr mix 2x was measured by a pcr tube followed by the addition of 0.1 l forward primer tcs1 ( 5dcgagaacgggcactttgcga3 ) and reverse primer tcs2 ( 5dggacaacaaagaaatcccgcaca3 ) , respectively ; this was followed by the addition of 1 l of dna template then 23.8 l of nuclease free water was added to make 50 l volume . reaction mixture was gently vortexed and the samples spun down then were loaded into the thermal cycler to undergo amplification according to masiga et al . . the reaction conditions were as follows : ( 30 cycles ) 94c for 60 s , 55c for 120 s , and 72c for 120 s. about 0.8 grams of agarose was dissolved by heating in 100 ml 1x tris acetic acid and ethylenediaminetetraacetic acid ( tae buffer ) ( ph 7.9 ) in a microwave oven set for 2 minutes . after cooling , 2 l ethidium bromide stock ( 100 mg ethidium bromide tablet dissolved in 10 ml distilled water and stored in foil - covered bottle to protect from light ) was added and mixed with the gel . 30 mls of 1x tae buffer was added to the tank and the combs were removed by pulling it out straight up . bromophenol tracking blue was used as the loading dye ( 0.001 gram bromophenol blue in 1 ml distilled water and 9 ml 40% sucrose solution made in 1x tae ) . two ( 10 l ) of the marker and samples were separately mixed on a paraffin paper with 2 l loading dye . the first well was loaded with the control dna , the subsequent wells were loaded with extract treated dna , and the last well was loaded with 1 kb molecular marker . electrophoresis was carried out for 45 minutes at 80 v. gels were removed and viewed under ultraviolet radiation for resolved bands ; the gel was photographed and documented . the in vitro extract treated trypanosomes with 300 mg / ml aqueous extract and 25 mg / ml fraction iv portion induced 55% and 90% cell death of the parasites after 30-minute incubation , respectively . the dna of the treated and untreated parasites incubated for 30 , 60 , and 120 minutes was isolated and electrophoresed and was observed to have high molecular weight bands of > 1400 bp ( figures 1(a ) , 1(b ) , and 1(c ) and lanes 2 , 3 , and 4 ) . the bands were detected at the same area with the untreated control group lane 4 . amplification of the extract treated and untreated parasite dna using pcr is shown ( figure 2 ) . the amplification resulted in a specific size band of > 300 bp which is specific for trypanosoma congolense for all the groups . the emergence and spread of resistance to antitrypanocidal drugs have highlighted the need for the discovery and development of novel antitrypanocidal leads . one of the approaches used in chemotherapy of parasites relies on testing for biological activity of plant extracts . the results of the in vitro incubation of the aqueous extracts and fraction iv portion of ximenia americana showed they had activity against the parasites . the results corroborate those of earlier studies on medicinal plants having antitrypanosomal activity [ 2 , 4 , 6 , 24 , 25 ] . however , studies of antitrypanosomal activity of plant extracts are mostly limited to testing the ability to inhibit parasite growth in vitro and in vivo . it is difficult to speculate the mechanism by which the extracts exhibited their trypanocidal action . phillipson and o'neil and atawodi et al . speculated that plant extracts could bind with the kinetoplast dna of the parasite . dou and li , kumar et al . , el - shemy et al . , and saboo et al . hence , we decided to examine if the mode of trypanocidal action was through the binding of the aqueous extracts and fraction iv portion to the dna of the parasite . rosenkranz and wink had earlier reported that plant natural product can interact with molecular target such as dna and could damage it by fragmentation . dna fragmentation occurs when endogenous endonucleases or natural products cleave the chromatin dna into internucleosomal fragments of 180 bp and their multiples . the results of the agarose gel dna analysis of the in vitro extract treated parasites did not reveal any dna fragments of less than 500 bp , suggesting that death of the parasites was not as a result of dna fragmentation . the ecor1 digest of trypanosoma dna also did not reveal any change in band size of dna from the untreated group . our result is similar to who reported that azadirachta indica extracts failed to cause dna fragmentation in some cancer cells . the result differs from who reported that some plant extracts with trypanocidal effect also fragmented trypanosome dna causing cell death . the findings of this investigation clearly show that the aqueous extract and fraction iv portion of ximenia americana had antitrypanosomal potentials but did not indicate that trypanosome death was as a result of dna fragmentation . further work is on to purify , isolate , and characterize the active principle of fraction iv portion of the extract of ximenia americana . | trypanosomosis is a debilitating disease affecting mainly livestock and humans in tropical africa .
chemically synthesized drugs and medicinal plants have been used in the treatment and control of this disease . in this study ,
the in vitro effect of aqueous extracts and fraction iv extract of ximenia americana stem bark on trypanosoma congolense dna was investigated .
the extracts were incubated with the parasites in vitro at 300 mg / ml aqueous extract and 25 mg / ml fraction iv portion for 30 , 60 , and 120 mins .
the dna of the trypanosomes was isolated and digested using ecor1 enzyme and subsequently pcr was carried out .
results showed that aqueous extract and fraction iv portion immobilized 55% and 90% of the trypanosomes after 30-minute incubation .
subsequent isolation of the parasite dna and agarose gel electrophoresis did not reveal that cell death was as a result of dna fragmentation .
this suggests that cell death was by another mechanism of action . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
occult diaphragmatic perforations due to stab wounds rarely cause initial symptoms and are usually missed by most currently used clinical and radiologic methods . abdominal organ herniation due to diaphragmatic injury was first described by sennertus in 1541.(1 ) the first successful repair was performed by riolfi in 1886.(2 ) the reported incidences of thoraco - abdominal penetrating diaphragmatic injuries are between 10 - 42%.(3,4 ) these lesions are usually smaller in size than blunt injuries and are therefore associated with a greater risk of obstruction and strangulation . the reported rates of initially undiagnosed case are between 12 to 60% . ( 5 ) we report a case of delayed presentation of penetrating diagrammatic injury manifesting as incarcerated gastric herniation . the need for identifying diaphragmatic injury during the initial admission a 23 yr old male presented to the casualty with complaints of severe epigastric and lower chest pain , and vomiting of two days duration . three months back , he had sustained three stab wounds : one over the right lower chest and two over the right upper abdomen . at that time , thoraco - abdominal radiography , ultrasonography and computed tomography scan ( ct ) were normal . however , we had advised surgical exploration , but the patient and his relatives were reluctant and decided to seek treatment elsewhere . he was discharged shortly afterwards and remained asymptomatic until now . during the present admission , clinical examination revealed tenderness over the epigastric region with decreased air entry on the left side of the chest . a ct scan was performed which showed almost the entire stomach , grossly distended and herniating through the left hemi - diaphragm into the thorax(figure1 ) . axial ct image of the thorax shows a dilated contrast filled stomach occupying almost the entire left hemi - thorax reformatted coronal and sagittal views helped demonstrate the hernia better.(figure 2,3 ) at emergency laparotomy the stomach along with the omentum was seen herniating through a 4 cm long rent in the antero medial aspect of the left hemi diaphragm . another rent about 2 cm long was seen 5 cm below this . the stomach was incarcerated and appeared congested . the stomach and omentum which were viable were reduced into the abdominal cavity and the defects were primarily repaired . an intercostal drain was instituted in the left hemithorax . ct scan : sagittal reconstruction showing the stomach(with contrast ) herniating into the thorax through a defect in the diaphragm-collar sign / hourglass sign. ct scan : coronal reconstruction showing the incarcerated gastro - thorax , the ryles tube can be clearly seen entering the herniated stomach . the second ( delayed ) phase is usually asymptomatic , associated with herniation of abdominal contents and may occur over months or years . the third ( obstructive ) phase is characterized by complications such as incarceration , strangulation and perforation . in asymptomatic patients with thoraco - abdominal stab wounds , the risk of an occult diaphragmatic injury is approximately 7% , and a mortality rate of 36% following delayed recognition . ( 6,7 ) diaphragmatic perforations following penetrating injuries are frequently associated with left sided wounds . in a study of 97 patients , the overall incidence of occult diaphragmatic injuries in left - sided thoracoabdominal stab wounds was 4 of 24 ( 17% ) , and was much lower after stab wounds of left epigastrium ( 0% ) , right lower chest ( 0% ) , and right epigastrium ( 4% ) . this case also highlights the rare situation of left sided diaphragmatic injury due to right sided stab wounds . the clinical features of delayed presentations are often nonspecific and include abdominal pain , nausea , vomiting , dysphagia , chest pain and dyspnoea . the interval between injury and the onset of symptoms can range from several weeks to years . the delay in diagnosis may due to absence of symptoms at the time of injury as the herniation has not yet occurred . chest radiography is the first line investigation but may be inconclusive and findings may include elevation of the hemidiaphragm , a bowel pattern in the chest , or a naso gastric tube passing into abdomen and entering the chest . ct is the mainstay in diagnosis of diaphragmatic rupture with a reported sensitivity of 71% and specificity of 100% . ( 8) several other techniques have been proposed to investigate tdh.(9 ) laparoscopy has been recommended as a new tool for detecting occult diaphragmatic injuries in the absence of other indications for formal laparotomy.4 ct scan was useful in diagnosing this condition in our case . surgical treatment of long - standing post traumatic diaphragmatic rupture is similar to that of non traumatic diaphragmatic hernias . it is strongly suggested that penetrating injuries should be routinely explored surgically , even in asymptomatic patients so as to identify occult diaphragmatic injury and prevent delayed strangulation.(10 ) | diaphragmatic injuries due to thoraco - abdominal penetrating trauma may often go unnoticed at the initial admission , especially in patients who are asymptomatic , with stable hemodynamic and respiratory parameters .
such occult diaphragmatic perforations can result in latent morbidity and mortality due to delayed trans - diaphragmatic herniation of the abdominal viscera leading to incarceration , strangulation and perforation . here
we report a case of an initially asymptomatic patient who had sustained multiple truncal stab injuries and presented two months later with a trans - thoracic incarceration of the stomach which was accurately diagnosed and successfully repaired at the time of surgery .
this case report highlights the importance of exploring thoraco - abdominal penetrating injuries even in the absence initial clinical and radiological signs , so as to promptly identify occult and isolated diaphragmatic perforations and prevent delayed catastrophes .
the clinical features , radiological findings , diagnostic difficulties and surgical options are discussed along with review of relevant literature . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
enterococci strains are widespread in nature ( soil , water and foods ) and have been shown to play an important role in contributing to ripening and flavouring processes of certain foods ( foulquie et al . , 2006 ; franz et al . , 1999 ) . in addition to contribution of quality of finished products , some strain of enterococci are believed to be involved in the preservation of foods against food borne pathogens such as listeria monocytogenes with bacteriocin ( ahmadova et al . , 2013 ) . even though enteroccoci were used to be considered as harmless inhabitants of the gut flora of humans and animals , these organisms are one of the leading causes of nosocomial infections ( leavis et al . , 2006 ) . e. feacalis and e. faecium are by far the most prevalent species accounting for over 90% of these infections worldwide ( treitman et al . , 2005 ) . infections associated with enterococci used to be treated successfully with antibiotic treatments , but many antibiotics are currently less effective resulting in longer hospitalization periods , treatment failure and significant financial burdens ( diazgranados et al . , 2005 ) . this rapid and global dissemination of multidrug resistant strains were attributed to the imprudent and overuse of antibiotics in human and veterinary practices as well as inappropriate use in animal production ( borgen et al . , 2000 ) . there are a number of well - established international organizations and government agencies such as the japanese veterinary antimicrobial resistance monitoring system and danmap to monitor antibiotic resistance in order to perform risk assessment for public health ( harada and asai , 2010 ) . in recent years , efforts have been made to provide some knowledge on the prevalence of enterococci from foods of animal origin , and their antimicrobial resistance worldwide ( hammad et al . there is evidence supporting the potential transmission of enterococci via the consumption of contaminated foods of animal origin ( olsen et al . , 2012 ) . based on the importance of the emergence of antimicrobial resistant strains of pathogens in foods of animal origins , some studies have examined the prevalence and the frequency of antimicrobial resistance in enterococci from different retail samples in turkey ( itak et al . , 2004 ; koluman et al . , 2009 ; zmen toay et al . , 2005 ) , however no study has been conducted regarding the genetic mechanisms of resistance to aminoglycosides , erythromycin , tetracycline and vancomycin among enterococci isolated from cheese in turkey . therefore , the biodiversity of the enterococcal species isolated from eleven different cheeses and their antibiotic resistance profile was determined in this study . in total , one hundred cheese samples were randomly collected from supermarkets , retail markets and open - air markets between january and july 2014 in hatay , turkey . the analysed - cheeses consisted of eleven different types of hard , soft and semi - soft ripened cheeses ( white , kasar , tulum , ezine , antep , slk , lor , van otlu , civil , orgu and dil ) and manufactured in different geographical areas of turkey . all these cheese samples were collected in sterile bags and transferred in ice - boxes and investigated immediately after arrival at the laboratory . from each cheese , 25 g of sample was removed and blended for 2 min in a stomacher ( bagmixer 400p , interscience , france ) with 225 ml of buffered peptone water ( ph 7.0 ) . homogenised cheese samples were incubated overnight at 37. after that , an aliquot of 100 l of enriched suspension was added into enterococcal broth and incubated at 37 for 24 h. post - enrichment , 10 l of this was streaked on the enterococcal agar with and without vancomycin ( 6 mg / l ) . from each agar plates , 1 - 2 suspected colonies with typical enterococci morphology were picked and plated on the blood agar plates . the isolates were identified biochemically by using vitek2 system ( biomrieux , marcy - l'toile , france ) . the susceptibility pattern determination was performed by disk diffusion method on mueller hinton agar with antibiotic disks according to the clinical laboratory standards institute ( clsi , 2012 ) . fifteen different antibiotics were used : gentamicin ( 10 g / disc and 120 g / disc ) , streptomycin ( 300 g / disc ) , kanamycin ( 30 g / disc ) , ciprofloxacin ( 5 g / disc ) , vancomycin ( 30 g / disc ) , teicoplanin ( 30 g / disc ) , linezolid ( 30 g / disc ) , lincomycin ( 10 g / disc ) , erythromycin ( 15 g / disc ) , penicillin ( 10 g / disc ) , ampicillin ( 10 g / disc ) , tetracycline ( 30 g / disc ) , chloramphenicol ( 30 g / disc ) , rifampin ( 5 g / disc ) and quinopristine / dalfopristine ( 4.5/10.5 g / disc ) . e. casseliflavis ( atcc 700327 ) and staphylococcus aureus ( atcc 29213 ) strains were used as positive controls . genomic dna was extracted by using genematrix bacterial & yeast genomic dna purification kit ( eurx ltd . dna to be analyzed was stored at 20. the identification of the genes ( erma , ermb , mefa / e , tetk , tetl , tetm and teto ) that involve in tetracycline and macrolide resistance was performed by a multiplex - pcr approach according to malhotra - kumar et al . all vancomycin resistant , including intermediate resistant , enterococci were screened for resistance genes ( vana , vanb , vanc1/2 , vand , vane , vang ) by pcr as previously described ( depardieu et al . , 2004 ) . the presence of aminoglycosides resistance associated genes ( aac(6)-ie - aph(2)-ia , aph(2)-ib , aph(2)-ic , aph(2)-id , aph(3)-iiia , ant(4)-ia ( vakulenko et al . , 2003 ) and chloramphenicol resistance gene ( cat ) ( aarestrup et al , . 2000 ) were also determined by pcr . in total , one hundred cheese samples were randomly collected from supermarkets , retail markets and open - air markets between january and july 2014 in hatay , turkey . the analysed - cheeses consisted of eleven different types of hard , soft and semi - soft ripened cheeses ( white , kasar , tulum , ezine , antep , slk , lor , van otlu , civil , orgu and dil ) and manufactured in different geographical areas of turkey . all these cheese samples were collected in sterile bags and transferred in ice - boxes and investigated immediately after arrival at the laboratory . from each cheese , 25 g of sample was removed and blended for 2 min in a stomacher ( bagmixer 400p , interscience , france ) with 225 ml of buffered peptone water ( ph 7.0 ) . homogenised cheese samples were incubated overnight at 37. after that , an aliquot of 100 l of enriched suspension was added into enterococcal broth and incubated at 37 for 24 h. post - enrichment , 10 l of this was streaked on the enterococcal agar with and without vancomycin ( 6 mg / l ) . from each agar plates , 1 - 2 suspected colonies with typical enterococci morphology were picked and plated on the blood agar plates . the isolates were identified biochemically by using vitek2 system ( biomrieux , marcy - l'toile , france ) . the susceptibility pattern determination was performed by disk diffusion method on mueller hinton agar with antibiotic disks according to the clinical laboratory standards institute ( clsi , 2012 ) . fifteen different antibiotics were used : gentamicin ( 10 g / disc and 120 g / disc ) , streptomycin ( 300 g / disc ) , kanamycin ( 30 g / disc ) , ciprofloxacin ( 5 g / disc ) , vancomycin ( 30 g / disc ) , teicoplanin ( 30 g / disc ) , linezolid ( 30 g / disc ) , lincomycin ( 10 g / disc ) , erythromycin ( 15 g / disc ) , penicillin ( 10 g / disc ) , ampicillin ( 10 g / disc ) , tetracycline ( 30 g / disc ) , chloramphenicol ( 30 g / disc ) , rifampin ( 5 g / disc ) and quinopristine / dalfopristine ( 4.5/10.5 g / disc ) . e. casseliflavis ( atcc 700327 ) and staphylococcus aureus ( atcc 29213 ) strains were used as positive controls . genomic dna was extracted by using genematrix bacterial & yeast genomic dna purification kit ( eurx ltd . dna to be analyzed was stored at 20. the identification of the genes ( erma , ermb , mefa / e , tetk , tetl , tetm and teto ) that involve in tetracycline and macrolide resistance was performed by a multiplex - pcr approach according to malhotra - kumar et al . all vancomycin resistant , including intermediate resistant , enterococci were screened for resistance genes ( vana , vanb , vanc1/2 , vand , vane , vang ) by pcr as previously described ( depardieu et al . , 2004 ) . the presence of aminoglycosides resistance associated genes ( aac(6)-ie - aph(2)-ia , aph(2)-ib , aph(2)-ic , aph(2)-id , aph(3)-iiia , ant(4)-ia ( vakulenko et al . , 2003 ) and chloramphenicol resistance gene ( cat ) ( aarestrup et al , . 2000 ) were also determined by pcr . although the importance of enterococci in food industry as probiotics and starter cultures is unquestioned , they have commonly been implicated in nosocomial infections worldwide ( arias et al . , having demonstrated that the virulence traits in enterococci strains from food samples were found to be identical to those obtained from humans suggesting that the consumption of animal foods could be a significant source of enterococcal infections ( olsen et al . , 2012 ) . enterococci can tolerate high concentration of salt and contaminate milk and its products easily due to poor hygienic practices at any point of manufacturing . hence , the incidence and prevalence of enterococci in foods of animal origin have been examined worldwide . presently , there are some data on the presence of enterococci at the concentration up to 10 cfu / g in cheese samples in turkey ( aygun et al . , 2005 ; zmen toay et al . , 2010 ) . out of 100 cheese samples , 99 contained enterococci with 61.2% of the isolates identified as e. faecalis , 15.1% as e. faecium , 12.9% as e. gallinarum , 5.0% as e. durans , 2.9% as e. casseliflavis and 2.9% as e. avium in the current study . in turkey , the prevalence of enterococci in cheese samples was reported to range between 60 and 100% according to the prior studies ( itak et al . , 2004 ; koluman et al . , 2009 ; zmen toay et al . , 2010 ) . the most recently observed prevalence of enterococci in dairy products in other countries include 100% in brazil ( furlaneto - maia et al . , 2014 ) , 90% in egypt ( hammad et al . , 2015 ) , 72% in france ( jamet et al . , 2012 ) and 27% in italy ( pesavento , 2014 ) . the prevalence and species distribution of enterococci in foods of animal origin varies by country and type of foods . it was also previously shown that known factors in manufacturing process such as pasteurization of milk can influence the abundance and prevalence of enterococci in the final products ( jamet et al . , 2012 ) . in this study , e. faecalis was found to be the most frequently isolated species which is in accordance to data published in european countries and in turkey ( jamet et al . , 2012 ; koluman et al . , 2009 ; nieto - arribas et al . , 2011 ; zmen toay et al . , 2010 ) . in contrast , there are also some studies reporting e. faecium being the most frequently isolated species ( hammad et al . , 2015 ; tuncer , 2009 ) . enterococci are noted for their intrinsic resistance to aminoglycoside ( low level ) and -lactam antibiotics . the high level resistance to gentamicin and streptomycin is of significant importance because of their use in the treatment of enterococcal infections ( arias et al . , 2010 ) and characterised by no growth zone around the discs ( 120 g for gentamycin and 300 g for streptomycin ) ( clsi , 2012 ) . in the current study , 84.2% ( 117/139 ) of enterococci isolates were found to be resistant to kanamycin , 5.8% ( 8/139 ) to high level streptomycin and 51.1% ( 71/139 ) to gentamycin , whereas high level gentamycin resistance was found in three ( 2.2% ) isolates ( two e. faecalis , and one e. gallinarum ) ( table 1 ) . the multiplex - pcr analysis showed that two e. feacalis isolates harbor the aph(3)-iiia gene and a single e. gallinarum isolate had the acc6-leaph(2)-la gene ( table 2 ) . recently , we detected the aph ( 3)-iiia , ant(6)-ia and aac(6)-ie - aph(2)-ia genes in e. feacalis isolates obtained from chicken meat ( yilmaz et al . , 2016 ) . our results are higher than those recently noted in egypt where only one e. faecium strain with aph ( 3 ) gene was recorded ( hammad et al . , 2015 ) . a recent study from france reported that only 7% of raw cheese samples were contaminated with low level gentamycin of which three strains had the aph2-aac6 gene ( jamet et al . , 2012 ) . in addition , there was no high level gentamycin enterococci found in spanish cheeses ( nieto - arribas et al . , 2011 ) . the occurrence of high level resistance to gentamicin has previously reported among enterococci isolates from clinical infections ( araoka et al . , 2011 ; dorabat et al . , 2010 ) , animals ( choi and woo , 2013 ; liu et al . , 2012 ) and foods of animal origins ( hammad et al . , 2014 ; hammad et al . , 2015 ) . however , to our best knowledge , this study revealed the presence of e. feacalis and e. gallinarum with aminoglycoside resistance genes from cheeses in turkey for the first time . tec , teicoplanin ; va , vancomycin ; cn , gentamicin ; k , kanamycin ; rd , rifampin ; te , tetracycline ; e , erithromycin ; my , lincomycin ; p , penicillin ; amp , ampicillin ; lzd , linezolid ; qd , quinopristine / dalfopristine ; c , chloramphenicol ; s , streptomycin ; cip , ciprofloxacin . va , vancomycin ; cn , gentamicin ; k , kanamycin ; rd , rifampin ; te , tetracycline ; e , erithromycin ; my , lincomycin ; lzd , linezolid ; qd , quinopristine / dalfopristine ; c , chloramphenicol ; s , streptomycin ; cip , ciprofloxacin . the glycopeptide group of antibacterial agents ( vancomycin and teicoplanin ) are recognised as very reliable reserve antibiotics against multi - drug resistance enterococci in humans ( kos et al . , 2012 ) . in 1988 , vancomycin resistant enterococci ( vre ) was first reported in european countries ( leclercq et al . , 1988 ; uttley et al . , 1988 ) , and since then vre have been frequently isolated worldwide . from a total of 100 cheese samples , only five ( 5% ) samples were found to be contaminated with vre in this study ( table 1 ) . of the five vre isolates , three ( 3.5% ) were found to have full resistance while other two were with intermediate resistance . in 2004 , ( 2004 ) revealed a high frequency of vancomycin resistance among e. feacalis and e. faecium from turkish white cheese as high as 96.8% and 76% respectively . however , a more recent report revealed lower levels ( 13.1% ) of intermediate vancomycin resistance among enterococci isolated from fermented foods including cheese in turkey ( zmen toay et al . , 2010 ) . recently , studies reported vancomycin resistance rates among enterococci from dairy products in europe ranging between none in france ( jamet et al . , 2012 ) , and 2% in spain ( nieto- arribas et al . , 2011 ) . there have been nine types of glycopeptide resistance ( vana , vanb , vanc , vand , vane , vang , vani , vanm and vann ) characterized and reported in enterococci so far . despite recent study in which the vana gene was shown to be present in 7% of enterococci obtained from chicken meat in turkey ( yilmaz et al . , similarly , in egypt , 5% of enterococci isolates from egyptian raw karish cheeses were found to be vancomycin resistant but vancomycin resistant genes were not detected in these isolates ( hammad et al . , 2015 ) . the results of this study also demonstrate that vre has decreased dramatically from over 70% in 2004 ( itak et al . , 2004 ) to 5% in the current study . because widespread use of avoparcin as a growth promoting agent in animal production led to emergence of vancomycin - resistant enterococci in humans , animal and animal products , this dramatic decrease might be attributed to the ban of antibiotic usage in animal production starting from 2006 . when the use of avoparcin in animal production was banned in 1996 , the prevalence of vre decreased markedly in european countries ( borgen et al . resistance to other class of antibiotics including erythromycin and tetracycline among enterococci obtained from foods of animal origin has been previously described as a common trait ( hammad et al . , 2015 ; jamet et al . , 2012 ; koluman et al . , 2009 ; nieto - arribas et al . , , the highest resistance was observed for lincomycin ( 88.5% ) ( table 1 ) , which is not surprising as most enterococci were reported to have intrinsic resistance to lincosamides ( klare et al . , 2003 ) . about 11.5 - 34% of the enterococcal isolates were also resistant to tetracycline and erythromycin , respectively . a low level resistance to ciprofloxacin ( 2.9% ) and resistance to chloramphenicol ( 3.6% ) was noticed in this study . yet , all enterococci strains were sensitive to ampicillin and penicillin . antibiotic resistance profile we observed in this study was in accordance with those reported for the fermented turkish foods and chicken meats in turkey ( zmen toay et al . , 2010 ; 2015 ) and cheeses in europe ( jamet et al . , 2012 ; nieto - arribas et al . , the high frequency of resistance to tetracycline among enterococci isolated from animal foods has previously been attributed to its extensive usage in veterinary practice ( hammad et al . , 2015 ) . ( 2004 ) reported higher levels of resistance among enterococci isolated from turkish white cheese sample , which may be related to the ban of antibiotic usage in animal production as a growth promoter in 2006 . this study found that e. feacalis strains were more resistant to antibiotics compared to other species . in a study carried out in italy , e. feacalis strains were found to be resistant to antibiotics more frequently than other species ( pesavento et al . , 2014 ) . in addition , the strains of e. durans were found to be less antibiotic resistant when compared to other species , which is not surprising as e. durans has long been generally used as starter cultures in dairy technology ( litopoulou - tzanetaki et al . the gene encoding 23s rrna methylases , ermb , was found in five e. faecalis strains and in a single e. gallinarum strains ( table 2 ) . of the six tetracycline resistant genes , tetm was present in 26.6% ( 37/139 ) of the isolates , followed by tetl gene that was present in only 2.2% ( 3/139 ) ( table 2 ) . we recently observed tetm as the most predominant gene in tetracycline resistant enterococci found in raw minced meat in turkey ( yilmaz et al . , 2015 ) . the five chloramphenicol resistance e. feacalis strains ( one having intermediate resistance ) had cat gene , but this gene was not present in e. avium strain that was also resistant to choloramphenicol ( table 2 ) . the presence and particular involvement of tetm , tetl , ermb and cat genes for resistance phenotypes has already been presented in enterococci isolated from foods of animal origin including cheese around the world ( hammad et al . , 2014 ; jamet et al . , 2012 ; nieto - arribas et al . , some antibiotics ( quinopristine / dalfopristine , rifampin and linezolid ) examined in this study are critically important classes of antibiotics for the treatment of vre infections evaluated by who ( 2011 ) and there is no data available for their usage in veterinary medicine in turkey . in this study , 46.8% of the isolates were found to be resistant to rifampin and 42.4% were resistant to quinopristine / dalfopristine with e. feacalis ( 64.7% ; 55/85 ) showing higher resistance than e. avium ( 25% ; 1/4 ) , e. gallinarum ( 11.1% ; 2/18 ) and e. faecium ( 4.8% ; 1/21 ) ( table 1 ) . we found that 5.8% of isolates were resistant to linezolid ( six e. faecalis and two e. gallinarum ) . quinopristine / dalfopristine is one of the approved antibiotics for the treatment of vancomycin resistant e. faecium infections ( liu et al . , 2012 ) which necessitates the regular monitoring of resistance against these classes of antibiotics among the isolates obtained from foods of animal origin . as a result , this study does not produce enough evidence to rule out that cheese samples are a definitive vehicle of infection in humans . however , the occurrence of multidrug resistant enterococci in cheese samples highlights a potential source for humans . it seems noteworthy that the presence of antibiotic resistant enterococci in cheese possesses a health risk since vancomycin resistant infections are highly associated with vre colonization in humans ( kim et al . , 2012 ) . in addition , the presence of antibiotic resistance genes detected in enterococci indicates a risk factor for dissemination of genes through food . taking abovementioned results into consideration , some elementary hygiene principles with together quality management in dairy plants have to be applied urgently in order to reduce the frequency of multidrug resistant strains of enterococci in turkey . | the aim of this study was to determine the prevalence of enterococci in cheese samples and to characterize their antimicrobial resistance profiles as well as the associated resistance genes .
a total of 139 enterococci were isolated from 99 cheese samples , the isolates were identified as e. faecalis ( 61.2% ) , e. faecium ( 15.1% ) , e. gallinarum ( 12.9% ) , e. durans ( 5.0% ) , e. casseliflavis ( 2.9% ) and e. avium ( 2.9% ) . the most frequent antimicrobial resistance observed in enterococci isolates was to lincomycin ( 88.5% ) , followed by kanamycin ( 84.2% ) , gentamycin ( low level , 51.1% ) , rifampin ( 46.8% ) and tetracycline ( 33.8% ) . among the isolates , the frequencies of high level gentamycin and streptomycin resistant enterococci strains were 2.2% and 5.8% , respectively .
apart from the mentioned antibiotics , low levels of resistance to ciprofloxacin , erythromycin and chloramphenicol were found .
moreover no resistance was observed against penicillin and ampicillin .
the antimicrobial resistance genes including tetm , tetl , ermb , cat , aph(3)-iiia , ant(6)-ia and aac(6)-ieaph(2)-ia were found in enterococci from turkish cheese samples . in the current study , we provided data for antibiotic resistance and the occurrence of resistance genes among enterococci .
regulatory and quality control programs for milk and other dairy products from farms to retail outlets has to be established and strengthened to monitor trends in antimicrobial resistance among emerging food borne pathogens in turkey . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
, basel , switzerland ) is the most frequently used antiviral agent for the treatment and prevention of influenza , and its use has increased since the influenza a ( h1n1 ) epidemic.1,2 ) with the increased use of oseltamivir , psychiatric symptoms have been reported as side effects . between 1999 and 2007 , a total of 480 million patients worldwide were administered oseltamivir , and psychiatric side effect surveys were conducted in japan ( n=2,772 ) , the united states ( n=190 ) , and other countries ( n=89).3 ) psychiatric side effects were more common in infants and children aged 16 years or younger than in adults ( 2,218 children vs. 833 adults),4 ) and generally occurred within 48 hours of receiving oseltamivir.5,6 ) according to the international classification of diseases 10th revision ( icd-10 ) , the major symptoms include abnormal behavior ( 1,160 events , 38% ) , delusions / perceptual disturbances ( 661 events , 21.7% ) , and delirium or delirium - like events.37 ) these side effects may lead to accidents , injuries , or suicides . unlike research abroad , few studies of the psychiatric side effects of oseltamivir have been conducted in south korea . moreover , despite various epidemiological and experimental studies , few studies have investigated the entire disease cycle from symptom onset and treatment through follow up . it is likely that the extensive use of oseltamivir to treat influenza will continue into the future ; thus , it is important that attention be given to the psychiatric side effects of the drug . a 22-year - old male visited our psychiatry clinic with the major complaints of mood swings , suicidal impulses , auditory hallucinations , memory deterioration , and insomnia , which had occurred several times a day for the past 5 days . twelve days earlier , the patient had developed fever and respiratory symptoms suspected to be indicative of influenza a ( h1n1 ) . ten days before his visit , he was prescribed 75 mg oseltamivir ( tamiflu ) and 650 mg acetaminophen ( tylenol er ; janssen korea , ltd . , seoul , korea ) , which he took in the morning and evening daily for 5 days . nine days before his visit , the diagnosis was confirmed by an influenza a ( h1n1 ) polymerase chain reaction ( pcr ) test , and he continued to take tamiflu as scheduled . during the 5 days that he was taking tamiflu , the patient continued his normal routine , but felt a slight deterioration in mood and memory and suffered from insomnia . the patient s fever and respiratory symptoms were in remission 3 days after the initiation of tamiflu ; however , the deterioration in his mood and memory and the insomnia did not improve significantly . the next day , when he finished the 5-day course of tamiflu , he started to develop significant psychiatric symptoms . he experienced manic symptoms for periods ranging from 10 minutes to 2 hours and then abruptly felt depressed and burst into tears with frequent nihilistic and sin delusions . two days after he finished taking tamiflu and 3 days before his visit , the patient s mood swings and instability grew worse , and he experienced auditory hallucinations similar to a telephone conversation between a man and a woman and text message alarm ringtones for mobile phones . because of his memory deterioration , the patient readily forgot what he had done several hours or days earlier . he was not able to sleep more than 23 hours a day . eventually , the patient visited our psychiatric clinic and was admitted under the suspicion of bipolar disorder , an organic mental disorder such as delirium and encephalitis , and psychotic disorders caused by his drug intake . the patient was admitted to the closed ward and treated with antipsychotic medication by 10 mg intramuscular olanzapine ( zyprexa ; eli lilly and company , ltd . , indianapolis , in , usa ) and 10 mg oral olanzapine . after drug treatment , the patient was able to sleep for 9 hours . the next morning , his suicidal ideas had disappeared , his mood swings decreased , and the frequency and intensity of his auditory hallucination were reduced significantly . single - photon emission computed tomography ( spect ) and magnetic resonance imaging ( mri ) scans performed the second day after the patient was admitted to hospital yielded normal findings with no deterioration in brain function or activity and no changes in brain structure . the electroencephalogram ( eeg ) showed no abnormal brain - wave patterns , and the neurological examinations revealed no abnormal findings . physical examinations ( blood test , serum electrolyte , blood glucose , blood urea nitrogen , creatinine , liver function test , serum syphilis , hiv test , thyroid function test , serum vitamin b12 , folate ) , chest x - ray , electrocardiogram , and urine tests all showed normal results . the patient did not have a history of drug use , and the result of his urine drug - screening test was negative . the influenza a ( h1n1 ) pcr test was repeated , and a negative result was confirmed . the patient received 5 mg olanzapine orally on day 2 following admission to the hospital , after which he showed a normal sleep pattern . from day 3 after admission , the patient s mood and behaviors became normal , and no auditory hallucinations or memory deterioration were observed . given the rapid improvement in his symptoms , antipsychotic medication was ceased . psychiatric observation , which was continued until day 8 , revealed no specific psychiatric symptoms . he talked about his symptoms with an ego - dystonic attitude and a high insight level . on day 8 after admission , the discharge diagnosis was mental and behavioral disorder due to the use of other psychoactive substances ( f19.8 ; icd-10 ) . he was followed up 2 weeks after discharge , at which point , he had adjusted to his normal daily routine . the absence of symptoms was confirmed at the next follow - up 4 weeks after discharge . at 10 months after discharge , we describe a patient with psychiatric symptoms that resulted from oseltamivir intake following an influenza a ( h1n1 ) infection . first , involvement of other psychiatric conditions was ruled out by psychiatric interviews and assessments , and the presence of organic mental conditions and psychotic disorders caused by the intake of other medications was excluded through physical examinations , brain imaging scans , and eeg . second , the patient s symptoms were similar to those reported in previous studies of psychiatric symptoms associated with oseltamivir . third , the patient was highly responsive to antipsychotic medications and fully recovered in a short period of time , which suggested drug - induced psychosis . fourth , because the patient was unaware of the side effects of oseltamivir and the possibility of developing psychiatric symptoms , he did not have a bias or a sensitive response to the drug . fifth , the patient s symptoms were confirmed to have developed independently during the time of the medication intake , and he showed no symptoms during a 10-month follows - up period after the reversal of his symptoms . it has been known that psychiatric symptoms usually develop within 48 hours of oseltamivir intake5,6 ) ; however , in our case , the psychiatric symptoms became obvious 5 days after oseltamivir intake . one hypothesis is that a neuraminidase inhibitor that has antiviral effects crosses the blood - brain barrier ( bbb ) into the central nervous system.8 ) studies in mice have shown that although oseltamivir carboxylate , an oseltamivir metabolite , does not pass through the bbb readily , it may do so when combined with other agents or when the bbb is damaged.9 ) moreover , oseltamivir carboxylate has been shown to cause neuronal excitability.10 ) a previous study found that plasma and brain oseltamivir carboxylate concentrations were higher in young mice than in adults , suggesting that oseltamivir is more likely to have adverse effects in infants and adolescents than in adults.11 ) because the effect of the influenza virus on the central nervous system is not fully understood , we are not able to conclude whether the symptoms experienced by our patient were consistent with the clinical course of influenza . moreover , the symptoms may have been the result of immunological rather than influenza viral effects on the central nervous system.8,9 ) complications of influenza , such as encephalitis and encephalopathy , can be diagnosed by neurological examinations and brain imaging . however , these techniques are not sufficient for the diagnosis of central nervous system complications not caused by the direct invasion of the influenza virus , such as immunological or unknown mechanisms.12 ) oseltamivir is generally prescribed in combination with nonsteroidal anti - inflammatory drugs ( nsaids ) or antihistamine agents . the effect of interactions between oseltamivir and these agents on the central nervous system is poorly understood . the oseltamivir metabolite changes as it interacts with other drugs and may affect the central nervous system.9,10 ) psychiatric side effects of oseltamivir have been reported more frequently in japan than in the united states and europe.3 ) this may be explained by the extensive use of oseltamivir during the influenza pandemic in japan ; however , genetic features associated with ethnicity or geographic factors may also contribute to the higher incidence of psychiatric symptoms . although several studies have demonstrated that oseltamivir induces psychiatric symptoms , this issue remains under debate . further study of the mechanisms underlying the psychiatric side effects of the drug is needed . in the meantime , close observation and follow - up are recommended when oseltamivir is administered for the treatment of influenza . | oseltamivir is the most common antiviral drug used to treat and prevent influenza .
epidemiological studies performed in japan , the united states , and the united kingdom indicate that oseltamivir may cause psychiatric symptoms ; however , the underlying mechanism has not been elucidated . in south
korea , interest in oseltamivir has increased with the spread of the new influenza virus ; however , no case report or investigation of psychiatric symptoms associated with the drug has been reported to date . here ,
we report a case o0f a 22-year - old male who complained of mood swings , suicidal feelings , auditory hallucinations , memory deterioration , and insomnia after taking oseltamivir . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the 1970s and 1980s saw extensive research on microtubules and actin . during this
period , the consensus developed that these cytoskeletal elements were unique to
eukaryotes and that nothing related to tubulin or actin existed in bacteria or
archaeans . this consensus was overthrown in the 1990s when a series of discoveries
revealed that prokaryotes actually did have homologues of tubulin and actin and that
these assembled into cytoskeletal filaments . it is now generally accepted that
eukaryotic microtubules and actin filaments originated from these prokaryotic
homologues . the key discoveries of bacterial tubulin and actin were published in 1992
and are reviewed here on their 25th anniversary . the discovery of ftsz as a bacterial homologue of tubulin came first and was made
independently by three groups ( de boer
et al . , 1992 ; raychaudhuri and park , 1992 ; mukherjee
et al . , 1993 ) . these independent studies each
purified ftsz protein from an escherichia coli expression system and
demonstrated that it bound and hydrolyzed gtp . they noted that bacterial ftszs were
missing the walker sequence motifs characteristic of g proteins but that they had a
conserved short sequence , gggtgtg , that was almost identical to the g / aggtgsg
sequence conserved in all - , - , and -tubulins . that sequence ,
known as the tubulin signature sequence , was believed to be involved in the binding
of gtp in the tubulins . the three groups all concluded that the gtp - binding site of
ftsz appeared to be related to that of tubulins . a year earlier , before any link to tubulin was known , bi and lutkenhaus ( 1991 ) were the first to propose that ftsz might be a
cytoskeletal protein . electron microscopy to show that ftsz
localized to the invaginating septum in dividing e. coli : in
our model the role of ftsz is to form a cytoskeletal element that is functionally
analogous to the role of actin in cytokinesis in animal cells . ( 1992 )
noted that the gtpase activity showed a dependence on ftsz concentration
characteristic of the self - assembly of tubulin and actin . a subsequent study by mukherjee and lutkenhaus
( 1994 ) provided two major advances . first , they demonstrated that purified
ftsz could assemble in vitro into filamentous polymers . second , they extended the sequence alignment to
identify > 20 amino acids that were highly conserved in all tubulins and ftsz . they
did this by starting the alignment at the gggtgtg sequence and inserting gaps in the
ftsz to maximize identity . remarkably most of the gaps coincided with gaps already in
the alignment of - , - , and -tubulins . i considered this
alignment to be compelling evidence for full homology , but the editors of
cell were more cautious , insisting on adding a question mark to
my 1995 minireview , our laboratory took up the question of in vitro assembly and showed that ftsz
assembled in vitro into sheets of protofilaments and mini - rings that were similar to
tubulin polymers ( erickson
et al . , 1996 ) . any question of homology was
dramatically resolved when the structures of ftsz ( lwe and amos , 1998 ) and tubulin ( nogales et al . they had an identical complex fold , which is the ultimate
test of homology . many
archaeans have up to five ftsz homologues , some with very divergent sequences that
likely serve functions other than cell division . the discovery of bacterial actins was complicated by the homology of actin to other
protein families . sometimes , this is
indicated by amino acid sequence identity , but often this sequence identity is too
weak to recognize . the most definitive demonstration of homology is from protein
structure . when the x - ray structure of actin was determined ( kabsch et al . , 1990 ) , it was seen to have
a complex fold that was identical to that of hexokinase and also to hsp70 , a
chaperonin . because this fold is so complex yet was shared so precisely , it was
concluded that the three shared a common ancestry . actin , hexokinase , and hsp70 are
homologues and are considered to be members of an actin superfamily . probably the original protein in this family
was the sugar kinase , which underwent gene duplications that evolved into a
chaperonin and separately into a protein that could assemble cytoskeletal filaments ,
actin . the first strong suggestion for actin homologues in bacteria was a theoretical study
by bork et al . they used the recent x - ray structures of actin , hexokinase , and hsp70 to do a
structure - based sequence alignment , which identified four short signature sequences
that were conserved across the superfamily . they then looked for these signatures in
bacterial proteins and found them in three : ftsa , mreb , and parm ( stba ) . these
bacterial proteins were closest in sequence to hsp70 and actin rather than the sugar
kinases and were therefore candidates for bacterial actin . ( 2001 ) studied the localization of mreb in bacteria by light microscopy ,
and found helical filaments running through the cell under the membrane . ( 2001 )
isolated mreb protein and showed by electron microscopy that it assembled thin
filaments . their major discovery was x - ray crystallography , which showed that mreb
had the actin fold and was assembled in the crystals into actin - like filaments . later
work has discovered multiple prokaryotic actins with a variety of cytoskeletal
functions , although the functions of most are unknown . it now seems clear that both tubulin and actin were invented in bacteria and/or
archaeans and proliferated into diverse families of cytoskeletal filaments well
before the emergence of eukaryotes ; for various perspectives on the evolution , see
erickson ( 2007 ) , lwe and amos ( 2009 ) , and wickstead and gull ( 2011 ) . an interesting irony is that roles of tubulin
and actin have somewhat switched from bacteria to eukaryotes . ftsz forms the
cytokinetic ring in bacteria , whereas actin provides the major cytoskeletal framework
in eukaryotes . some bacterial ( plasmid ) actins function for nucleoid segregation , a
role performed by microtubules in eukaryotes . a global conclusion would be that once a protein
has evolved the ability to assemble cytoskeletal filaments , these can be modified to
perform a wide range of useful and sometimes overlapping cellular functions . the discovery of ftsz as a bacterial homologue of tubulin came first and was made
independently by three groups ( de boer
et al . , 1992 ; raychaudhuri and park , 1992 ; mukherjee
et al . , 1993 ) . these independent studies each
purified ftsz protein from an escherichia coli expression system and
demonstrated that it bound and hydrolyzed gtp . they noted that bacterial ftszs were
missing the walker sequence motifs characteristic of g proteins but that they had a
conserved short sequence , gggtgtg , that was almost identical to the g / aggtgsg
sequence conserved in all - , - , and -tubulins . that sequence ,
known as the tubulin signature sequence , was believed to be involved in the binding
of gtp in the tubulins . the three groups all concluded that the gtp - binding site of
ftsz appeared to be related to that of tubulins . a year earlier , before any link to tubulin was known , bi and lutkenhaus ( 1991 ) were the first to propose that ftsz might be a
cytoskeletal protein . electron microscopy to show that ftsz
localized to the invaginating septum in dividing e. coli : in
our model the role of ftsz is to form a cytoskeletal element that is functionally
analogous to the role of actin in cytokinesis in animal cells . ( 1992 )
noted that the gtpase activity showed a dependence on ftsz concentration
characteristic of the self - assembly of tubulin and actin . a subsequent study by mukherjee and lutkenhaus
( 1994 ) provided two major advances . first , they demonstrated that purified
ftsz could assemble in vitro into filamentous polymers . second , they extended the sequence alignment to
identify > 20 amino acids that were highly conserved in all tubulins and ftsz . they
did this by starting the alignment at the gggtgtg sequence and inserting gaps in the
ftsz to maximize identity . remarkably most of the gaps coincided with gaps already in
the alignment of - , - , and -tubulins . i considered this
alignment to be compelling evidence for full homology , but the editors of
cell were more cautious , insisting on adding a question mark to
my 1995 minireview , our laboratory took up the question of in vitro assembly and showed that ftsz
assembled in vitro into sheets of protofilaments and mini - rings that were similar to
tubulin polymers ( erickson
et al . , 1996 ) . any question of homology was
dramatically resolved when the structures of ftsz ( lwe and amos , 1998 ) and tubulin ( nogales et al . , 1998 ) they had an identical complex fold , which is the ultimate
test of homology . many
archaeans have up to five ftsz homologues , some with very divergent sequences that
likely serve functions other than cell division . the discovery of bacterial actins was complicated by the homology of actin to other
protein families . sometimes , this is
indicated by amino acid sequence identity , but often this sequence identity is too
weak to recognize . the most definitive demonstration of homology is from protein
structure . when the x - ray structure of actin was determined ( kabsch et al . , 1990 ) , it was seen to have
a complex fold that was identical to that of hexokinase and also to hsp70 , a
chaperonin . because this fold is so complex yet was shared so precisely , it was
concluded that the three shared a common ancestry . actin , hexokinase , and hsp70 are
homologues and are considered to be members of an actin superfamily . probably the original protein in this family
was the sugar kinase , which underwent gene duplications that evolved into a
chaperonin and separately into a protein that could assemble cytoskeletal filaments ,
actin . the first strong suggestion for actin homologues in bacteria was a theoretical study
by bork et al . they used the recent x - ray structures of actin , hexokinase , and hsp70 to do a
structure - based sequence alignment , which identified four short signature sequences
that were conserved across the superfamily . they then looked for these signatures in
bacterial proteins and found them in three : ftsa , mreb , and parm ( stba ) . these
bacterial proteins were closest in sequence to hsp70 and actin rather than the sugar
kinases and were therefore candidates for bacterial actin . ( 2001 ) studied the localization of mreb in bacteria by light microscopy ,
and found helical filaments running through the cell under the membrane . ( 2001 )
isolated mreb protein and showed by electron microscopy that it assembled thin
filaments . their major discovery was x - ray crystallography , which showed that mreb
had the actin fold and was assembled in the crystals into actin - like filaments . later
work has discovered multiple prokaryotic actins with a variety of cytoskeletal
functions , although the functions of most are unknown . it now seems clear that both tubulin and actin were invented in bacteria and/or
archaeans and proliferated into diverse families of cytoskeletal filaments well
before the emergence of eukaryotes ; for various perspectives on the evolution , see
erickson ( 2007 ) , lwe and amos ( 2009 ) , and wickstead and gull ( 2011 ) . an interesting irony is that roles of tubulin
and actin have somewhat switched from bacteria to eukaryotes . ftsz forms the
cytokinetic ring in bacteria , whereas actin provides the major cytoskeletal framework
in eukaryotes . some bacterial ( plasmid ) actins function for nucleoid segregation , a
role performed by microtubules in eukaryotes . however , some tubz filaments also
function for plasmid segregation . a global conclusion would be that once a protein
has evolved the ability to assemble cytoskeletal filaments , these can be modified to
perform a wide range of useful and sometimes overlapping cellular functions . | the year 2017 marks the 25th anniversary of the discovery of homologues of tubulin
and actin in prokaryotes . before 1992 , it was largely accepted that tubulin and actin
were unique to eukaryotes .
then three laboratories independently discovered that
ftsz , a protein already known as a key player in bacterial cytokinesis , had the
tubulin signature sequence
present in all - , - , and
-tubulins .
that same year , three candidates for bacterial actins were
discovered in silico .
x - ray crystal structures have since confirmed multiple
bacterial proteins to be homologues of eukaryotic tubulin and actin .
tubulin and
actin were apparently derived from bacterial precursors that had already evolved a
wide range of cytoskeletal functions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it can be developmental or acquired and rarely may be associated with temporomandibular joint ( tmj ) ankylosis . it has been only occasionally reported since then , probably due to its usually asymptomatic nature . in 1941 , hrdlicka reported the first cases of bmc in 21 specimens from an unspecified number of dried skulls , and in 1948 , sicher first reported this anomaly in a living person . honee and bloem described a case of bifid condyle in the cadaver of a 71-year - old patient . although this type of morphologic change is generally associated with trauma , conditions such as teratogenic drug use , genetic inheritance , infection and exposure to radiation can also cause the development of this anomaly . the first patient was a 14-year - old female with a history of extraction of lower decayed and painful left first molar done about 3 months earlier . the patient continued to have pain and recurrent swelling on and off after extraction and was managed by her treating dentist with medications . the patient presented to the department with dull pain and facial swelling in relation to lower left molar region extending to the angle of mandible . axial and coronal computed tomography ( ct ) images of bilateral tmj and mandible with multiplanar reformatting ( mpr ) were done for evaluating any pathologic fracture and tmj pathosis . these findings are best seen on the axial and sagittal images [ figure 1 ] . coronal and axial ct images demonstrate left bmc oriented anteroposteriorly with articular surface irregularity the second patient was a 12-year - old female patient , referred for ct examination for evaluation of mild facial asymmetry and suspected tmj ankylosis . she had a reduced degree of jaw opening since childhood , and subsequently developed midline deviation to the left along with difficulty in mastication . these images demonstrated sagittal splitting of the left mandibular condyle into medial and lateral condylar head . the first patient was a 14-year - old female with a history of extraction of lower decayed and painful left first molar done about 3 months earlier . the patient continued to have pain and recurrent swelling on and off after extraction and was managed by her treating dentist with medications . the patient presented to the department with dull pain and facial swelling in relation to lower left molar region extending to the angle of mandible . axial and coronal computed tomography ( ct ) images of bilateral tmj and mandible with multiplanar reformatting ( mpr ) were done for evaluating any pathologic fracture and tmj pathosis . these findings are best seen on the axial and sagittal images [ figure 1 ] . the second patient was a 12-year - old female patient , referred for ct examination for evaluation of mild facial asymmetry and suspected tmj ankylosis . she had a reduced degree of jaw opening since childhood , and subsequently developed midline deviation to the left along with difficulty in mastication . these images demonstrated sagittal splitting of the left mandibular condyle into medial and lateral condylar head . szentpetery et al , in their study of 1882 cadaveric skulls , found the incidence of bmc to be 0.48% . a report of four cases of bifid condyles presented by loh and yeo included one involving an edentulous cadaver . in a literature review of reported cases in living patients , subsequently , four cases by stefanou et al and two other cases have been reported . recently , artvinli and kansu ( 2003 ) and antoniades et al ( 2004 ) have reported the first two cases of trifid condyle in patients who also had bifid condyles on the other side . described the first case of bilateral bifid condyles in a living patient . since then 10 more cases have been reported . current literature review in living patients revealed a total of 45 cases of bifid condyle , out of which 11 cases are bilateral , giving a ratio of approximately 3:1 . however , if the survey of the dry skulls and cadaveric reports are included , then the total number is 84 cases , of which 15 are bilateral . they appear to be more common on the left side in unilateral cases by a ratio of 2:1 . most cases ( 67% ) are asymptomatic and are found on routine dental radiographic examination . however , some have been reported in patients presenting with tmj symptoms , swelling , trauma , or ankylosis . the embryologic theory suggests that it is due to the obstruction of the blood supply to the condyle or the persistence of the vascularized fibrous septa . another theory postulates trauma as the cause with disruption or dislocation of joint integrity due to birth trauma , condylar fractures or surgical condylectomy in separate studies conducted by loh and yeo and antoniades et al , it was found that most cases of bifid condyle were asymptomatic and not associated with any history of trauma .. the site of fracture of the mandibular condyle and its relation to the insertion of the lateral pterygoid muscles are factors determining the future development of bifid condyle . other causes that have been proposed include genetics , endocrine disturbances , infection , radiation , nutritional deficiencies , and exposure to teratogenic substances . support for the latter suggestion comes from the work of gundlach et al who experimentally induced bifid condyles in rats by injecting teratogenic substances such as n - methyl - n - nitrosourea and formhydroxamic acid in different concentrations , at various stages of pregnancy . the extent of bifid condyle may range from a shallow groove to discrete condylar heads and the orientation may be anteroposterior or mediolateral . it has been postulated that anteroposterior splitting usually occurs in patients with identifiable antecedent trauma , while mediolateral splitting is usually developmental in origin . but here in our patient we have seen that there was a history of trauma for the mediolaterally splitted condyle and the anteroposterior splitting was because of osteomyelitis and the patient denied any previous trauma in all her life . szentpetery et al . have suggested that when two condylar parts lie in the sagittal plane , trauma is indicated as the cause , and when the parts lie in the coronal plane , the persistence of the fibrous septa at the condylar cartilage is likely to be the cause . while this may be true for the majority of cases , some mediolateral bifid condyles have been reported following sagittal fracture through the condylar head . according to blackwood , two articulating surfaces of the bmc were divided by a groove and could be orientated mediolaterally or anteroposteriorly , characterizing a specific entity . in this case report , as postulated above , groove formation and presence of medial and lateral head of both condyles clearly demonstrated the formation of the bmc . majority of the cases are detected during routine radiographic examination . in most of the cases , however , bmc is reported to be associated with pain , swelling , restricted mouth opening and most commonly tmj clicking . in our case due to the lack of clinical symptoms , diagnosis is made by radiographic findings . ct scan is the best radiograph for detection of bmc because it allows for detailed evaluation of condylar morphology . however , bmc can also be seen on opg , but sometimes the overlapping of the anatomic structures can hide the bifidity . in summary , bmc , an anatomic variation of condyle is a rare anomaly whose etiology is unknown . in the present case , literature says that it is most commonly due to facial trauma in the early stages of development . patients with internal articular derangement should be treated with occlusal splints and arthroscopic surgery , while patients with associated articular ankylosis may need surgical condylectomy or arthroplasty . awareness of this abnormality will help to avoid mistaking it for a fracture or a tumor . our first case also illustrates the point that bmc may be associated with tmj ankylosis . such a case requires detailed clinical examination and evaluation by ct for further management and for prognosticating the outcome . | bifid condyle is a rare anatomic variation of mandibular condyle .
it can be symptomatic or diagnosed incidentally on routine radiographic examination .
no definite etiologic factor has been identified .
it is suggested that bifid condyle could be a developmental anomaly or secondary to trauma .
we are reporting two cases of bifid mandibular condyle .
both were diagnosed using computed tomography scan , which additionally revealed the associated pathosis in the angle of the mandible in first patient and the ankylosis of temporomandibular joint in the second patient . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
skeletal anchorage with bone screws has been more and more incorporated into orthodontic practice making treatment quicker due to reduced need for patient compliance with anchorage reinforcement appliances . however , bone screw success rate is around 85% , making screw reinsertion an unexceptional clinical event [ 14 ] . reinsertion rate can still be greater if it is considered that some orthodontic mechanics require screw repositioning according to the phase of malocclusion correction [ 5 , 6 ] . because bone screw anchorage frequently includes screw replacement and repositioning , its reuse has been considered by some authors [ 5 , 79 ] , but this clinical procedure can require a careful screw recycling process , which should keep the mechanical and biological characteristics of the bone screws . an efficient cleaning and sterilization process has to precede bone screw reuse to avoid contamination and infection . the purpose of cleaning is to remove or reduce visible smears including blood , protein , and debris that were precipitated on the screw surface [ 10 , 11 ] . sterilization serves to eliminate or stop reproduction of microorganisms including bacteria , spores , and fungi . cleaning processes including electrolytic , ultrasonic , and chemical methods have been used separately or in association to achieve a greater efficiency [ 1113 ] . it has been demonstrated that autoclave sterilization does not influence mechanical resistance , fracture risk , and primary stability of bone screws [ 1316 ] . however , more recently , microscopic images showed that the bone and organic tissues adhered to the surface of failed bone screws were not easily removed even after many cleanings and sterilizations . this highlights that a stricter guideline seems to be needed regarding recycling of retrieved bone screws , mainly if reuse is to be performed between different patients . furthermore , bone screw surface irregularities , such as scratches produced by the mechanical machining process , roughness associated with sandblasting , and corrosion areas , can make the cleaning process still harder [ 1719 ] . it can be speculated that a more aggressive mechanical cleaning process including a slight abrasive stripping of the screw surface by sandblasting could have a greater efficiency to remove any organic or inorganic residual , providing a safer reconditioning method for used bone screws . however , the impact of this recycling protocol on bone screw performance must be evaluated . thus , the objective of this study was to evaluate the null hypothesis that the mechanical strength of bone screws retrieved from iliac bone pig and recycled by sandblasting and ultrasonic bath is not different from new screws . two hundred bone screws of the same type and brand especially manufactured for this experiment ( dentos , daegu , south korea ) such that the nominal and core diameter changes were the only variable among them were used in this study . thus , the dimensional characteristics of head and thread ( length , pitch , flank angle , thread form , thread depth , and taper ) were systematically standardized because they could distort the effect of the recycling process on the screw mechanical strength , reducing reliability of the results . the sample was divided into four groups with 50 bone screws each , equally distributed in 5 diameters that progressively increased from 1.3 to 1.7 mm , in increments of 0.1 mm . fifty new bone screws ( control group , cg ) were inserted in high - density artificial bone ( 0.80 g / cm , sawbones division of pacific research laboratories , vashon island , wash , astm f1839 - 08 ) to achieve a torque value able to cause torsional fracture of the screws ( fracture torque , ft ) . an essay machine equipped with a screwdriver fit to a digital torquimeter was used for bone screw insertion , perpendicularly to artificial bone blocks , to achieve fracture torque values that were measured in newtons per centimeter ( figure 1 ) . group 1 consisted of bone screws inserted into blocks of pig iliac bone and subsequently removed to reproduce torsional stress developed at the screw threads during clinical placement and removal from the jaw bones ( figure 2 ) . the cortical thickness close to the iliosacral joint ranged from 0.5 to 1 mm , which is similar to the buccal cortical thickness in some anatomic regions of the human maxilla and mandible . after removal , the bone screws were fractured in high - density artificial bone using the same protocol applied to the cg , and fracture torque was recorded . bone screws from group 2 were submitted to the same experimental protocol applied to group 1 , but before screw insertion into high - density artificial bone for fracture torque measurement , the anchorage devices underwent a recycling process that included ultrasonic cleaning and autoclave sterilization . ultrasonic bath was operated at 40 khz and 25c for 20 min in detergent solution . afterwards , the screws were rinsed in deionized water and sonicated again for 15 min in deionized water . subsequently , the bone screws were packed in sealed bags and the autoclaving process was performed at 121c and 18 psi for 20 min . group 3 underwent the same experimental procedures applied to group 2 , except for the recycling process of the bone screws , which included sandblasting ( figure 3 ) . the sequence of procedures included ultrasonic bath in detergent solution , rinsing in deionized water , blasting of the screw thread surface with al2o3 - 90 m particles at 60 psi with the sandblaster unit positioned 10 mm away from the screw surface , and ultrasonic cleaning of the residual alumina particles in deionized water for 20 min . after the recycling process and before the fracture procedure , the bone screws of groups 2 and 3 were individually weighed on a precision scale to evaluate if a significant amount of metallic structure was lost during sandblasting . analysis of variance ( anova ) followed by tukey tests was used to compare the fracture torque among groups and diameters . weights of the bone screws after the recycling processes were compared between groups 2 and 3 with mann - whitney tests . a multiple linear regression analysis was performed taking into account the fracture torque as dependent variable to simultaneously evaluate the influence of two recycling processes , 5 different diameters , and weight loss on the mechanical strength of bone screws . statistical analyses were performed with statistica software ( statistica for windows 6.0 , statsoft , inc . , tulsa , oklahoma ) , at p < 0.05 . table 1 shows that the bone screws of the control and experimental groups had similar fracture torque regardless of previous insertion in bone tissue and recycling process applied to groups 1 , 2 , and 3 . however , the fracture torque was significantly greater for each 0.1 mm added in bone screw diameter regardless of previous insertion or recycling protocol . the weights of sandblasted bone screws were significantly smaller than those of the nonsandblasted ( table 2 ) . when all the variables ( recycling protocols , diameters , and weight loss ) were simultaneously evaluated in the regression analysis , bone screw diameter was the only significant variable in predicting fracture torque , explaining more than 97% of its variability ( table 3 ) . fifteen to twenty percent of bone screws are early discarded only because of stability failure , which can occur a few days or months after insertion [ 1 , 2 , 4 ] . other significant percentages of bone screws are early discarded only because the orthodontic mechanics require screw repositioning in the arch to be continued [ 5 , 6 ] . in both situations , thus , it is not surprising that timely bone screw reuse has been considered by orthodontists , reducing the number of titanium screws necessary to finish skeletally anchored treatments [ 59 ] . however , when bone screw reuse is considered , an initial concern is whether the mechanical strength will support the reinsertion and removal procedures . a similar fracture torque of new ( cg ) and used bone screws ( g1 ) showed that screws were not weakened after single insertion and removal in pig iliac bone ( table 1 ) . these findings are in accordance with noorollahian et al . 's study , which found similar fracture torque for unused and single used bone screws . in fact , defino et al . observed that orthopedic bone screws had the mechanical performance affected only after the third repeated insertion . however , this is only a first condition for screw reuse because , besides structural strength , reuse requires a recycling protocol to produce a reconditioned screw surface free of any organic residuals , microorganisms , or corrosion products . several studies have demonstrated that autoclave sterilization does not have any negative impact on bone screw strength and fracture torque even after several sterilization cycles ( up to 50 times , as in adelson et al . however , some studies have demonstrated that autoclaving alone can fail to completely decontaminate infected instrument if it is not adequately cleaned prior to the sterilization cycle [ 22 , 23 ] . in general , cleaning can be performed by manual scrubbing , enzymatic agents , and ultrasonic bath , but the association between them ( mechanical and chemical regimens ) seems to be the most effective cleaning procedure [ 24 , 25 ] . however , it can be speculated that ultrasonication followed by autoclave sterilization would weaken the bone screw structure ; this was not confirmed by the results of this study because a similar fracture torque was observed between control group and group 2 ( table 1 ) . importantly , scientific lines of evidence have shown that traditional cleaning processes , such as sonication , even when associated with chemical agents , can not be sufficient to efficiently remove the proteinaceous biofilm from contaminated instruments , and more aggressive and complex recycling methods as electrolysis have been suggested [ 7 , 12 , 26 ] . considering that sandblasting is a simple procedure able to clean the screw surface by abrasive mechanical stripping , which can still benefit bone tissue response [ 27 , 28 ] , this study evaluated the mechanical strength of screws previously inserted in pig iliac bone that underwent recycling processes including sonication , sandblasting , and autoclave sterilization ( group 3 ) . the results showed that the recycled bone screws had similar fracture torque when compared to the control group and groups 1 and 2 ( table 1 ) . the weights of sandblasted screws were slightly smaller than nonsandblasted , highlighting that sandblasting produced cleaning by abrasive stripping of the superficial layer of the titanium screws with some metallic structure reduction ( table 2 ) . nevertheless , this structural loss was limited and not enough to significantly affect the bone screws torsional strengths ( tables 1 and 2 ) . only screw diameter variation ( 0.1 mm ) was sufficient to significantly change the fracture torque ( table 1 ) . this fact shows that , from the viewpoint of mechanical strength , the professionals should be more concerned with any screw diameter change , even if small , than if the bone screw was recycled to be reused ( table 1 ) . however , most professionals do not show a great concern if bone screw diameter has to be changed in only 0.1 mm , but they are deeply worried about mechanical performance of recycled bone screws . when the recycling protocols of groups 2 and 3 , the five different diameters , and the weight loss were included in a regression model , the only variable significantly and strongly associated with fracture torque was the screw diameter ( table 3 ) . thus , the choice of screw diameter is critical to perform a safe insertion procedure because an increase in cortical bone thickness can easily approximate the insertion torque from the fracture torque . according to these results , the breakage risk of a reused bone screw is more associated with inadequate diameter choice than with a single recycling process . however , if the screws underwent sequential recycling cycles for multiple uses other results can be found . it has been demonstrated that surface roughness of titanium screws produced by macrosandblasting ( al2o3 - 350 m ) has a better response of bone tissues than microsandblasted surfaces ( al2o3 - 50 m ) . thus , the evaluated recycling process with al2o3 - 90 m can still be adjusted to benefit the biological response . ultrasonic bath in group 3 was used after sandblasting to remove loose particles of al2o3 because al ions could elicit an inflammatory response and disturb bone differentiation and deposition , although this speculation has not been scientifically confirmed [ 2830 ] . thus , any residual particle of al2o3 that remains embedded in the screw surface after recycling does not have deleterious effect on bone response . instead , some studies consider that al2o3 exerts a favorable influence on bone formation [ 30 , 31 ] . as a consequence , osseointegration and stability of the mini - implant this paper provides some guidelines for bone screw recycling , but it does not evaluate professional preference or acceptance degree about this procedure . however , if screw reuse is performed by some professionals , and it is , then this study corroborates the important opinion of other authors that recycling should follow stricter guidelines [ 7 , 12 ] . from a viewpoint of screw mechanical characteristics , recycling by ultrasonic - sandblasting and autoclave sterilization can be a feasible protocol . however , these results should be complemented by in vivo studies because metal corrosion , orthodontic or orthopedic loading , and occlusal forces during chewing can produce an additional impact on mechanical properties of retrieved bone screws . the recycling protocols did not influence torsional strength of bone screws even when ultrasonic bath was associated with al2o3 blasting . sandblasting cleaning produced an abrasive mechanical stripping of the screw surface , but the structural loss was not sufficient to significantly influence the fracture torque . however , differences of 0.1 mm in bone screw diameter significantly changed the fracture torque . | purpose .
this study evaluated the influence of recycling process on the torsional strength of mini - implants .
materials and methods .
two hundred mini - implants were divided into 4 groups with 50 screws equally distributed in five diameters ( 1.3 to 1.7 mm ) : control group ( cg ) : unused mini - implants , g1 : mini - implants inserted in pig iliac bone and removed , g2 : same protocol of group 1 followed by sonication for cleaning and autoclave sterilization , and g3 : same insertion protocol of group 1 followed by sonication for cleaning before and after sandblasting ( al2o3 - 90 ) and autoclave sterilization . g2 and g3 mini - implants were weighed after recycling process to evaluate weight loss ( w ) .
all the screws were broken to determine the fracture torque ( ft ) .
the influence of recycling process on ft and w was evaluated by anova , mann - whitney , and multiple linear regression analysis . results .
ft was not influenced by recycling protocols even when sandblasting was added .
sandblasting caused weight loss due to abrasive mechanical stripping of screw surface .
screw diameter was the only variable that affected ft .
conclusions .
torsional strengths of screws that underwent the recycling protocols were not changed .
thus , screw diameter choice can be a more critical step to avoid screw fracture than recycling decision . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tuberculosis ( tb ) is thought to be one of the oldest human diseases and the history is almost as old as mankind . the european kings of the middle ages imparted the royal touch to cure the king 's evil to which mycobacterial lymphadenitis referred . india has the highest tb burden accounting for one - fifth of the global incidence and nearly 40% of the indian population is infected with the tb bacillus . since the mid-1980s , both in developing and developed countries , there is increasing incidence of extrapulmonary tb has been noted . in india , extrapulmonary tb accounting 20% of all tb cases and its prevalence in the country varies between 8.3% and 13.1% in different districts according to cohort analysis by the central tb division , ministry of health and family welfare in 2002 . in india and other developing countries , tb lymphadenitis is the most common form of extrapulmonary tb and it comprises 35% of cases . infection with the human immunodeficiency virus / acquired immunodeficiency syndrome ( hiv / aids ) is associated with an increased frequency of both pulmonary and extrapulmonary tb especially lymphadenitis . tb lymphadenitis is usually more common in females and in younger age groups in contrast to pulmonary tb which is more common in males and in the older age group and a peak age of onset of 20 - 40 years . there are various diagnostic modalities available for the diagnosis of tb lymphadenitis viz fine - needle aspiration cytology ( fnac ) , histopathological examination excised lymph nodes , culture , ziehl - neelsen ( zn ) staining for acid fast bacilli ( afb ) , imaging studies , and molecular tests . even though culture is considered as gold standard for the diagnosis , fnac to be used as the initial diagnostic test in suspected cases of tb as it has excellent sensitivity and specificity , and also it is a simple and less expensive outpatient diagnostic procedure . the present study was undertaken to evaluate cytomorphological patterns of tuberculous lymphadenitis including hiv / aids positive cases , to correlate the afb positivity with cytomorphological patterns and also to find out overall afb positivity . the present retrospective study was undertaken at department of pathology in our institution , a tertiary care center , conducted over the period of 3 years from march 2012 to march 2015 , after obtaining approval from the institutional ethical committee . a total of 212 cases with cytologically proven tuberculous lymphadenitis were included in the present study . patients with nontuberculous mycobacterial infections such as mycobacterium scrofulaceum , mycobacterium avium - intracellulare complex and mycobacterium kansasii , pulmonary koch 's , bacillus calmette - guerin vaccination causing lymphadenitis , and periodic acid - schiff positive organisms in fnac smears were also excluded from this study . nontuberculous mycobacterial infections were excluded by identification of only microabscesses , ill - defined granulomas , noncaseating granulomas and a small numbers of giant cells , and pulmonary koch 's , bacillus calmette - guerin vaccination causing lymphadenitis were excluded by detailed clinical history collected from medical records . clinical data such as site of aspiration , number lymph nodes involved , nature of aspirates ( blood mixed material , purulent / pus , caseous , or cheesy ) were obtained from patient medical records . may - grunwald giemsa and hematoxylin and eosin stained smears were studied for pattern analysis . according to the das et al . study , cytology smears revealing cytomorphological features of tuberculous lymphadenitis were grouped into three categories : pattern a : epithelioid granuloma without necrosis [ figure 1a ] , pattern b : epithelioid granuloma with necrosis [ figure 1b ] , and pattern c : necrosis without epithelioid granuloma [ figure 1c ] . ( a ) pattern a : epithelioid granuloma without necrosis ( may - grunwald giemsa , 400 ) . ( b ) pattern b : epithelioid granuloma with necrosis ( h and e , 400 ) . ( c ) pattern c : necrosis without epithelioid granuloma ( may - grunwald giemsa , 400 ) . ( d ) grade 3 + acid fast bacilli positivity ( ziehl - neelsen , 1000 ) zn stained smears were used for screening of afb and grading . these positive smears were categorized into three grades ; 1 + : smears with occasional bacilli , 2 + : smears with singly scattered afb , 3 + : smears with a large number of bacilli arranged in bundles detected under 10 [ figure 1d ] . all the statistical analysis was performed using ibm spss statistics for windows ( version 20.0 , ibm corporation , armonk , new york , usa ) . correlation between various cytomorphological patterns and afb positivity was assessed using chi - square test . the present retrospective study was undertaken at department of pathology in our institution , a tertiary care center , conducted over the period of 3 years from march 2012 to march 2015 , after obtaining approval from the institutional ethical committee . a total of 212 cases with cytologically proven tuberculous lymphadenitis were included in the present study . patients with nontuberculous mycobacterial infections such as mycobacterium scrofulaceum , mycobacterium avium - intracellulare complex and mycobacterium kansasii , pulmonary koch 's , bacillus calmette - guerin vaccination causing lymphadenitis , and periodic acid - schiff positive organisms in fnac smears were also excluded from this study . nontuberculous mycobacterial infections were excluded by identification of only microabscesses , ill - defined granulomas , noncaseating granulomas and a small numbers of giant cells , and pulmonary koch 's , bacillus calmette - guerin vaccination causing lymphadenitis were excluded by detailed clinical history collected from medical records . clinical data such as site of aspiration , number lymph nodes involved , nature of aspirates ( blood mixed material , purulent / pus , caseous , or cheesy ) were obtained from patient medical records . may - grunwald giemsa and hematoxylin and eosin stained smears were studied for pattern analysis . according to the das et al . study , cytology smears revealing cytomorphological features of tuberculous lymphadenitis were grouped into three categories : pattern a : epithelioid granuloma without necrosis [ figure 1a ] , pattern b : epithelioid granuloma with necrosis [ figure 1b ] , and pattern c : necrosis without epithelioid granuloma [ figure 1c ] . ( a ) pattern a : epithelioid granuloma without necrosis ( may - grunwald giemsa , 400 ) . ( b ) pattern b : epithelioid granuloma with necrosis ( h and e , 400 ) . ( c ) pattern c : necrosis without epithelioid granuloma ( may - grunwald giemsa , 400 ) . ( d ) grade 3 + acid fast bacilli positivity ( ziehl - neelsen , 1000 ) zn stained smears were used for screening of afb and grading . these positive smears were categorized into three grades ; 1 + : smears with occasional bacilli , 2 + : smears with singly scattered afb , 3 + : smears with a large number of bacilli arranged in bundles detected under 10 [ figure 1d ] . all the statistical analysis was performed using ibm spss statistics for windows ( version 20.0 , ibm corporation , armonk , new york , usa ) . correlation between various cytomorphological patterns and afb positivity was assessed using chi - square test . out of 212 cases , 118 were afb positive cases and remaining 94 was afb negative , but showed cytological features of tuberculous lymphadenitis . in the present study , the most common site of involved lymph nodes was cervical lymph nodes in 206 ( 97.2% ) followed by axillary lymph nodes in 4 ( 1.9% ) and inguinal lymph nodes in 2 ( 0.9% ) cases . the most common presentation was single palpable cervical lymphadenopathy in 177 ( 83.5% ) cases followed by multiple unilateral palpable cervical lymphadenopathy in 31 ( 14.6% ) and multiple bilateral cervical lymphadenopathy in 4 ( 1.9% ) cases . on the basis of appearance of aspirate , blood mixed aspirate were noted more commonly in 179 ( 84.4% ) cases followed by purulent / pus material in 26 ( 12.3% ) cases and caseous or cheesy material in 7 ( 3.3% ) cases . blood mixed aspirate was predominantly seen in pattern a and b and purulent / pus and caseous or cheesy material were predominantly seen in pattern c. of these 212 cases , pattern a was observed in 40 ( 18.9% ) cases , pattern b was observed in 102 ( 48.1% ) cases , and pattern c was observed in 70 ( 33% ) cases . afb positivity was found in 2 ( 5% ) cases of pattern a , 62 ( 60.8% ) cases of pattern b , and 54 ( 77.1% ) cases of pattern c. the highest percentage of afb positivity ( 64.7% ) was observed in aspirate containing purulent / pus and caseous / cheesy material . the overall afb positivity was seen in 55.7% ( 118/212 ) cases . on grading of afb positivity , grade 1 + observed in 29.7% , grade 2 + observed in 28.8% 2 , and grade 3 + observed in 41.5% cases . all the hiv - positive cases showed pattern c and grade 3 + afb positivity . the present study showed significant statistical difference between afb positivity and cytomorphological patterns ( p < 0.0001 ) . in the present study , the most common site of involved lymph nodes was cervical lymph nodes in 206 ( 97.2% ) followed by axillary lymph nodes in 4 ( 1.9% ) and inguinal lymph nodes in 2 ( 0.9% ) cases . the most common presentation was single palpable cervical lymphadenopathy in 177 ( 83.5% ) cases followed by multiple unilateral palpable cervical lymphadenopathy in 31 ( 14.6% ) and multiple bilateral cervical lymphadenopathy in 4 ( 1.9% ) cases . on the basis of appearance of aspirate , blood mixed aspirate were noted more commonly in 179 ( 84.4% ) cases followed by purulent / pus material in 26 ( 12.3% ) cases and caseous or cheesy material in 7 ( 3.3% ) cases . blood mixed aspirate was predominantly seen in pattern a and b and purulent / pus and caseous or cheesy material were predominantly seen in pattern c. of these 212 cases , pattern a was observed in 40 ( 18.9% ) cases , pattern b was observed in 102 ( 48.1% ) cases , and pattern c was observed in 70 ( 33% ) cases . afb positivity was found in 2 ( 5% ) cases of pattern a , 62 ( 60.8% ) cases of pattern b , and 54 ( 77.1% ) cases of pattern c. the highest percentage of afb positivity ( 64.7% ) was observed in aspirate containing purulent / pus and caseous / cheesy material . the overall afb positivity was seen in 55.7% ( 118/212 ) cases . on grading of afb positivity , grade 1 + observed in 29.7% , grade 2 + observed in 28.8% 2 , and grade 3 + observed in 41.5% cases . all the hiv - positive cases showed pattern c and grade 3 + afb positivity . the present study showed significant statistical difference between afb positivity and cytomorphological patterns ( p < 0.0001 ) . on clinical examination , cervical lymph nodes ( 97.2% ) were more commonly involved and inguinal lymph nodes were least commonly involved in the present study similar to most of the recently published studies . this is because , the organism usually gains access to the cervical lymph nodes through the tonsillar lymphoid tissue . in this study , most common presentation was single palpable cervical lymphadenopathy in 83.5% cases comparable to chand et al . ( 81.6% ) study , and higher than nidhi et al . ( 63.3% ) study . we observed multiple unilateral palpable cervical lymphadenopathy in 14.6% cases and multiple bilateral cervical lymphadenopathy in 1.9% cases , which were almost comparable to nidhi et al . study . due to various initiatives by governmental and nongovernmental agencies , this might explain the high number of cases presenting with single lymph node enlargement . according to gross nature of aspirate , blood mixed aspirates were noted in 84.4% followed by purulent / pus material in 12.3% and caseous or cheesy material in 3.3% cases in the current study , whereas , hemalatha et al . observed blood mixed aspirates in 87.3% and purulent to cheesy materials in 12.7% cases . pattern a and b were predominantly observed in blood mixed aspirate , whereas pattern c was predominantly observed in purulent / pus and caseous or cheesy aspirates in the present study similar to hemalatha et al cytomorphological pictures of tuberculous lymphadenitis was described by various authors with minor modifications with different names viz patterns or category . we described cytomorphological pictures in our study as patterns . in our study , most common cytomorphological pattern observed was pattern b ( 48.1% ) similar to hemalatha et al . and gupta et al . studies , and it was higher than studies done by nidhi et al . , and chand et al . ( 16.4% and 21.8% , respectively ) . in the current study , pattern c and pattern a were noted in 33% and 18.9% cases , respectively . the formation of granuloma is dependent on a fairly good immune system within the host . in immunocompromised situations , the immunological interplay between lymphocytes , macrophages , the organism , and various interleukins / cytokines may not be efficient to result in granuloma formation . hence , when afb positivity is observed without granuloma formation , other comorbid immunodeficient states should be thought of . similar to few indian studies , we observed more number of afb positivity in pattern c ( 77.1% ) followed by pattern b ( 60.8% ) in the current study . pattern a showed 5% afb positivity in our study , whereas nidhi et al . and chand et al . we found maximum percentage of afb positivity ( 64.7% ) in aspirate containing purulent / pus and caseous / cheesy material similar to studies done by various authors . if the purulent material is aspirated , slides should be stained for zn staining to rule out tuberculous lymphadenitis , because it can mimic as acute suppurative lesions . the present study showed overall afb positivity in 55.7% cases comparable to most of the published studies , and lower than nidhi et al . and slides can be decolorized for zn staining if cytological features of tb and necrosis present ; this may increase the afb positivity . yield of afb positivity can be further increased by doing repeat fnac of a lymph node . clinical correlation and microbiological assessment should be done in afb negative cases showing only epithelioid granulomas without necrosis . microbiological assessment is necessary in afb negative cases to confirm the diagnosis of tb as approximately 10,000 - 100,000 mycobacterial organism / ml of the sample should be present for smear afb positivity . in the present study , all the hiv positive cases ( n = 10 ) showed pattern c with grade 3 + afb positivity , whereas hemalatha et al . study , included 4 hiv positive cases , of theses 3 cases showed numerous macrophages with 3 + afb positivity and 1 case showed pattern b with 1 + afb positivity . on grading of afb positivity , 29.7% cases showed grade 1 + , 28.8% cases showed grade 2 + , and 41.5% cases showed grade 3 + positivity in the present study . hence , it can be argued that the bacterial load in the rural population affected by tb seems to be high . there was significant statistical difference between afb positivity and cytomorphological patterns ( p < 0.0001 ) similar to hemalatha et al . comparison of patterns of tuberculous lymphadenitis and overall afb positivity in the present study with other studies is shown in table 1 . comparison of patterns of tuberculous lymphadenitis and overall afb positivity in the present study with other studies fnac is a sensitive , simple , convenient , safe , minimally invasive procedure to diagnose tuberculous lymphadenitis . study of both cytomorphological patterns and zn staining for afb can improve the diagnostic yield . regardless of the presence of granuloma , zn stain must be employed whenever infective pathology is suspected . | background : one of the most common causes of lymphadenopathy in india is tuberculosis . it can be diagnosed by a minimally invasive procedure known as fine - needle aspiration cytology ( fnac ) , and thereby unnecessary surgical interventions are avoided.aim:this study was undertaken to evaluate cytomorphological patterns of tuberculous lymphadenitis including human immunodeficiency virus - positive cases , to correlate the acid - fast bacilli ( afb ) positivity with cytomorphological patterns and also to find out overall afb positivity.materials and methods : in this study , a total of 212 cases of cytologically proven tuberculous lymphadenitis were retrieved and analyzed retrospectively between march 2012 and march 2015 for three different cytomorphological patterns ( epithelioid granuloma without necrosis [ pattern a ] , epithelioid granuloma with necrosis [ pattern b ] , and necrosis without epithelioid granuloma [ pattern c ] ) and bacillary loads on ziehl - neelsen stain ( zn ) for afb.results:pattern a through c was observed in 40 ( 18.9% ) , 102 ( 48.1% ) , and 70 ( 33% ) cases , respectively .
afb positivity was found in 2 ( 5% ) cases of pattern a , 62 ( 60.8% ) cases of pattern b , and 54 ( 77.1% ) cases of pattern c. the highest percentage of afb positivity ( 64.7% ) was observed in aspirate containing purulent / pus and caseous / cheesy material .
the overall afb positivity was seen in 55.7% ( 118/212 ) cases . on grading of afb positivity ,
grade 1 + was observed in 29.7% , grade 2 + was observed in 28.8% , and grade 3 + was observed in 41.5% cases.conclusion:fnac is a sensitive , simple , convenient , safe , minimally invasive procedure to diagnose tuberculous lymphadenitis .
study of both cytomorphological patterns and zn staining for afb can improve the diagnostic yield . regardless of the presence of granuloma ,
zn stain must be employed whenever infective pathology is suspected . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in egypt , childhood acute lymphoblastic leukemia ( all ) is the most common cancer in children , accounting for almost one - third of newly diagnosed pediatric cancer cases . the annual incidence of pediatric all is approximately four cases per 100,000 children per year in the national cancer institute nci , cairo university , egypt . the 210 years age group constitutes 68.5%.1,2 fortunately , improvements in treatment , including multimodal therapy and hospital care , have improved survival such that over 80% of children diagnosed with all survive at least five years.2,3 however , childhood cancer survivors are at increased risk of developing chronic health conditions , some of which manifest during or soon after treatment whereas others emerge years after therapy.4 obesity is a particularly significant problem among all survivors , which can intensify cardiovascular outcomes and place these individuals at greater risk for other chronic health conditions.5 evidence from the childhood cancer survivor study ( ccss ) suggests that survivors of all ( who lived 5ys after treatment ) experience a higher rate of obesity than their same - sex siblings , especially for female survivors ( all : 31.7% vs. siblings : 22.2%).6 obesity may further compound the risk of other late effects , such as increased rate of cardiovascular diseases observed in childhood cancer survivors.7 previous studies have attributed obesity to the cranial irradiation ( crt ) patients received to prevent central nervous system ( cns ) relapse , however , since the 1990s , cns prophylaxis with crt protocols has gradually been replaced with intrathecal and systemic chemotherapy by several consortia.8 a study of the children s oncology group ( cog ) found excessive weight gain also occurred in children receiving chemotherapy alone.9 treatment with glucocorticoids has been implicated in the physiology of adiposity , and there is data that dexamethasone may act more potently than prednisone.10 prolonged use of corticosteroids has shown effects on body composition associated with increases in the percentage of body fat in pediatric all survivors.11 also , hepatic abnormalities are well documented in survivors of childhood malignancies . a spectrum of liver diseases has been described including hepatitis b and c , iron overload , hepatic fibrosis , cirrhosis and hepatocellular carcinoma.12 less commonly reported hepatobiliary complications include cholelithiasis , focal nodular hyperplasia ( fnh ) , nodular regenerative hyperplasia , hepatic microvesicular fatty change and siderosis.13 the childhood cancer survivor study ( ccss ) noted an almost two - fold excess risk of gallbladder disease among childhood cancer survivors compared to sibs ( 1.9 95 % 1.72.2).13 acute or sub - acute hepatobiliary injury is recognized with varying incidence following radiation , multiple chemotherapies , or hematopoietic stem cell transplantation ( hsct).14 additionally , hepatobiliary toxicity is associated with supportive care measures , such as transfusion - acquired hepatitis , transfusion - associated iron overload or cholestatic disease from total parenteral nutrition ( tpn ) . these conditions may predispose to clinically significant liver disease in aging childhood cancer survivors.15 in this study , we aimed to estimate the prevalence of overweight , obesity , and hepatic late adverse effects in pediatric all survivors who lived 5 years after treatment . a comparative cross - sectional case - control study was performed on thirty - five all survivors , treated at hematology and oncology unit , pediatric department , menoufia university hospital . all of them completed treatment with st jude total xv chemotherapy protocol 5 years before the time of examination . in that protocol , on hematopoietic recovery , consolidation therapy with high - dose methotrexate , mercaptopurine , triple intrathecal treatment began , and the dose of methotrexate was based on risk classification . during initial continuation therapy , patients with low - risk disease received daily mercaptopurine and weekly methotrexate with pulses of mercaptopurine , dexamethasone , and vincristine . two re - induction treatments were given between weeks 7 to 9 and weeks 17 to 19 . patients with standard - risk disease received weekly asparaginase and daily mercaptopurine with pulses of doxorubicin plus vincristine plus dexamethasone . they also received two re - induction treatments between weeks 7 to 9 and weeks 17 to 20 . for the remaining part of continuation therapy , patients with low - risk disease received mercaptopurine and methotrexate , with pulses of dexamethasone , vincristine , and mercaptopurine , and patients with standard - risk disease received three rotating drug pairs continuation treatment lasted 120 weeks for girls and 146 weeks for boys.16 none of those survivors received radiotherapy . a control group of 35 healthy children with matched age and sex was selected from volunteers from a local school . they were apparently healthy with no history of chronic illnesses or previous history of steroid intake . a written informed consent was obtained from the parents of all children , and oral assent was obtained from children of both groups . this study was approved by the ethical committee of the faculty of medicine , menoufia university . the survivors and controls were subjected to anthropometric measurements and laboratory investigations : anthropometric measurements ( weight , height , and body mass index ) , bmi was assessed by z - score . body mass index = weight in kilograms/(height in meters)2 was plotted on age and gender - specific percentile charts ( for 2 to 20-year - olds ) . bmi over the 95 percentile indicates obesity , between 85 and 95 indicates risk of overweight.17 we evaluated longitudinal changes in obesity rate and bmi z scores in survivors of pediatric all as for survivors of childhood cancer aged < 20 y. the bmi z - score or percentile is often used to evaluate weight status , rather than the absolute bmi because an increased bmi is part of the normative / adolescent development and also varies by sex.18 the bmi z - score or percentile can be calculated on the basis of age and sex - specific mean bmi of a reference population.19 7 ml of venous blood were withdrawn from every child then transferred into a plain tube , centrifuged for 10 min at 4000 r.p.m . the serum obtained was kept frozen at 20 c till analysis ( liver , kidney function tests , iron profile and hcv antibodies detection ) . serum alt & ast were estimated by enzymatic colorimetric method using randox kit , united kingdom.20 serum total and direct bilirubin were estimated by enzymatic colorimetric method using diamond diagnostics kit , germany.20 serum urea was determined by mod berthelot enzymatic colorimetric method using diamond diagnostics kit , germany.21 serum creatinine was determined by the fixed rate kinetic chemical method , using diamond diagnostics kit , germany.22 serum iron and total iron binding capacity ( tibc ) were determined by a colorimetric method using spectrum diagnostics kit ( germany).23,24 transferrin saturation index ( tsi ) was calculated by the following formula : iron concentration divided by tibc and multiplied by 100 . the tsi > 16% values were regarded as correct ones.25 serum ferritin levels were measured to assess the iron status of our patients by enzyme linked immune sorbent assay ( elisa ) technique using ( ramco laboratories kit , inc . , usa ) , and hcv antibodies were detected by elisa using ( autobio diagnostics , china ) kit on microplate reader ( bio - rad 680 hercules , california , usa ) . the statistical presentation and analysis of the present study were conducted using spss v.20 ( spss inc . , data were expressed in two phases : continuous parametric variables were presented as means sd while for categorical variables numbers ( % ) were used . chi - square ( test ) and fisher s exact test were used for qualitative variables , student s t - test for parametric continuous variables and man whitney ( u ) test for non - parametric variables the mean age of the survivors at the time of the study was ( 11.014.6 ) years . fourteen of them ( 40% ) are females , and 21 ( 60% ) are males . sixty % were leukemia of low risk , and 40 % were of standard risk the mean age of them at diagnosis was ( 5.861.5 ) years . the mean age of controls was ( 9.63.3 ) . the weight and bmi were significantly higher in the survivors controls ( p value = 0.002 and 0.039 respectively ) while no significant difference was found between the two groups regarding the height ( p - value = 0.351 ) ( table 1 ) . ( p - value = 0.003 ) and highly significant correlation with weight at diagnosis and after chemotherapy ( p value = < 0.001 ) . also , a highly significant value was detected between obese survivors and positive family history of obesity ( p value = < alt , total & direct bilirubin , serum ferritin and transferrin saturation were significantly higher in the survivors than controls ( p value = 0.03 , 0.036 , 0.044 , 0.006 and 0.03 respectively ) ( table 3 ) . while no significant difference was found between the two groups regarding ast , albumin , creatinine , bun , serum iron and tibc ( table 3 ) . ten ( 28.6% ) of survivors had hepatitis c antibodies with none ( 0% ) of controls ( p value = 0.02 ) ( table 4 ) . a correlation was calculated between cumulative doses of asparaginase and alt , ast , total bilirubin , direct bilirubin . a positive highly significant correlation was found between cumulative dose of asparaginase and liver enzymes ( alt , ast ) ( p value = < 0.001 ) and with total bilirubin ( p - value = 0.003 ) but not with direct bilirubin ( p - value = 0.052 ) ( table 5 ) . no significant correlation was found between liver function ( transaminases and hyperbilirubinemia ) and ferritin levels in survivors ( table 6 ) . the first aim of this study was to assess the prevalence of overweight and obesity in pediatric all survivors . our results revealed that survivors of pediatric all were at risk becoming overweight or obese with long - term follow - up . centers for disease control and prevention ( cdc ) definition growth charts , salazar - martinez et al.26 said that the prevalence of overweight and obesity was 12.1% and 6.2% , respectively , among the healthy egyptian adolescents . this study revealed that overweight and obesity were more prevalent in all survivors compared to general egyptian population , suggesting an impact of chemotherapy on weight gain in all survivors . this datum is in agreement with asner et al.27 who examined the prevalence and the risk factors for overweight and obesity in a cohort of all survivors treated and living in the french speaking part of switzerland reported that there is a significant prevalence of obesity in young all survivors . fang et al.28 indicated a significantly higher bmi in pediatric all survivors than the reference population . however , a study by murphy et al.29 found that on - treatment and survivor groups had a significantly lower body cell mass index than matched controls , and 53% of the survivors were considered undernourished . in a study done on 56 adolescent , all survivors in saudi arabia , with a mean age of 13.4 years an average of 9.1 years post - diagnosis who did not receive crt , the prevalence of bmi for age defined overweight , and obesity ( combined 28.5% ) were lower than in the general population in saudi arabia . the authors supposed that overweight and obesity observed were probably not an all specific problem.30 our results demonstrated that the survivors who had high bmi z - score at diagnosis also had increased risk of being overweight /obese after treatment completion . study which is a retrospective cohort of 83 pediatric patients with all ; they examined bmi status at several key time points : diagnosis ; end of induction ; end of consolidation ; every 6 months during maintenance ; and yearly for up to 5 years post - treatment . at diagnosis , 21% were overweight ( bmi = 8594.9th percentile ) or obese ( bmi 95th percentile ) . at the end of treatment and weight gain during treatment was associated with being overweight / obese 5 years post - treatment ( or = 3.8 , 95% ci : 1.112.5).31 all of the involved survivors had received dexamethasone with the mean cumulative dose of 927 135 mg / m which may be the cause of weight gain . one theory is that , during glucocorticoid treatment , all patients have an increased energy intake32 and reduced energy expenditure on habitual physical activity33 and that this effect continues after treatment ceases . other theories are that glucocorticoid treatment causes increased adiposity by suppressing growth hormone secretion or that it causes resistance to leptin.34 the second aim of this study was to assess the hepatic late adverse effects in pediatric all survivors . at our study , there was a significant increase in d. bilirubin , t. bilirubin , alt , serum ferritin and soluble transferrin saturation in the survivors group more than the control group . ten of our survivors ( 28.6 % ) have hcv positive antibodies detected by elisa . these results go with the previous findings of mulder et al.35 who concluded that abnormal high alt level was detected in survivors of childhood cancer . also , schempp et al.36 found elevated levels of serum ferritin and soluble transferrin ( iron overload ) in survivors of childhood cancer and attributed this to transfusion volume . this iron overload causes tissue damage through the chronic formation of free radicals leading to liver dysfunction.37 in a study of 118 children ( with standard - risk leukemia ) receiving native e. coli asparaginase or peg - asparaginase , abnormal liver function ( grade 3/4 ) , including elevated transaminases and hyperbilirubinemia , was found in 8% of patients receiving native e. coli asparaginase and in 5% of patients receiving peg - asparaginase.38 there are no clear pediatric guidelines for the management of asparaginase in patients with hepatic toxicity , and treatment recommendations vary across protocols . in the dcog all-11 pediatric protocol , patients are required to display aspartate aminotransferase / alanine aminotransferase < 10uln and no signs of jaundice with bilirubin < 3 uln before starting asparaginase treatment.39 patients with hematologic malignancies were at a very high risk of hcv infection due to the large transfusional support they often needed.40 the previously immunocompromised status of the leukemia survivors may have promoted more rapid viral replication or impaired host viral clearance and led to rapidly progressive liver disease.41 moreover , it is known that chemotherapeutic drugs ( methotrexate and 6-mercaptopurine ) increase the risk of liver toxicity during or soon after cancer treatment.13 pediatric all survivors are at increased risk of overweight / obesity , iron overload , hcv infection and delayed hepatic complications . | backgroundchildhood acute lymphoblastic leukemia ( all ) with current cure rates reaching 80% emphasizes the necessity to determine treatment - related long - term effects . the aim of this study is to estimate the prevalence of overweight , obesity , and hepatic late adverse effects in a cohort of all survivors treated at the hematology and oncology unit , pediatrics department , menoufia university , egypt.methodsin this case - control study , height , weight , and body mass index ( bmi ) were assessed for 35 pediatric all survivors and 35 healthy children .
these parameters were plotted on the growth and who standard deviation charts for both males and females .
overweight and obesity were defined by bmi > 85th and 95th percentile respectively .
laboratory investigations were done in the form of iron profile , liver enzymes , total and direct bilirubin levels , serum urea & creatinine and detection of hepatitis c virus antibodies by elisa.resultsthe weight and bmi were significantly greater in the survivors than controls ( p value = 0.002 and 0.039 respectively ) .
alt , total & direct bilirubin , serum ferritin and transferrin saturation were considerably higher in the survivors than the controls ( p value = 0.03 , 0.036 , 0.044 , 0.006 and 0.03 respectively ) .
ten ( 28.6% ) of survivors had hepatitis c antibodies with none ( 0% ) of controls ( p value = 0.02)conclusionspediatric all survivors are at increased risk of overweight / obesity , hepatic dysfunction in the form of elevated liver enzymes , bilirubin levels , and c viral hepatitis .
screening of those survivors for such complications should be considered . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
administration of blood and blood products carries the risk of post - operative bacterial infection and increased rates of recurrence in various malignancies . lower transfusion trigger , pre - operative autologous blood donation ( with or without erythropoietin ) , intraoperative red blood cell salvage , regional anaesthesia , controlled hypotension and antifibrinolytic tranexamic acid ( ta ) is a synthetic antifibrinolytic agent that is approximately 710 times more potent than aminocaproic acid . it blocks the lysine - binding sites of plasminogen , plasmin and tissue plasminogen activator ( tpa ) , and thus delays fibrinolysis and degradation of blood clot . a recent systematic review of over 10,000 patients undergoing various surgeries suggested that administration of ta reduces the need of receiving transfusion by 38% ( relative risk [ rr ] 0.62 , 95% confidence interval [ 95% ci ] : 0.580.65 ; p < 0.001 ) . we wanted to find out whether intraoperative administration of ta reduced blood loss in patients undergoing supramajor head and neck cancer surgery . thromboelastography ( teg ) allows evaluation of kinetics of clot formation and presence and inhibition of fibrinolysis . hypercoagulability , difficult to detect with routine coagulation tests , can be diagnosed with teg displaying a short r - time , broad alpha angle and maximum amplitude ( ma ) > 70 mm . this prospective , double - blind , randomised , placebo - controlled trial was conducted after approval from the institutional review board in a tertiary referral cancer institute in india . we included 240 patients with resectable squamous cell carcinoma of the oral cavity undergoing supramajor surgery viz . , composite resection of the mandible along with neck dissection , requiring reconstructive procedures in the form of pedicled flaps . patients with coagulopathy ( partial prothrombin time > 50 s , or international normalised ratio > 1.5 , platelets < 50 10/l ) , or those who had recent history of ( < 5 days ) acetylsalicylic acid ingestion , patients on anticoagulant therapy ( heparin received within 4 h or warfarin received 3 days pre - operatively ) or those with peripheral vascular disease , pre - existing renal dysfunction ( serum creatinine > 1.2 mg / dl ) , liver dysfunction or known allergy to ta were excluded . the patients were allocated to two groups by random numbers generated using a computer programme , and blocks of 10 were generated . the patient , the anaesthesiologist and the person assessing the blood loss were blinded to the assignment . the study drug , either tranexamic acid ( ta ) 10 mg / kg in 100 ml of normal saline ( ta group ) or placebo ( 100 ml normal saline ) was prepared by one investigator as per the randomisation and handed over to the attending anaesthesiologist who was blinded to the group assignment . patients were stratified a priori according to plan of reconstruction ( pedicled pectoralis major myocutaneous flap or pectoralis major myocutaneous and deltopectoral flap ) . the technique of induction , maintenance and reversal of anaesthesia was left to the discretion of the attending anaesthesiologist . the study drug , prepared in the calculated dose , or placebo was infused over 20 min after induction of anaesthesia before the surgical incision was taken . in the event of prolonged surgeries , the infusion was repeated every 3 h. intraoperative blood loss was calculated by gravimetry , the blood collected in the suction bottle and visual assessment of blood loss in the surgical field . maximum allowable blood loss ( mabl ) was calculated with a transfusion trigger of 8 g% haemoglobin ( hb ) using the formula : mabl = ( [ hb minimum hb]/hb ) ( weight in kg ) ( ml of blood per kg body weight ) . the blood loss was replaced with ringer 's lactate or a colloid until it exceeded the calculated mabl . the anaesthesiologist could override the trigger if the patient developed haemodynamic instability ( heart rate > 120 beats / min , or a systolic blood pressure decrease by > 20% of pre - operative value ) despite adequate volume replacement . assessment of volume status and the amount of fluid to be infused was left to the judgement of the attending anaesthesiologist . the primary endpoint was reduction in blood loss , while the secondary endpoint was the number of patients needing transfusion . we noted demographics , comorbidities , pre - operative and post - operative hb concentration on day 1 and platelet count . we performed teg in the first 50 patients in each group at five intervals : pre - operatively , 1 h after the first dose , 1 h after the second dose , immediately post - operatively on transfer to recovery room and on the morning of the first post - operative day . post - operative blood loss was assessed from the blood collected in the suction drain bottles over the first 24 h. the type and duration of surgery , experience of the surgeon and mean arterial blood pressure during surgery were also recorded . we also noted the urine output in the first 24 h and serum creatinine on post - operative day 1 and 3 . the patients were monitored for development of skin flap and reconstruction flap necrosis ( both graded as edge necrosis , flap loss either more or < 50% ) , oro - cutaneous fistulas , symptomatic deep vein thrombosis , need for surgical re - exploration and other incidental complications until discharge from the hospital . from our previous data , the mean blood loss in patients undergoing composite resections and reconstruction was 750 ml ( standard deviation [ sd ] 100 ) . for the trial to have 80% power to detect a reduction of 40% in the average blood loss , at = 0.05 , ( ps programme , copyright 1997 , vanderbilt university medical center - http://www.mc.vanderbilt.edu/prevmed/ps/ ) we calculated that 100 patients in each group were needed . to compensate for protocol violation such as failure to administer drug , change of surgical plan and non - availability of case record forms statistical analysis was performed on intention to treat basis using student 's t - test and chi - square test . serial measurements were analysed by paired t - test ( for two observations ) and by repeated measures anova ( for more than two observations ) and a p < 0.05 was considered statistically significant . patients in the ta and control groups were similar in sex , age , weight , comorbidities and baseline investigations including the coagulation parameters obtained with teg . the type of reconstructive surgery and duration of surgery was also similar [ table 1 ] . anaesthetic technique including the use of narcotic analgesics and haemodynamic parameters revealed no differences in two groups . the intraoperative blood loss and total blood loss ( a total of intraoperative blood loss and post - operative blood loss ) in the first 24 h in perioperative period was similar in both groups ( 750 ml in ta vs. 780 ml in control group , p = 0.22 , 1000 ml in ta group and 1100 ml placebo group , respectively ) . the difference in post - operative blood loss reached statistical significance ( ta 250 ml vs. 320 ml in the control group , p = 0.009 ) , but did not seem to be clinically significant and did not result in an increase in need for blood transfusion . of 108 patients , 22 needed blood transfusion in ta group while in the placebo group , 27 of 111 needed transfusion ( p = 0.51 ) . intraoperative fluid replacement , crystalloids and colloids were similar in both groups [ table 2 ] . the teg showed hypercoagulable profile at baseline , i.e. , shorter than normal r - time , k - time and wide angle indicating faster acceleration ( kinetics ) of fibrin build up and cross - linking in both groups . at all points when teg was performed the ma was higher than the normal range , and there was absence of significant fibrinolysis in both groups indicated by high clot lysis index at 60 min [ table 3 ] . baseline characteristics , type of reconstruction and duration of surgery blood loss , fluids and blood replacement baseline teg parameters post - operative investigations revealed no differences in two groups and no renal or hepatic dysfunction in the ta group [ table 4 ] . two patients died in the post - operative period , one had a hypoxic cardiac arrest on the second post - operative day in the ward due to a blocked tracheostomy tube ( ta group ) , while the other patient had an unexplained asystolic cardiac arrest ( placebo group ) . , two patients in each group had skin flap necrosis while three each had > 50% necrosis of reconstruction flap ( p = ns ) . one patient ( placebo group ) needed re - exploration of the wound for bleeding on the day of surgery . the incidence of oro - cutaneous fistula was also similar seen in two patients in ta group and three patients in placebo group . in this randomised , double - blind , placebo - controlled study , intravenous administration of ta did not reduce blood loss in patients undergoing supramajor surgery for oral cancers . post - operative blood loss was lower in the patients receiving ta but this difference was neither clinically significant and nor did it cause increased requirement for transfusion in the placebo group . ta administration was safe as there was no surgical complication , organ dysfunction or thromboembolic episode . exposure of tissues to injury causes release of enzymes , mainly tpa , thereby activating the fibrinolytic system . the fibrinolytic response is most pronounced in the intraoperative and early post - operative period . found increased levels of tpa , plasmin - antiplasmin complex and thrombin - antithrombin complex , indicating activation of coagulation . hyperfibrinolytic phase , indicated by increased levels of d - dimers was seen in the placebo group from 4 h onwards intraoperatively . the d - dimers levels returned to baseline on the first post - operative day . in contrast , the d - dimers levels were much lower throughout in patients given ta indicating inhibition of fibrinolysis . benoni et al . measured levels of thrombin fragments ( 1 + 2 ) , d - dimers plasminogen , 2 antiplasmin , tpa and plasminogen activator inhibitor ( pai-1 ) in blood from wound as well as peripheral venous blood . they found significant activation of coagulation and fibrinolysis in both samples , much more in the blood than the wound . d - dimer levels were lower in ta group indicating inhibition of fibrinolysis . in both these studies , blood loss was lower in patients receiving ta . in patients undergoing an orthotopic liver transplant , there was significant fibrinolytic activity , i.e. , high levels of d - dimer and fibrin degradation products , in the normal saline group in contrast to patients receiving ta . inhibition of fibrinolysis by ta was evident from higher clot lysis index than patients given placebo . ta has been shown to reduce blood loss in a variety of surgical procedures such as coronary revascularisation , orthotopic liver transplantation , scoliosis correction surgery , other orthopaedic procedures and caesarean sections . a recent meta - analysis of over 1100 patients also demonstrated the efficacy of antifibrinolytic agents in reducing blood loss in patients undergoing hip athroplasty and total knee replacement . ta was the most efficacious ( rr 0.47 [ 95% ci : 0.400.55 ] ) . the incidence of venous thromboembolism with antifibrinolytic agents was similar to placebo . in trauma patients , ta reduced all - cause mortality as well as the risk of mortality due to bleeding . it has been suggested that ta should be added for routine use in treatment of trauma patients . reducing the need for transfusion in cancer patients may be particularly important as the literature suggests increased recurrence rates in head and neck , colorectal , oesophageal and hepatocellular malignancies after blood transfusion . blood transfusion was associated with earlier recurrence in patients with advanced ovarian cancer undergoing cytoreductive surgery . the literature on the use of ta in cancer patients to reduce blood loss is scarce , with varied results . in 200 patients undergoing retropubic radical prostatectomy , ta led to a 21% absolute reduction ( 95% ci : 734% ) in transfusion rate . the median no of units transfused was also reduced ( 0 [ interquartile range ( iqr ) : 01 ] vs. 1 [ iqr : 01.5 ] ; p = 0.004 ) in patients who received ta . the blood loss was higher in placebo group ( 1103 ml [ sd 500.8 ] vs. 1335 ml [ sd 686.5 ] , [ 95% ci : 29.7370.7 ; p = 0.02 ] ) . in a small case series with historical controls , bednar et al . found that mean estimated blood loss was not reduced by ta in patients undergoing surgical treatment for metastatic tumours of the spine . in patients undergoing various procedures for head and neck cancers , ta administration did not reduce the drainage duration . in patients undergoing hepatectomy for hepatic tumours , perioperative administration of ta was shown to reduce blood loss ( 300 ml [ 302100 ] vs. 600 ml [ 403410 ] ) . cancer patients are hypercoagulable due to the production of various procoagulant activities , such as tissue factor and cancer procoagulant . cancer cells also increase fibrinolytic activity as tpa and urokinase - type plasminogen activator and pai-1 are expressed on their surface . we wanted to document effective inhibition of fibrinolysis with ta , and , therefore , we performed teg in first 100 patients . found a distinct difference in coagulation profile when comparing patients with benign and malignant colorectal lesions . our patients were hypercoagulable to start with ( shortened r and k - time and wide angle ) , and there was also decreased fibrinolytic activity in both groups ( high ma and > 80% clot lysis index at 60 min ) . it is unlikely that the dose of ta used by us was inadequate to achieve inhibition of fibrinolysis as it was similar to doses used in other studies that demonstrated reduced blood loss . an even smaller dose of ta ( 2 mg / kg / h infusion ) reduced fibrinolysis in patients undergoing orthotopic liver transplantation . in a dose response study , the d - dimer concentration was reduced with the smallest dose ( 2.5 mg / kg ) of ta as compared to placebo but the reduction of blood loss became significant from the doses upwards of 10 mg / kg . this may be because the fibrinolytic activity is more pronounced in the wound than in the peripheral blood in patients undergoing surgery . the site of action of ta is , therefore , more likely to be limited to the surgical field than being generalised . ta ( 10 mg / kg ) did not reduce blood loss and need for transfusion of red cells in patients undergoing head and neck cancer surgeries under general anaesthesia . intramural grant from tata memorial hospital , dr . e. borges road , parel , mumbai - 400 012 , maharashtra , india . intramural grant from tata memorial hospital , dr . e. borges road , parel , mumbai - 400 012 , maharashtra , india . | background and aims : transfusion of blood and blood products poses several hazards .
antifibrinolytic agents are used to reduce perioperative blood loss .
we decided to assess the effect of tranexamic acid ( ta ) on blood loss and the need for transfusion in head and neck cancer surgery.methods:after institutional review board approval , 240 patients undergoing supramajor head and neck cancer surgeries were prospectively randomised to either ta ( 10 mg / kg ) group or placebo ( p ) group .
after induction , the drug was infused by the anaesthesiologist , who was blinded to allocation , over 20 min .
the dose was repeated every 3 h. perioperative ( up to 24 h ) blood loss , need for transfusion and fluid therapy was recorded .
thromboelastography ( teg ) was performed at fixed intervals in the first 100 patients .
patients were watched for post - operative complications.results:two hundred and nineteen records were evaluable .
we found no difference in intraoperative blood loss ( ta - 750 [ 6001000 ] ml vs. p - 780 [ 1502600 ] ml , p = 0.22 ) .
post - operative blood loss was significantly more in the placebo group at 24 h ( p - 200 [ 120250 ] ml vs. ta - 250 [ 501050 ] ml , p = 0.009 ) , but this did not result in higher number of patients needing transfusions ( ta - 22/108 and p - 27/111 patients , p = 0.51 ) .
teg revealed faster clot formation and minimal fibrinolysis .
two patients died of causes unrelated to study drug .
incidence of wound complications and deep venous thrombosis was similar.conclusion:in head and neck cancer surgery , ta did not reduce intraoperative blood loss or need for transfusions .
perioperative teg variables were similar .
this may be attributed to pre - existing hypercoagulable state and minimal fibrinolysis in cancer patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
methamphetamine is a highly addictive drug that its abuse has become more widespread over the past years ( 2 , 3 ) . although substance use disorders are not the leading causes of death , they have an important share in disability burden worldwide ( 4 ) . in 2010 , about 0.8 % of world disability - adjusted life years ( daly ) ( 20.0 million dalys ) was directly related to illicit drug dependence ( 5 ) . amphetamine use has different health consequences , including risk of dependence , acute toxic effects ( like fatal overdose , drug induced psychotic symptoms , and myocardial infarction ) , health effects of sustained chronic use ( like psychotic disorders and common mental disorders ) , and accompanying problems like cardiovascular pathology and neurotoxic effects ( 1 , 2 , 6 - 9 ) . methamphetamine is a lipophilic substance , which easily passes the blood brain barrier and has important effects on neurochemical systems ( 10 ) . in cns , methamphetamine enters neuronal cell membranes by binding dopamine , norepinephrine , and serotonin transporters and causes monoamines to leave vesicles and accumulate in cytoplasm and then be transported out of the cell ( 11 , 12 ) . this result in the release of monoamines , which in accompany with decrease in its reuptake ( 13 ) causes monoamines concentration in the extracellular spaces and excessive stimulation of the sympathetic system . the clinical effects of methamphetamine is related to prolonged release of central monoamines , which leads to sympathetic system stimulation ( 11 ) . in chronic users , the sustained and repeated release of central monoamines has a great role in chronic neurologic effects of methamphetamine abuse . frequent use leads to depletion of the dopamine in cns and damages dopamine and serotonin terminals . damage to monoaminergic neurotransmission ( serotonin , norepinephrine , and dopamine ) has important effects on brain circuits and mood regulation and also the function of self - control , motivation , cognitive performance , and psychological stress ( 14 ) . these changes make the user unable to take pleasure without the drugs ( anhedonia ) , which can easily lead to severe depression ( 15 ) . during abstinence and withdrawal , patients experience different symptoms . anxiety and depression are of the most prominent psychiatric complaints of methamphetamine users , which must be considered in the treatment of methamphetamine users ( 16 , 17 ) . after abstinence , some patient s symptoms resolve or decrease during the first few weeks ( 18 ) but some remains that may extend beyond a year or more ( 19 ) . although behavioral counseling is the standard treatment for methamphetamine dependence ( 7 , 20 , 21 ) , pharmacologic and structural interventions seem to be helpful as additional therapies ( 20).understanding different outcomes of methamphetamine abstinence is useful for finding better treatments for dependence . some studies have shown the change in depression symptoms during abstinence but few studies worked on anxiety and quality of life during this period . this study aimed to show the effects of abstinence on depression , anxiety , and quality of life in methamphetamine users . patients who only have methamphetamine addiction ( at the time admission ) are eligible for admission in this center . the usual program of a patient in this camp lasts 5 periods of 21 days . in the first 3 weeks , patients are in a drug free environment ( abstinence ) , and have the peer group ( people who passed this way previously ) support and after the first week , they may receive some minor behavioral interventions . during the second 3- week period , patients stay for 6 weeks but there is not any obligation to stay and they can leave the camp in any stage of the program . a sample of 40 methamphetamine addicted people ( they were using only methamphetamine at the time of study and none of them was using narcotics or other drugs ) who admitted in the therapeutic community ( verdij camp ) for rehabilitation , were selected by the convenient method . of them , 6 people did not complete the abstinence period and left the camp during the study period and 34 participants completed the study . the intervention comprised 3 weeks of abstinence ( first three weeks of peoples stay ) , which was the usual camp program , including staying at the camp without accessing to methamphetamines and with the least supportive and behavioral interventions . no psychological program , group therapy , or pharmacotherapy took place in the first 3-week period . short form of beck depression scale ( 22 - 25 ) , cattell anxiety inventory ( 26 ) , and short
form health survey ( sf-36 ) ( 27 ) were used for outcome assessments . short form of beck has 13 questions and validity and
reliability of its persian version was used in different studies and had validity and reliability with cronbach of 0.83 to 0.85 ( 28 , 29 ) . cattell anxiety inventory has 40 questions , which has two parts for hidden and obvious anxiety . assessment gives a score of 0 to 40 in each section ( total score of 0 to 80 ) and higher scores show more anxiety . the validity of its persian version has been determined and reliability has been reported from 0.65 to 0.85 ( 30 ) . short form health survey ( sf-36 ) has 36 items and 8 subscales and the reliability ( cronbach from 0.77 to 0.90 in subscales ) and validity of its persian version has been confirmed ( 31 ) . all subjects were male , 61.8% ( n = 21 ) aged 20 to 30 years and the rest ( n = 13 ) over 30 years . of them , 52.9% ( n = 18 ) were single , 29.4% ( n = 10 ) were married , 5.2% got divorced and 11.8% were in a state of separation . most of them ( 70.6% ) had high school education and 29.4% had an academic degree . the mean depression score before admission was 17.11 9.75 and after 3 weeks of abstinence it declined to 9.96 7.16 . depression scores after the abstinence decreased and the difference was statistically significant ( p < 0.001 ) . mean scores of hidden , obvious , and total anxiety are shown in table 2 . mean scores of anxiety was 76.00 2.99 at admission and 36.79 4.08 after 3 weeks . hidden , obvious , and total anxiety scores decreased after 3 weeks of abstinence , but none of the changes was significant . the quality of life increased after 3 weeks of abstinence and the difference was significant ( p < 0.001 ) . table 3 shows mean scores for quality of life and its scales before admission and 3 weeks after . quality of life score changes after 3 weeks were significant with respect to physical functioning , role limitations ( emotional
problems ) and mental health subscales . the study findings showed that withdrawal in short term decreased depression level but the anxiety did not change significantly . withdrawal improved quality of life , which could also be seen in some of its scales . a cross sectional study by mcgregor et al . ( 32 ) showed that methamphetamine withdrawal syndrome can be categorized into two phases of first 7 - 10 days of acute phase and a second sub - acute phase , which is at least 2 weeks . in acute phase , increased sleeping and eating , depression , anxiety symptoms , and also craving exist but following the acute phase , these symptoms remain at a low level ( 32 ) . a study showed that substantial percentages ( 40% ) of methamphetamine users , who enter into treatment process , have major depression and another 44% may have substance - induced depression ( 33 ) . depression level of methamphetamine users decreased significantly after withdrawal , which is compatible with other studies ( 18 , 19 , 34 , 35 ) . newton et al . also showed that some degrees of depression exist during the first days of abstinence , which after that time , it reaches to minimal levels ( 36 ) . our study showed that patients entering to the treatment program have a high level of anxiety , including both hidden and obvious , which does not improve in 3 weeks of abstinence . ( 35 ) in a pilot study with 6 patients stated that anxiety symptoms would improve during the first few weeks . small sample size of study and possible use of psychotropic medications in their study may have an effect on the results . also the change in anxiety may have been the result of staying at a supportive group or engaging in study and a hawthorne effect . it has been shown that after methamphetamine use , it enters neuronal cell membranes and causes monoamines release , including serotonin , norepinephrine , and dopamine ( 11 - 13 ) and excessive stimulation of the sympathetic system by this release and also preventing its reuptake . in chronic use of methamphetamines , depletion of monoamines this plays a role on mood regulation and with other changes ( 14 ) can cause anhedonia in a chronic user and move them to depression ( 15 ) . although after abstinence , there are some improvements in depression scores , it is not clear that how much the damaged neurotransmission is repaired or how this improvement happens . a study on brain glucose metabolism in methamphetamine chronic users showed abnormalities in the same parts of brain as in mood disorders ( 37 ) . this metabolic activity is related to patient s depressive symptoms and after cessation of methamphetamine glucose , brain glucose metabolism improves but not in all parts of the brain ( 38 ) . frequency of depression and anxiety in methamphetamine users is high and their diagnosis accompanying substance - induced symptoms of depression is difficult . it is obvious that behavioral counseling is the standard treatment for methamphetamine dependence ( 7 , 20 , 21 ) , but pharmacologic interventions seem to be helpful as additional interventions ( 20 ) . although after withdrawal , depression symptoms improve , depression must be addressed in the process of care . medical treatment of depression for these patients needs more attention . some routine treatments of depression may have adverse outcomes in these patients . using selective serotonin reuptake inhibitors ( ssris ) is very common for depression and anxiety disorders but in methamphetamine users , it is probably associated with craving and increased risk of relapse during treatment and psychosocial interventions , thus some consider it as contraindicated ( 39 , 40 ) . there are researches that suggest some medications have role in the management of mood disorders in methamphetamine users . citicoline could have an antidepressant role in these patients ( 41 ) ; both quetiapine and risperidone can improve manic , mixed , and depressive symptoms and also decrease drug cravings ( 42 ) but reported to be abused by some ( 43 ) and positive effects of dopamine agonists on the activity of the brain and behavior , which could be a hope for pharmacologic treatment of stimulant dependence ( 44 ) . the improvement in subscales of mental health , role limitations ( emotional
problems ) and physical functioning are significant . a study on methamphetamine users at admission for treatment , showed quality of life in this group is less than normal population , especially in mental issues ( 45 ) . a one - year study on 723 methamphetamine addicted people showed that treatment completion and continued care improve health related quality of life . our study shows positive effects of short - term abstinence on depression and quality of life in methamphetamine chronic abusers . as remaining withdrawal symptoms have a role in treatment success high level of anxiety in abstinence period and after that must be addressed in treatment of methamphetamine users , which can help in their abstinence and also recovery of patients to enable them for a productive life . our study was done in a therapeutic community and an environment , which is different from ordinary life . this must be considered in the change of quality of life ; therefore , a longer time follow - up is needed after finishing the program . lack of a comparison group was another weakness in our study , so we can not be sure if the change is the effect of abstinence only or other factors like being in a group had a role . the relatively small sample size may have some effects , especially where differences were non - significant . accordingly , a randomized trial with a bigger sample size is needed to confirm our findings . | background : during withdrawal , patients experience different symptoms .
these symptoms are associated with relapse .
understanding different outcomes of methamphetamine abstinence is useful for finding better treatments for dependence.objectives:this study aimed to show the effects of abstinence on depression , anxiety , and quality of life in methamphetamine users.patients and methods : a prospective quasi - experimental ( before and after study ) method was used to show the effect of 3 weeks abstinence on depression , anxiety , and quality of life . a convenient sample of addicted people entered into the study and 34 people completed the study .
beck depression scale , cattell anxiety inventory and short form health survey ( sf-36 ) ( for assessing quality of life ) , were used for outcome assessments.results:the mean depression score after abstinence decreased significantly ( p < 0.001 ) . both hidden and obvious anxiety and total anxiety had a high level at admission and after 3 weeks of abstinence ,
the mean level of anxiety did not change significantly ( p < 0.096 ) .
however , the quality of life increased after 3 weeks of abstinence ( p < 0.001).conclusions : depression and anxiety are prevalent in methamphetamine users .
short - term abstinence improves depression and quality of life but does not improve anxiety in methamphetamine abusers . during follow up of these patients , addressing depression and anxiety is important to achieve better results . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hyperuricemia , defined as high levels of blood uric acid , is the major etiological factor of gout ( 1 ) , recently , increasing serum levels of uric acid ( sua ) has been found to be linked to the prevalence of the metabolic syndrome , cardiovascular diseases , cerebrovascular disease and it was found as a predictor of micro albuminuria and renal dysfunction ( 27 ) . in recent years , the prevalence of hyperuricemia in china is dramatically increasing , about 18.66% ( 8) . hyperuricemia induces vascular diseases , possibly through the generation of reactive oxygen species and subsequent endothelia dysfunction , which exerts the pro - inflammatory effects ( 9 ) . kenneth rock noted that uric acid might be an activator of the immune system by stimulating dendritic cell maturation and t lymphocytes ( 10 ) . the il-1/il-1r pathway maybe explained the inflammatory link between sua and endothelial dysfunction ( 11 ) . uric acid can also inhibit endothelial generation of nitric oxide that induces lipid oxidization and impairs endothelium - dependent vasodilation ( 12 ) . sua was increasing in postmenopausal women ( 13 ) , which may increase the risk of cardiovascular diseases , metabolic syndrome , diabetes and other chronic metabolic diseases ( 1417 ) . one possible explanation of physical mechanisms was estrogenic signaling might decrease sua through affecting the activity of renal ( 18 ) . it is well known that stronger estrogenic effect is a major etiology of uterine fibroids and fibrocystic breast disease ( 20 , 21 ) . factors increase overall lifetime exposure to estrogen , such as obesity and early menarche , are positively associated with the incidence of uterine fibroids ( 22 ) . in patients suffering from uterine fibroids and fibrocystic breast disease , whether sua are lower than the general due to stronger estrogenic effect ? if so , it may offer evidence to support the role of estrogenic effect on sua metabolism in females . this study selected participants with uterine fibroids , fibrocystic breast disease or uterine fibroids combining with fibrocystic breast disease as cases , and participants without these diseases as controls . thereby , we can explore whether estrogenic effect can regulate sua and open a new view to prevent and treat hyperuricemia in females . all participants were regular and registered staffs or retirees of enterprises and institutions in dongying city with the benefit of free health check - up once a year . participants were selected from health check - up records of a general hospital in shandong province from jan 2011 to jan 2012 . we included 5728 female participants with an age range of 1972 yr who had intact health check - up records . exclusion criteria for participants : fasting blood glucose ( fbg)>8.00 mmol / l ( osmotic diuresis critical point is 8.96mmol / l ) ; ast100u / l or alt100u / l ; creatinine clearance ( ccr)<50ml-/min or blood uric nitrogen ( bun)>9mmol / l ( 23 ) ; currently using diuretics , allopurinol or uricosuric agents ; gout patients ; surgery history of hysterectomy , mastectomy or ovarian cystectomy ; current or former hormone replace therapy ( hrt ) users ; present or past histories of endometriosis , ovarian tumors and polycystic ovarian syndrome ; current in the stage of pregnancy or breastfeeding . finally , a total of 5555 female participants were recruited . the study set up three cases : case i 568 uterine fibroids patients aged 1972 yr ; case ii 608 fibrocystic breast disease patients aged 19 - 54 yr ; case iii 173 patients diagnosed with both uterine fibroids and fibrocystic breast disease aged 1954 yr . the study set up two controls : control i 4206 people without uterine fibroids and fibrocystic breast disease aged 1972 yr ( vesus case i ) ; control ii 3762 people from control i excluding age above 54 yr ( vesus case ii and case iii ) . the oldest uterine fibroids patients were 72 yr old and no fibrocystic breast disease patients were older than 54 yr old . since sua differs in women s lifespan due to menopause , for each condition , participants were further divided into different age groups : 1944 ( reproductive period ) , 4554 ( menopause ) , 5559 ( early post - menopause ) and 60 ( post - menopause ) for case i and control i ; 1944 ( reproductive period ) and 4554 ( menopause ) for case ii , case iii and control ii . standardized interviews and self - reported questionnaires were used to obtain the following information : age ( in years ) ; medical history including cardiovasculuar diseases , metabolic diseases , uterine fibroids , endometriosis , fibrocystic breast disease , ovarian tumors , polycystic ovarian syndrome and so on ; operation history including hysterectomy , mastectomy , ovarian cystectomy and so on ; use of prescription medication including anti - hypertensives , allopurinol , uricosuric agents , hormone use and so on ; histories of pregnancy , delivery and breast feeding . body mass index ( bmi ) was calculated by dividing the weight in kilograms by the square of the height in metres . blood pressure ( bp ) was obtained from the right arm of the subject in a relaxed , sitting position after 5 min rest . systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) were recorded for twice by mercury sphygmomanometers . blood samples were obtained by venipuncture in the morning after fasting overnight ( at least 12 h ) . laboratory test included : fasting blood glucose ( fbg ) , total cholesterol level ( t - ch ) , triglyceride ( tg ) , glutamic - pyruvic transaminase ( alt ) , glutamic - oxalacetic transaminase ( ast ) , blood uric nitrogen ( bun ) , blood creatinine ( cr ) and sua . glomerular filtration rate ( gfr ) , estimated by creatinine clearance ( ccr ) using the cockcroft - gault ( cg ) formula : ( 140 age ) weight/(serum creatinine85 ) . uterine fibroids and fibrocystic breast disease were confirmed by professional gynecologistis according to the standard protocol of the health check - up institute ( 24 , 25 ) . if variances were homogenious , the mean differences between groups were compared by student s t test . a p - value of less than 0.10 was considered to be statistically significant when comparing differences between cases and control by student s t test . after adjustment for covariant variables , the associations between the two kinds of diseases and sua were evaluated using the generalized linear regression mode . the study set sua as the dependent variable ; the presence of diseases from cases as the independent variable ; risk factors selected based on results of independent - sample t test ( p<0.10 ) as covariant variables . compared with controls , partial regression coefficient of cases represented differences of sua ( ug / l ) between the case and control . a p - value of less than 0.05 was considered to be statistically significant by generalized linear regression mode . all participants were regular and registered staffs or retirees of enterprises and institutions in dongying city with the benefit of free health check - up once a year . participants were selected from health check - up records of a general hospital in shandong province from jan 2011 to jan 2012 . we included 5728 female participants with an age range of 1972 yr who had intact health check - up records . exclusion criteria for participants : fasting blood glucose ( fbg)>8.00 mmol / l ( osmotic diuresis critical point is 8.96mmol / l ) ; ast100u / l or alt100u / l ; creatinine clearance ( ccr)<50ml-/min or blood uric nitrogen ( bun)>9mmol / l ( 23 ) ; currently using diuretics , allopurinol or uricosuric agents ; gout patients ; surgery history of hysterectomy , mastectomy or ovarian cystectomy ; current or former hormone replace therapy ( hrt ) users ; present or past histories of endometriosis , ovarian tumors and polycystic ovarian syndrome ; current in the stage of pregnancy or breastfeeding . finally , a total of 5555 female participants were recruited . the study set up three cases : case i 568 uterine fibroids patients aged 1972 yr ; case ii 608 fibrocystic breast disease patients aged 19 - 54 yr ; case iii 173 patients diagnosed with both uterine fibroids and fibrocystic breast disease aged 1954 yr . the study set up two controls : control i 4206 people without uterine fibroids and fibrocystic breast disease aged 1972 yr ( vesus case i ) ; control ii 3762 people from control i excluding age above 54 yr ( vesus case ii and case iii ) . the oldest uterine fibroids patients were 72 yr old and no fibrocystic breast disease patients were older than 54 yr old . since sua differs in women s lifespan due to menopause , for each condition , participants were further divided into different age groups : 1944 ( reproductive period ) , 4554 ( menopause ) , 5559 ( early post - menopause ) and 60 ( post - menopause ) for case i and control i ; 1944 ( reproductive period ) and 4554 ( menopause ) for case ii , case iii and control ii . standardized interviews and self - reported questionnaires were used to obtain the following information : age ( in years ) ; medical history including cardiovasculuar diseases , metabolic diseases , uterine fibroids , endometriosis , fibrocystic breast disease , ovarian tumors , polycystic ovarian syndrome and so on ; operation history including hysterectomy , mastectomy , ovarian cystectomy and so on ; use of prescription medication including anti - hypertensives , allopurinol , uricosuric agents , hormone use and so on ; histories of pregnancy , delivery and breast feeding . body mass index ( bmi ) was calculated by dividing the weight in kilograms by the square of the height in metres . blood pressure ( bp ) was obtained from the right arm of the subject in a relaxed , sitting position after 5 min rest . systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) were recorded for twice by mercury sphygmomanometers . blood samples were obtained by venipuncture in the morning after fasting overnight ( at least 12 h ) . laboratory test included : fasting blood glucose ( fbg ) , total cholesterol level ( t - ch ) , triglyceride ( tg ) , glutamic - pyruvic transaminase ( alt ) , glutamic - oxalacetic transaminase ( ast ) , blood uric nitrogen ( bun ) , blood creatinine ( cr ) and sua . glomerular filtration rate ( gfr ) , estimated by creatinine clearance ( ccr ) using the cockcroft - gault ( cg ) formula : ( 140 age ) weight/(serum creatinine85 ) . uterine fibroids and fibrocystic breast disease were confirmed by professional gynecologistis according to the standard protocol of the health check - up institute ( 24 , 25 ) . if variances were homogenious , the mean differences between groups were compared by student s t test . a p - value of less than 0.10 was considered to be statistically significant when comparing differences between cases and control by student s t test . after adjustment for covariant variables , the associations between the two kinds of diseases and sua were evaluated using the generalized linear regression mode . the study set sua as the dependent variable ; the presence of diseases from cases as the independent variable ; risk factors selected based on results of independent - sample t test ( p<0.10 ) as covariant variables . compared with controls , partial regression coefficient of cases represented differences of sua ( ug / l ) between the case and control . a p - value of less than 0.05 was considered to be statistically significant by generalized linear regression mode . demographic and biochemical parameters of participants according to cases and age categories were listed in table 1 ( for uterine fibroids and control ) , table 2 ( for fibrocystic breast disease and control ) and table 3 ( for uterine fibroids combining with fibrocystic breast disease and control ) . demographic data and laboratory parameters in the case of uterine fibroids and control note : values expressed as mean ( sd ) ; abbreviations : bmi , body mass index ; sbp , systolic blood pressure ; dbp , diastolic blood pressure ; t - ch , total cholesterol level ; tg , triglyceride ; fbg , fasting blood glucose ; sua , serum levels of uric acid . demographic data and laboratory parameters in the case of fibrocystic breast disease and control note : values expressed as mean ( sd ) demographic data and laboratory parameters in the case of uterine fibroids combining with fibrocystic breast disease and control note : values expressed as mean ( sd ) from table 1 ( for uterine fibroids and control ) , totally for all ages , bmi , t - ch , tg and fbg of the case were higher compared with the control but sua were lower . when considering age categories , from 1944 yr , bmi , sbp , dbp , t - ch , tg and fbg of the case were higher than the control ; from 4554 yr , it was found only t - ch in the case were lower than that in the control ; from 5559 yr , bmi , sbp , dbp , t - ch , fbg and sua of the case were lower than the control ; from 6072 yr , bmi , sbp , dbp and sua of the case were lower than the control . from table 2 ( for fibrocystic breast disease and control ) , totally for all ages , bmi , sbp , dbp , tg and sua in the case were lower than the control . when considering age categories , from 1944 yr , bmi , sbp , tg and sua of the case were lower than the control ; from 4554 yr , dbp and tg of the case were lower than the control . from table 3 ( for uterine fibroids combining with fibrocystic breast disease and control ) , totally for all ages , only sua of the case were lower than the control . when considering age categories , from 1944 yr , bmi and t - ch of the case were higher than the control ; from 4554 yr , bmi , sbp , dbp and sua of the case were lower than the control . to compare differences of sua between cases and controls , the study built 11 generalized linear regression models according to age categories among three cases ( the note of table 4 showed adjusted variables in different models respectively ) covariant variables entered generalized linear regression models were selected by t test at the standard of p<0.10 , as follows from table 13 . in comparison with controls , sua of three cases decreased by 9.62 umol / l , 4.69 umol / l and 10.91 umol / l respectively . when taking age into consideration , the decreasing sua differed from each other . from 19 to 44 yr , sua of case i to case iii were lower than controls by 8.46 umol / l ( p=0.011 ) , 5.88 umol / l ( p=0.014 ) and 9.39 umol / l ( p=0.059 ) , respectively . from 4554 yr , no significant differences were between three cases and controls . in case i and its control : from 5459 yr , differences were not significant ; from 60 to 72 yr , sua in case i was lower than the control by 32.02 umol / l ( p=0.003 ) . differences in sua ( umol / l ) among cases and controls of different age groups by generalized linear regression adjusted for bmi , t - ch , tg , fbg and age ; adjusted for bmi , sbp , dbp , tg , t - ch and fbg ; adjusted for bmi , sbp , dbp , t - ch and fbg ; adjusted for bmi , sbp and dbp ; adjusted for bmi , sbp , dbp , tg and year ; adjusted for bmi , sbp and tg ; adjusted for dbp and tg ; adjusted for bmi and t - ch ; adjusted for bmi , sbp and dbp . demographic and biochemical parameters of participants according to cases and age categories were listed in table 1 ( for uterine fibroids and control ) , table 2 ( for fibrocystic breast disease and control ) and table 3 ( for uterine fibroids combining with fibrocystic breast disease and control ) . demographic data and laboratory parameters in the case of uterine fibroids and control note : values expressed as mean ( sd ) ; abbreviations : bmi , body mass index ; sbp , systolic blood pressure ; dbp , diastolic blood pressure ; t - ch , total cholesterol level ; tg , triglyceride ; fbg , fasting blood glucose ; sua , serum levels of uric acid . demographic data and laboratory parameters in the case of fibrocystic breast disease and control note : values expressed as mean ( sd ) demographic data and laboratory parameters in the case of uterine fibroids combining with fibrocystic breast disease and control note : values expressed as mean ( sd ) from table 1 ( for uterine fibroids and control ) , totally for all ages , bmi , t - ch , tg and fbg of the case were higher compared with the control but sua were lower . when considering age categories , from 1944 yr , bmi , sbp , dbp , t - ch , tg and fbg of the case were higher than the control ; from 4554 yr , it was found only t - ch in the case were lower than that in the control ; from 5559 yr , bmi , sbp , dbp , t - ch , fbg and sua of the case were lower than the control ; from 6072 yr , bmi , sbp , dbp and sua of the case were lower than the control . from table 2 ( for fibrocystic breast disease and control ) , totally for all ages , bmi , sbp , dbp , tg and sua in the case were lower than the control . when considering age categories , from 1944 yr , bmi , sbp , tg and sua of the case were lower than the control ; from 4554 yr , dbp and tg of the case were lower than the control . from table 3 ( for uterine fibroids combining with fibrocystic breast disease and control ) , totally for all ages , only sua of the case were lower than the control . when considering age categories , from 1944 yr , bmi and t - ch of the case were higher than the control ; from 4554 yr , bmi , sbp , dbp and sua of the case were lower than the control . to compare differences of sua between cases and controls , the study built 11 generalized linear regression models according to age categories among three cases ( the note of table 4 showed adjusted variables in different models respectively ) . covariant variables entered generalized linear regression models were selected by t test at the standard of p<0.10 , as follows from table 13 . in comparison with controls , sua of three cases decreased by 9.62 umol / l , 4.69 umol / l and 10.91 umol / l respectively . when taking age into consideration , the decreasing sua differed from each other . from 19 to 44 yr , sua of case i to case iii were lower than controls by 8.46 umol / l ( p=0.011 ) , 5.88 umol / l ( p=0.014 ) and 9.39 umol / l ( p=0.059 ) , respectively . from 4554 yr , no significant differences were between three cases and controls . in case i and its control : from 5459 yr , differences were not significant ; from 60 to 72 yr , sua in case i was lower than the control by 32.02 umol / l ( p=0.003 ) . differences in sua ( umol / l ) among cases and controls of different age groups by generalized linear regression adjusted for bmi , t - ch , tg , fbg and age ; adjusted for bmi , sbp , dbp , tg , t - ch and fbg ; adjusted for bmi , sbp , dbp , t - ch and fbg ; adjusted for bmi , sbp and dbp ; adjusted for bmi , sbp , dbp , tg and year ; adjusted for bmi , sbp and tg ; adjusted for dbp and tg ; adjusted for bmi and t - ch ; adjusted for bmi , sbp and dbp . based on a large sample of health check - up records , the study showed that people suffering from uterine fibroids , fibrocystic breast disease or uterine fibroids combined with fibrocystic breast disease had a significantly lower sua than controls except periods of menopause and early post - menopause , which indirectly supported our primary hypothesis that estrogenic effect may positively adjust sua metabolism in females . in the health check - up survey , it was unrealistic to determine menopausal period through testing serum estradiol levels in a large sample . so we divided age groups based on former chinese epidemiological data . according to lin li s study of 21,113 women aged 4065 yr in 13 cities , china , age at natural menopause was most between 45 to 55 yr and only no more than 3% of women were still at menopause between 55 to 60 yr ( 26 ) . so we set age groups as 1944 ( reproductive period ) , 4554 ( menopause ) , 5559 ( early post - menopause ) and 60 ( post - menopause ) . in our study , the oldest uterine fibroids patients were 72 yr old , so we set the highest age category as 6072 yr in the case of uterine fibroids . some scholars may doubt that after menopause , as the ovaries s function declines , some uterine fibroids tend to atrophy without estrogenic effect . however , uterine fibroids are still the most common benign tumors in postmenopausal women ( 27 ) . bachmann suggested that after menopause , ovaries still continue to produce testosterone , and peripheral tissues metabolize testosterone to active estrogen ( 28 ) . additionally , adipose tissue is able to produce increasing levels of estrogen with age at the time of menopause ( 29 ) . on the other hand , the estrogen receptor - alpha ( er- , a kind of estrogen receptors ( ers ) , estrogen becomes functional mainly in the presence of er- ( 30))gene polymorphisms have been reported to be associated with uterine leiomyoma risk ( 31 ) , which have no relationships with aging . so , it is reasonable to include participants among the age category of 6072 yr . fibrocystic breast disease become most evident in women between 35 and 55 yr of age ( 32 ) . it is caused by a proliferation of epithelial cells in the lobulo - alveolar region . after menopause , women s breast epithelial tissue has become atrophic with changed respond to hormonal messengers ( 32 ) . generally , in post - menopausal women , few of them suffer from this kind of disease . so in this study , no patients of fibrocystic breast disease were older than 54 yr old . the two key steps in keeping normal sua are synthesis in liver and excretion in kidney . we excluded participants whose liver and kidney function were damaged judged by laboratory indexs : transaminases that reflect liver function ; ccr and bun that reflect glomerular filtration function . moreover , osmotic diuresis due to hyperglycaemia can decrease sua pathologically , so we excluded people whose fbg>8.00 mmol / l . uterine fibroids and fibrocystic breast disease were related to body size , diabetes and atherosclerosis ( 3335 ) and these factors also influence uric acid metabolism ( 2 ) . to keep comparative groups matched , we adjusted bmi , sbp , dbp , t - ch , tg and fbg by generalized regression model . however , we did not include ccr as an adjusted variable like former studies did , because maybe ccr is an intermediary variable in the analysis between estrogenic effect and sua ( 36 ) . moreover , from table 13 , it was found that differences of these parameters between 3 pairs of cases and controls were variated according to age categories , so the study built 11 individual generalized linear regression models to fit for different conditions referred to diseases and age . stronger estrogenic effect ( higher level of estrogen binding higher express of ers ) than normal plays an important part in the etiology of uterine fibroids and cyclomastopathy ( 30 , 37 ) . it has been reported that estrogenic effect can regulate the metabolism of sua ( 18 ) . in renal , estrogen induces fractional excretion of uric acid and higher levels of estradiol leads a lower postsecretory tubular reabsorption of urate ( 18 ) . wang w indicated that gene polymorphism of er- affects sua reduction after bariatric surgery ( 39 ) . therefore , due to higher estrogenic effect on regulation of sua , participants with uterine fibroids and fibrocystic breast disease in our study had lower sua than controls . when exploring sua in uterine fibroids patients according to age categories , although in groups of reproductive period and post - menopause period , sua in cases were all lower than controls , but differed in ranges . in the age category of 1944 yr ( reproductive period ) , the case was 9.62umol / l lower than control , which is not as great as that in the age category of 6072 yr ( the case was 32.02 . the possible reason may be : the physiological effect of estrogen are realized by enough levels of estrogen binding active ers . in the reproductive period , no matter in the case or the control , generally , endogenous estrogen level is relatively higher overall , which can ensure the normal regulation on metabolism . thus , sua of the control was relatively lower ( 237.05 umol / l ) compared with participants after menopause ( 271.22 umol / l ) . and however , among people of 6072 yr ( post - menopause period ) , in general , endogenous estrogen level is lower than premenopause because of weakened ovarian function . therefore it is reasonable that after menopause , losing protection of estrogenic effect , females are likely to suffering from hyperuricemia ( 13 ) . however , in people with uterine fibroids , a stronger er- immunoreactivity was observed in the post - menopausal group compared with the premenopausal group ( 40 ) . high activity of ers keep people with uterine fibroids after menopause can still have strong estrogenic effect , which can protectively decrease sua in a certain degree . in the group of post - menopause period , moreover , if estrogenic effect can decrease sua , in menopause ( 4554 yr old ) group and early post - menopause ( 5559 yr old ) group , why we found that the difference of sua was not obvious between the case and control ( p - values are 0.725 and 0.21 separately ) ? possible explanation of the result is that throughout menopause , levels of different hormones rise and fall : 1- the abnormal metabolism of female is due to raised level of androgens ( 41 , 42 ) . 2-the eccentric raised level of glucocorticoid may hamper the activity of estrogen ( 43 , 44 ) . how estrogeic effect realizes its function on sua ? whether it is relied on higher level of estrogen or stronger effect of ers ? many studies have explored the role of estrogen ( especially exogenous estrogen ) for adjusting sua . . showed that hormone replacement therapy ( hrt ) reduced sua in certain group of postmenopausal women with hyperuricaemia ( 45 ) . based on the third national health and nutrition examination survey , hak et al . got similar results ( 13 ) however , after using hrt , sua did not change significantly in post - menopausal women ( 36 ) . maybe , the controversial outcomes from hrt were due to different effects of ers among individuals . recently , it is found that ers , especially er- play an essential role in the realization of estrogenic effect , which differs according to their genotypes ( 39 , 46 ) . moreover , stronger effect of er- plays an important part in the etiology of uterine fibroids and fibrocystic breast disease ( 37 , 47 ) . brandon discoverd that ers gene expression increased in leiomyoma compared with normal myometrium ( 48 ) . so maybe , stronger effect of ers may be another mechanism for lower sua in uterine fibroids and fibrocystic breast disease patients compared with controls in our study . only with health check - up data , we can not be sure which one , higher level of estrogen or stronger effect of ers , is more important for estrogenic effect on sua . further studies can focus on : 1 ) explore ers functions for regulating sua through immunohistochemistry from related biopsy samples or ex - vivo experiments ; 2 ) compare serum active estrogen s levels ( like estradiol ) from patients of uterine fibroids and fibrocystic breast disease with the general . since this is a cross sectional study , we could nt determine a casual relationship . in addition we did not partition disease grades according to the severity of uterine fibroids and fibrocystic breast disease , so we could not analyze dose - response of exposure and outcome . participants of uterine fibroids and fibrocystic breast disease had a lower sua except the stage of menopause . that may indirectly support that estrogenic effect can protectively keep sua at a relatively lower level in females . this study was approved by the ethics committee of school of public health , shandong university and informed oral consent was obtained from each participant . since many individuals invovled in this study were workers from rural areas , some of whom were illiterate , the informed consent was read and explained by investigators , and participants were told that their health examination data might be applied for reaserch without private information leakage ( including name , contact information and so on ) . the whole process was recorded by voice recorders ( recorder pens ) , which can supervise behaviors of investigators and keep qualities of the survey . | background : increasing serum levels of uric acid ( sua ) after menopause in women brought up a hypothesis that estrogenic effect may protectively regulate sua .
estrogenic effect is a major etiology of uterine fibroids and fibrocystic breast disease .
the study aimed to explore sua among patients suffering from these diseases to enhance the hypothesis.methods:overall , 1349 female participants were selected into three cases : case i having uterine fibroids ( n=568 ) , case ii having fibrocycstic breast disease ( n=608 ) and case iii having uterine fibroids combining with fibrocycstic breast disease ( n=173 ) ; 4206 participants without these diseases were selected as controls . based on health check - up data from 2011 to 2012 , in dongying shengli oilfield central hospital ,
a cross - sectional study was conducted to examine the difference in sua between the case and control .
we adjusted covariates by generalized linear regression mode.results:from 19 to 44 yr , sua of case i to case iii were lower than controls by 8.46 umol / l ( p=0.011 ) , 5.88umol / l ( p=0.014 ) and 9.39 umol / l ( p=0.059 ) , respectively . from 4554 yr ,
no significant differences were between three cases and controls . in case i and its control : from 5459 yr , differences were not significant ; from 60 to 72 yr , sua in case i was lower than the control by 32.02umol / l ( p=0.003).conclusion : participants of uterine fibroids and fibrocystic breast disease had a lower sua except the stage of menopause , which indirectly supported that estrogenic effect , may protectively decrease sua . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cancer is the leading cause of death in economically developed countries and the second leading cause of death in developing countries . advancements have been made in traditional treatment modalities that have been used for decades , namely , surgery , radiotherapy , and chemotherapy . in addition , with the value of early diagnosis in cancer therapy recognized , the technology of early diagnosis is also advancing . although these treatment modalities play an important role , the results are not entirely adequate , especially for advanced cancers . cancer is still a major public health problem worldwide , and new treatment modalities and strategies are still needed to optimize patient outcomes . cancer immunotherapy , which can be generally classified as passive or active , has always been an attractive and potentially efficient treatment for cancer patients . passive immunotherapy , consisting of infusion of donor t lymphocytes and transfer of anticancer monoclonal antibodies , has been proven to be an effective treatment for a variety of cancers [ 3 , 4 ] , and continued advances in t - cell engineering and antibody should further enhance their clinical impact . however , vaccines , which represent active immunotherapy , are based on the manipulation of the host immune system to fight cancer and provide a path to obtain long - lasting responses in cancer patients . as one of the major players in active immunity , cytotoxic t lymphocytes ( ctls ) play a critical role in immunity against cancers . a variety of vaccine strategies have been designed to meet this goal , and recent phase ii / iii clinical trials using these vaccines have achieved promising results . cancer vaccines enhance the antitumor immune response by providing the early signals of activity ; dendritic cells ( dcs ) play an important role in this immune response activation , which involves a number of complex processes . first , dcs must capture tumor antigens , process the captured antigen for presentation on major histocompatibility complex ( mhc ) molecules ( either class i or class ii ) , and then migrate to draining lymph nodes . if capture and processing is accompanied by a suitable activation signal , dcs will enhance the activation of the immune response . if not , dcs will instead induce tolerance . second , in lymphoid organs , tumor - antigen - loaded dcs are capable of triggering protective t - cell responses , especially ctl responses . in this process , dcs require a maturation signal ( i.e. , a stimulatory adjuvant ) in order to elicit the desired ctls [ 9 , 10 ] . without a maturation signal , dcs present antigens in a stable state , which promotes tolerance by inducing regulatory t cell ( treg ) production and thereby thwarting an antitumor response [ 1113 ] . in addition , the ability of dcs to promote a ctl response also depends on the interaction of a positive t - cell costimulatory molecule ( i.e. , cd28 , ox40 ) with dc surface receptors ( i.e. , cd80/cd86 , ox40l ) ; the interaction of the negative t - cell costimulatory molecule ( i.e. , ctla-4 , lag-3 ) with the dc surface receptors can limit the activity of ctls by promoting treg formation . for these reasons , the appropriate utilization and regulation of dcs correlate with the success or failure of vaccine design . all in all , increasing immune activation by dcs is a critical step for improving ctl antitumor immune responses ( figure 1 ) . targeted therapy is a typical representative of selective , mechanism - based therapy and has become a new treatment option . based on the molecular mechanisms of ctl activation , targeted drugs can not only promote the capture of tumor antigens by dcs can also enhance the expression of costimulatory molecules such as cd40 , cd80 , and cd86 on the dc surface . moreover , targeted drugs block important inhibitory signals for activated t - cells , thereby maintaining t cell activation and potentiating tumor destruction . in general , through regulation of dcs and activated t cells , targeted drugs effectively boost ctl activation [ 1517 ] . furthermore , activated ctls must enter the tumor microenvironment to perform their functions , at which point a variety of negative regulatory signals suppress the immune response ; ctls must overcome the tolerance induced by tumor cells in order to mediate their cytotoxic effects . therefore , the effects of drugs that target the processes that generate ctl antitumor immune responses can be complementary and synergistic with cancer vaccines . combinatorial therapy provides a new treatment modality that enhances the vaccine - induced ctl antitumor immune response . however , greater focus on the appropriate dosage , sequencing , and timing of the targeted drugs is needed , as it will probably be crucial to the success of combinatorial strategies . another key issue for combinatorial therapies is the toxicity of these regimens . in general , the ultimate goal of enhancing vaccine - induced ctl antitumor immune responses encouraged by positive preclinical and clinical data [ 2125 ] , the research into the appropriate utilization and regulation of dcs in vaccine design continues , and the study of the combination of vaccines and targeted drugs aims to solve the above - mentioned problems . dcs , as the most efficient antigen - presenting cells ( apcs ) , have been increasingly used in various strategies of vaccine design to enhance their unique ability to activate antitumor ctls . these strategies facilitate the capture of tumor antigens by dcs , which helps to stimulate the activation of ctls in the next step . in the past few decades , vaccine design strategy has included several antigen - loading techniques to activate dcs , such as ( i ) pulsing dcs with peptides or proteins , ( ii ) transfecting dcs with dna or rna , ( iii ) loading dcs with tumor - cell lysates or tumor cells , and ( iv ) infecting dcs with bacterial , viral , or yeast vectors . ( figure 1(a ) ) in contrast , vaccines that do not utilize dcs tend to depend on the immunogenicity of the vaccines itself , which are not enough to elicit a stronger ctl response [ 27 , 28 ] . dcs transfected with the human telomerase reverse transcriptase ( htert)-hil18 gene were capable of eliciting a stronger htert - specific ctl response in vitro than those stimulated with the htert construct only . this strategy of vaccine design utilizes dc activation in vitro in order to avoid the complex regulation of dc exposure to antigen in vivo . on antigen encounter in vivo , dcs require a suitable activation and maturation signal to promote immunity ( enhanced capture , processing and presentation of tumor antigen - derived peptides ) rather than tolerance [ 7 , 30 ] . these signals include endogenous tumor cell lysates ( e.g. , high mobility group proteins or atp ) and exogenous molecules ( e.g. , toll - like receptor ( tlr ) ligands or antibodies ) . like tlr ligands ( which will be discussed later in this paper ) , monoclonal antibodies can been used to facilitate the capture of tumor antigens by dcs . trastuzumab and cetuximab are clinically efficacious monoclonal antibodies that are directed toward the tumor - associated receptor tyrosine kinases her2 and egfr , respectively . these antibodies not only downregulate oncogenic signaling , but also enhance the induction of tumor - specific ctls [ 31 , 32 ] . these antibodies coat tumor - associated receptors on tumor cells and bind fc receptors expressed on dcs simultaneously to form immune complexes that contribute to the capture of tumor antigens by dcs . further , fc receptor - mediated opsonization enhances the expression of costimulatory molecules ( i.e. , cd40 , cd80 , and cd86 ) on the dc surface , boosting t - cell activation . therefore , direct inoculation of patients with vaccines that activate dcs in vivo requires combining this targeted therapy in order to promote a desired immunogenic phenotype . confirmed that combining a cancer cell vaccine and her2 antibodies resulted in significantly longer survival rates than either therapy alone in a transgenic mouse model of breast cancer . this may be due to the fact that the combination therapy increased the capture of the cancer vaccine by dcs , enhanced the expression of costimulatory molecules ( i.e. , cd40 , cd80 , and cd86 ) on the dcs , and elicited greater tumor - specific t - cell responses . recently , a phase i / ii clinical trial of trastuzumab combined with a her2 peptide vaccine showed that 69% of patients developed ctl immune responses to tumor cells that expressed her2 . similarly , the egfr antibody cetuximab also enhances dc - mediated phagocytosis , increases the expression of the mhc class ii molecules , costimulatory molecules on dcs and induces a highly efficient antigen - specific ctl response in vitro ( figure 1(b ) ) . tumor - antigen - loaded dcs are capable of triggering protective t - cell responses , especially by activating the ctl response in lymphoid organs . however , without a maturation signal ( i.e. , a stimulatory adjuvant ) , dcs can not elicit the desired ctl response . when dcs present antigens in a stable state without an immunogenic maturation signal , regulatory t cells ( treg ) are induced , which both promote tolerance of antitumor responses and directly counters the antitumor response . what 's more , at the same time , stimulatory adjuvant can induce costimulatory molecules ( i.e. , cd40 , cd80 , and cd86 ) on the surface of dcs and the release of cytokines ( i.e. , ifn- , ifn- , and il-12 ) by dcs , which are required for t - cell activation and differentiation ( figure 1(c ) ) . many initial attempts at cancer vaccines lacked a consideration of this immune process , specifically the requirement of dcs for a stimulatory adjuvant in order to induce the desired ctls . peptide - based vaccines that were used to treat thousands of patients often lacked an effective dc - activating adjuvant . on the one hand , free peptides may be rapidly cleared before being loaded onto dcs because of their poor pharmacokinetic properties , so their half - lives may also be short . on the other hand , without an adjuvant , dcs might remain in the steady state and gradually promote tolerance rather than immunity . as a result , the ctl response to the selected tumor antigens is poor and therapeutic benefit is minimal . because the function and importance of dcs in stimulating ctl responses is well known now , effective dc - activating adjuvants are increasingly being used in vitro and in vivo . for example , il-2 is an important stimulatory adjuvant for maintaining dc growth and has received fda approval for use in melanoma and renal cell cancer . granulocyte - macrophage colony - stimulating factor ( gm - csf ) is necessary for the growth and differentiation of dcs , and tumor - necrosis factor- ( tnf- ) can promote dc maturation and antigen - presenting capabilities [ 38 , 39 ] . tlr ligands are the ideal adjuvants , allowing a variety of functions required for ctl activation . secondly , tlr ligands induce the expression of costimulatory molecules ( cd40 , cd80 , and cd86 ) on dcs that are required for t - cell activation . thirdly , tlr - induced cytokines , principally il-12 , ifn- , and ifn- , guide t - cell differentiation toward either cd8 + cytotoxic lymphocytes or cd4 + t helper type 1 ( th1 ) cells . several tlr ligands have shown significant promise for the treatment of cancer for example , the tlr7 agonist imiquimod that is currently approved for treatment of superficial basal cell carcinoma . although monotherapy with tlr agonists may provide a benefit in certain types of cancer , our interest is centered on the role of tlr agonists as stimulatory adjuvants . encouraging results have been reported in human melanoma with an antitumor peptide vaccine using cpg - odn ( a tlr agonist ) as an adjuvant , which promotes the generation of rapid and strong ctl antitumor responses . researchers also confirm that tlr agonists facilitate vaccine - induced ctl responses in many different mouse tumor models . therefore , its use as a vaccine adjuvant is perhaps the most extensively explored application for tlr agonists . after capture , processing and presentation of tumor antigens by dcs and activation of ctls , activated ctls must enter the tumor microenvironment to perform their functions ; at this point , a variety of negative regulatory signals interact and form a network to resist the immune response . these negative regulatory signals mainly originate from tumor cells and stromal cells such as immune cells , inflammatory cells , endothelial cells , and fibroblasts . tumor - induced mechanisms of immunosuppression are as follows : ( i ) tumor cells expansion or enabling the local accumulation of treg cells , which release suppressive cytokines and serve to silence immune responses [ 47 , 48 ] , ( ii ) tumor cells also encourage the formation of myeloid - derived suppressor cells ( mdscs ) , which use indoleamine 2,3-dioxygenase ( ido ) released by tumor cells to silence the responses of cytotoxic cd8 + t cells and helper cd4 + t cells while simultaneously promoting the formation of treg cells , and ( iii ) tumor cells secrete a variety of products including the above - mentioned ido , vascular endothelial growth factor ( vegf ) and surface molecules such as pd - l1 . vegf promotes the expansion of mdscs , blocks the maturation of dcs , and inhibits the expression of costimulatory molecules [ 50 , 51 ] . pd - l1 engages receptors on the surfaces of activated t cells and causes t - cell anergy or exhaustion [ 52 , 53 ] ( figure 2(a ) ) . in addition , t cells express other receptors that negatively regulate the immune response in the tumor microenvironment . for example , ctla-4 is a well - studied key negative regulator . when dcs present peptide epitopes to the t - cell receptor ( tcr ) and simultaneously present b7 costimulatory molecules ( cd80 , cd86 ) to cd28 on specific antitumor t cells , these t cells become activated . ctla-4 is subsequently upregulated and competitively engages b7 to attenuate t - cell responses ( figure 2(b ) ) . lag-3 is another negative receptor on the t cell surface that not only limits the activity of cd8 + and cd4 + t cells but also augments the activity of treg cells [ 55 , 56 ] . moreover , macrophages polarize to type 2 macrophages ( m2 ) because of hypoxia in the tumor microenvironment . m2-like macrophages secrete and release cytokines such as ccl17 , ccl22 , or ccl24 , which recruit treg cells to the local environment . however , there are still a large number of immunosuppressive mechanisms in the tumor microenvironment which are not mentioned in this paper . thus , even if pathologically induced auto - ctls could avoid negative regulatory signals and overcome diverse immunosuppressive networks within the tumor microenvironment , they would still be too weak to promote tumor destruction . although vaccines ( e.g. , sipuleucel - t ) can be used to increase the number of ctls , immunosuppression still occurs in the tumor microenvironment and can attenuate vaccine - induced ctls . for this reason , a larger number of targeted drugs have been designed and used in clinical trials to counteract negative regulatory mechanisms . imatinib can decrease ido expression and lead to an increased ratio of ctls to treg cells in a mouse model of gastrointestinal stromal tumors . reported that imatinib has a direct inhibitory effect on treg cells , including decreased numbers of treg cells and weak immunosuppressive capacity . the combination of imatinib plus a dc vaccine resulted in decreased numbers of treg cells , increased t - cell - derived ifn production and fewer metastases compared with either therapy alone in a bcrabl lymphoma model . the targeted drug sunitinib , a multityrosine kinase inhibitor that blocks vegfr function , decreased the function and number of mdscs in the tumor microenvironment of a mouse model of colon cancer . consequently , sunitinib inhibited the number and function of treg cells and augmented the activation of cytotoxic cd8 + t cells and helper cd4 + t cells . furthermore , sunitinib diminished the expression of pd-1 , pd - l1 , and ctla-4 . the combination of a dc vaccine plus sunitinib prolonged survival compared with either agent alone in a b16 melanoma model . the anti - ctla-4 antibody ipilimumab has recently been approved by the fda for use as a first - line or second - line therapy in patients with advanced melanoma . previous studies have confirmed the fundamental importance of ctla-4 in controlling t - cell function , and ctla-4 ligation is also important for the immune suppressive function of treg cells [ 62 , 63 ] . reported clinical trial data that led to the fda approval of anti - ctla-4 for the treatment of metastatic melanoma . their data indicates that ipilimumab , most notably , achieves durable benefits for more than 2.5 years . a subsequent clinical trial confirmed that ipilimumab plus standard care improved overall survival compared with standard care alone ( 11.2 months versus 9.1 months ) and significantly increased the proportion of surviving patients for at least 3 years of followup ( 20.8% versus 12.2% ) . as the most important function of vaccine - induced ctls , ctl - mediated cytotoxic effects play a critical role in immunity against cancers . ctls have the ability to kill tumor cells following the interaction of their tcr with a specific mhc - i complex on tumor cells . this process is mainly mediated by the ability of effector ctls to release perforin , granzyme , and tnf- , or to express fas ligand [ 66 , 67 ] . cytotoxicity proceeds through a multistep mechanism : ( i ) the tcr combines with a specific mhc - i complex on tumor cells , and then the remodeling of the actin cytoskeleton , reorganization of the cell surface , and repositioning of cytoplasmic proteins result in the formation of a so - called immune synapse , ( ii ) polarization of the microtubule organizing center ( mtoc ) toward the target occurs , and lytic granules move along the microtubules toward the mtoc , and ( iii ) lysis occurs through the polarized release of the content of cytotoxic granules ( a process also referred to as degranulation ) or expression of fas ligand on the ctl surface . the lytic pathway uses mainly two types of mechanisms to kill target cells : one is perforin mediated and another is fas ligand ( fasl ) based . the perforin - mediated mechanism is believed to involve secreted perforin , which forms pores in the target membrane . then co - secreted granzymes pass through the pores , enter cells and activate a cascade of caspases including caspase-3 and caspase-8 [ 7072 ] . the fasl - based mechanism involves crosslinking of the cell surface death receptor fas expressed on target cells induced by cell surface fasl expressed on ctls . cross - linked fas rapidly induces the assembly of an intracellular death - inducing signaling complex ( disc ) , which recruits and activates caspase-8 and ultimately activates caspase-3 , which serves as a common substrate for these two killing mechanisms [ 7275 ] . both of these mechanisms eventually induce apoptosis of target cells . although ctls have the capacity to efficiently kill tumor cells , tumor cells may develop escape mechanisms to evade ctl - mediated killing . for instance , tumor cells acquire resistance to perforin and granzyme or alter the expression of death receptors . in addition , the genetic instability of tumor cells can lead to the alteration of proapoptotic regulators , one of the most important being p53 . it has been demonstrated that the p53 status of tumor cells has a key role in determining the fate of the antitumor ctl response , because it regulates fas receptor expression , cellular flice / caspase-8 inhibitory protein ( cflip ) short protein degradation , and cd95-mediated apoptosis . in addition , tumor cells can lower the expression of mhc class i molecules to avoid detection or increase the expression of antiapoptotic proteins in order to resist cytotoxic mechanisms . therefore , the combination of vaccines and some targeted drugs may counteract these escape mechanisms and improve ctl - mediated tumor destruction . ( figure 3 ) in contrast to the escape mechanism described above , some targeted drugs enhanced sensitization of tumor cells to ctl - mediated destruction . for example , the proteasome inhibitor bortezomib sensitizes tumor cells toward adoptive ctl attack . a preclinical trial of bortezomib plus vaccination with dna encoding a tumor - specific protein is planned . the combination of an hpv e7-based vaccine and bortezomib prolonged the steady state of the disease , in contrast to either therapy alone , which had minimal effects . the increased survival correlated with enhanced sensitivity of the bortezomib - treated tumor cells to killing by e7-specific ctls . the possible mechanisms are as follows : ( i ) bortezomib may enhance the baseline activity of granzyme and caspase-8 in tumor cells , which could provide sensitization towards apoptosis , ( ii ) bortezomib may sensitize tumor cells to ctl - mediated lysis through enhanced expression of noxa , a bh3 protein that sequesters potent antiapoptotic proteins such as myeloid cell leukemia sequence 1 ( mcl1 ) , or ( iii ) bortezomib may increase tumor cell surface expression of the tnf - related apoptosis - inducing ligand receptor dr5 and fas , which further augments nk cell cytotoxicity . in addition , some evidence suggests that bortezomib can also sensitize tumor cells to nk cell - mediated lysis by downregulating peptide loading and mhc class i molecule expression . this is due to bortezomib inhibiting the proteasome that generates peptide epitopes for mhc class i molecules , rendering tumor cells more susceptible to killing by nk cells . pi3 k - akt inhibitors are another class of targeted drugs that sensitize tumor cells to ctl - mediated destruction through pi3 k - akt pathway inhibition ; this eliminates some prosurvival signals such as expression of antiapoptotic proteins , thereby increasing tumor cell lysis by perforin and granzymes released from ctls [ 83 , 84 ] . confirmed that tumor cells in which akt can be inducibly expressed showed enhanced resistance to ctl killing upon akt activation compared with noninduced cells . the enhanced resistance involved an increase in mcl1 expression , which is an antiapoptotic protein . demonstrated that a tumor cell line selected for resistance to vaccination therapy upregulated akt compared with wild - type cells that are sensitive to vaccination therapy . this result was associated with increased levels of bcl-2 , ciap1 , and ciap2 , which are also antiapoptotic proteins . moreover , noh et al . demonstrated that inhibiting the upregulation of the akt pathway increased the ctl - mediated killing of akt - upregulated tumor cells in vitro and akt inhibition in combination with vaccine - augmented ctl responses . a variety of strategies have been used to design vaccines that can induce a durable and long - lasting host immune response to fight cancer . however , a series of processes are necessary in order for a vaccine - induced ctl immune response to play a positive role in destroying cancer . in any step in these processes even when ctls are activated , negative signals causing t - cell anergy or exhaustion may occur in the tumor microenvironment . ctl - mediated cytotoxic effects also are affected by the escape mechanisms of tumor cells . for these reasons , when designing vaccines , we attempt to utilize and regulate dcs to elicit a much more potent ctl immune response . this strategy includes antigen - loading techniques in vitro , supplying targeted drugs that facilitate the capture of tumor antigens by dcs in vivo , and using stimulatory adjuvants that promote the whole development and function of dcs . in addition , targeted drugs can be used which block important immunosuppressive signals in the tumor microenvironment , and overcome the tolerance of tumor cells . the strategy of combining vaccines and targeted drugs increases ctl - mediated tumor cell lysis . in the context of advances in the understanding of how immunity , immunosuppression and tolerance regulate antitumor immune responses , immunotherapy and targeted drugs might have complementary and synergistic roles in cancer treatment ; therefore , the combination of vaccines and targeted drugs may become a more accepted practice in cancer treatment . | vaccine - induced cytotoxic t lymphocytes ( ctls ) play a critical role in adaptive immunity against cancers .
an important goal of current vaccine research is to induce durable and long - lasting functional ctls that can mediate cytotoxic effects on tumor cells . to attain this goal , there are four distinct steps that must be achieved . to initiate a vaccine - induced ctl antitumor immune response , dendritic cells ( dcs )
must capture antigens derived from exogenous tumor vaccines in vivo or autologous dcs directly loaded in vitro with tumor antigens must be injected .
next , tumor - antigen - loaded dcs must activate ctls in lymphoid organs .
subsequently , activated ctls must enter the tumor microenvironment to perform their functions , at which point a variety of negative regulatory signals suppress the immune response .
finally , ctl - mediated cytotoxic effects must overcome the tolerance induced by tumor cells .
each step is a complex process that may be impeded in many ways .
however , if these steps happen under appropriate regulation , the vaccine - induced ctl antitumor immune response will be more successful .
for this reason , we should gain a better understanding of the basic mechanisms that govern the immune response .
this paper , based on the steps necessary to induce an immune response , discusses current strategies for enhancing vaccine - induced ctl antitumor immune responses . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
institutionalized older adults tend to have poorer cognitive and physical functions ( gonzlez - colao harmand et al . , 2014 ; furtado et al . , 2015 ) . such problems may be associated to decreased cognitive and physical stimulation in long term care institutions ( ltcis ) . while attempting to offer improved support to older persons one of the recent interventions adopted is cognitive and motor stimulation using active virtual video games ( exergames ) ( keogh et al . , 2014 ) . since 2007 , research on exergames ( such as nintendo wii and xbox kinect ) aimed at promoting health has gradually increased . several of these applications have emerged with different aims , including investigations about the cardiovascular responses of young adults ( monteiro - junior et al . , 2014 ) , the motor ability of neurological patients ( monteiro junior and silva , 2012 ) , postural balance ( jorgensen et al . , 2013 ) and cognitive function of older adults ( maillot et al . , 2012 ) , among other themes . the majority of studies regarding this theme show the effects of this new therapy on physical functions in the elderly . postural balance is the most studied physical capability related to exergames , while few studies have investigated cognitive function . exergames can be considered a dual task ( pichierri et al . , 2012 ) because the games are performed by a man - videogame interface , requiring cognitive and motor functions simultaneously . 2012 ) or cameras which record the motions performed by gamer and send these signals via wireless or infrared to the device . the interface allows the individual to interact with the virtual environment through his / her body movements , requiring cognitive abilities such as spatiotemporal perception , working memory and executive function ( maillot et al . , 2012 ) . the necessity of performing coordinated movement simultaneously with the virtual environment events leads to the individual receiving a load of cognitive and physical stimulus . in their systematic review , laufer et al . ( 2014 ) demonstrated the possibility of increasing postural balance in older persons using exergames . ( 2012 ) verified that institutionalized older adults improved their postural balance and gait after this kind of exercise training . ( 2012 ) showed that , in addition to physical function , executive function was also improved in older adults after the exergames training program . therefore , evidence has been gradually accumulating with regard to the benefits of exergames on cognitive and physical functions of older persons . although the literature has shown improvements of cognitive and physical functions due to exergames , the intrinsic mechanisms involved in these functional changes have still not been elucidated and few studies have investigated the biological phenomena of exergames . therefore , the changes on cognitive and physical functions of older persons submitted to interventions with exergames are still not clear , mainly when considering institutionalized older persons . moreover , biological mechanisms of exergames on muscle adaptation are still not clarified . in this context , the aims of the present study were ( 1 ) to demonstrate the known biological mechanisms of physical exercise regarding muscle adaptation and establish a relationship with exergames ; and ( 2 ) to present a neurobiological hypothesis about the neuroplastic effects of exergames on the cognitive function of institutionalized older persons . such a hypothesis is based on the interaction with a virtual environment , which would increase the neural activation in important areas of the brain related to cognitive functions . the neural excitation of the specific circuits related to cognitive functions would increase neural processing capacity , improving sensory interpretation and decreasing response times . moreover , stimulation of the neural circuits can result in an increase in the synthesis of trophic factors synthesis . . these mechanisms can be potentiated by physical exercise , resulting in neurogenesis , synaptogenesis , and angiogenesis . together , these phenomena can improve cognitive performance and maintain the mental health of institutionalized older persons . ( 2011 ) showed higher caloric expenditure due to exergames in comparison to rest values . ( 2010 ) , that demonstrated that the cardiovascular and metabolic requirements of older adults were higher during training program with exergames . several studies have shown improvements in the physical functions of community - dwelling and institutionalized older people submitted to exergames ( padala et al . , 2012 ; keogh et al . , 2014 ; monteiro - junior et al . , 2015 ) . such findings support the hypothesis on biological adaptations related to this kind of intervention , mainly if we consider the large amount of institutionalized frail older persons . the effort needed to support body weight during the exercises can be considered of moderate to vigorous intensity , since this population shows high declines in physical function . therefore , a regular training program with exergames for institutionalized older persons can be compared to traditional physical training programs ( padala et al . , 2012 ) . physical effort proposed by exergames physical training programs involving multimodal exercises ( muscle strength , postural balance , among others ) can increase strength and muscle volume , improving functional capacity ( binder et al . , 2005 ; monteiro - junior et al . , 2015 ) . the changes in muscle fiber can occur due to the mechanical and metabolic stress caused by the physical exercise ( spiering et al . the tension applied on the muscle fibers could generate certain signaling for cellular adaptations , increasing protein synthesis and decreasing apoptosis ( spiering et al . , 2008 ) . furthermore , the damage on the muscle cells acutely releases interleukin-6 ( il-6 ) , which stimulates the differentiation of the satellite cells into new myonuclei . these myonuclei potentiate protein synthesis , which can result in an increase of muscle tissue volume ( spiering et al . , 2008 ) . the basal level of proinflammatory citokynes is higher in pre - frail and frail older adults than in healthy older adults ( lai et al . , 2014 ) . therefore , the effort needed in exercising with exergames would promote signaling mechanisms such as the akt - mtor pathway , increasing muscle strength and hypertrophy , consequently improving the ability to practice daily routine activities . in addition , physical exercise decreases inflammatory and increases anti - inflammatory factors , improving muscle integrity ( walsh et al . , 2011 ) . in this sense , research is needed in order investigate exergames effects on inflammatory and anti - inflammatory markers and other muscle cell responses . in short , physical function is associated to muscle strength increase , which is in turn related to postural balance . these physical qualities are important for the elderly , and could be influenced by exergames ( figure 1 ) . whatever changes occur at a molecular and cellular level , they can be beneficial for older persons with lower fitness levels . it causes mechanic stress which stimulates akt - mtor pathway , il-6 , il-10 , and il-1ra . akt - mtor pathway potentiates protein synthesis , il-6 increases myonuclei differentiation , and il-10 and il-1ra increase chronic anti - inflammatory response . both signaling result in muscle il : interleukin ; il-1ra : antagonist receptor of il-1 ; wbb : wii balance board ; nw : nintendo wii . in order to perform exergames , the individual should understand and interact with a virtual environment context . several sensorial informations ( visual , auditive , and somato - sensorial ) all of these generate a sensorial flow , which may occur through stimuli by tasks with predictable elements ( closed tasks ) or tasks with random elements ( open tasks ) . closed tasks requires simple abilities , because they do not suffer environmental variations , while the environment may vary in open tasks , requiring higher attention , inhibitory control , decision making , and speedy reaction times . executive functions are a fundamental element needed to perform adequate movements in response to an open task stimulus ( taddei et al . , 2012 ) . individuals that participate in physical activities with open tasks show better executive functions and lower reaction times ( taddei et al . , 2012 ) . in this sense , the majority of exergames can be considered as open tasks , and may , therefore , improve cognitive functions . ( 2012 ) have shown improvements in the executive function of 38 older persons ( experimental group ) compared to 41 controls . the experimental group performed a training program with a cycle ergometer in the virtual environment ( open task ) while controls performed the same activity without a virtual reality ( closed task ) . therefore , exergames can be considered a new perspective regarding interventions to maintain or improve the cognitive functions of older adults , maybe improving some aspects related to quality of life ( keogh et al . , 2014 ) . virtual reality and its interactivity have an impressive ability to attract the attention of any individual towards the game . in the literature , this is known as gameplay . the virtual environment , game settings , aims , challenges , rules , feedback system , interaction , and immersion are some of the factors that contribute for this attraction . the interactions with the virtual environment depend on planning , decision making , inhibitory control , and episodic memory , which allow the player to interpret the stimuli that occur during the displacement into the virtual environment ( maguire et al . , 1998 ) . such cognitive functions are associated to executive functions , which are crucial for the day - to - day of older adults , mainly if these people are institutionalized ( gonzlez - colao harmand et al . , 2014 ) . therefore , the stimuli offered by virtual reality exercises can increase the functionality of important specific brain circuits linked to cognition . ( 1998 ) demonstrated that the hippocampus , caudate nuclei , frontal and parietal cortex and cerebellum are the main areas that become more active during navigation into the virtual environment . the activation of the hippocampus was related to episodic memories and allocentric navigation , which allow the individual to displace him / herself into the environment using a topographic map . the increase of inferior parietal cortex activity was related to egocentric displacement ( based on the body as the center of spatial orientation ) , while caudate nuclei activity was related to displacement speed . the authors also demonstrated that left frontal cortex activity was associated with virtual tasks related to changing displacement direction , problem solving , and decision making . such findings indicate that both cortical and subcortical regions can be stimulated by a virtual environment . thus , the activation of these regions is important to maintain the independence of older persons , since these structures are involved in both basic and instrumental daily routine activities . according to the context ( 2005 ) demonstrated that individuals who suffered strokes modified their cortical functional organization to conduct motor tasks . it is possible that neuroplastic mechanisms ( e.g. , neurogenesis , synaptogenesis , and angiogenesis ) can occur due to this intervention , since both physical exercise and cognitive stimulation ( alone or together ) can induce structural and functional changes in the brain ( matta mello portugal et al . , 2013 ) . therefore , exergames can be a therapeutic strategy in both the prevention and treatment of cognitive disorders in institutionalized older adults . taking into consideration that the dual tasks proposed by exergames requires physical effort , it is possible that trophic factors such as brain - derived neurotrophic factor ( bdnf ) , vascular endothelial growth factor ( vegf ) , insulin - like growth factor ( igf-1 ) , glial cell derived neurotrophic factor ( gdnf ) , basic fibroblast growth factor-2 ( fgf-2 ) , and others are synthesized and secreted peripherally during the execution of these activities . these factors could subsequently travel to the brain and stimulate the differentiation and proliferation of neurons ( matta mello portugal et al . , 2013 ) . in the previous study cited previously ( anderson - hanley et al . , 2012 ) , the executive functions of older persons were improved after an exergame training program . these improvements were associated to plasma bdnf levels . in their pilot study with an animal model , tpa can generate an up - regulation of mbdnf ( mature bdnf ) , increasing the activity of tyrosine kinase b ( trkb ) receptors . the increase in mbdnf and the activity of its receptors resulted in hippocampus plasticity , identified by the syntheses of certain proteins , related to synapses ( synapsin 1 ) , mitosis ( mitogen - activated - protein - kinase , mapk ) , gene expression ( calmodulin kinase ii , camkii ) , and by increases in trkb receptor density . ( 2015 ) demonstrated that older persons with mild cognitive impairment submitted to physical exercise showed improved cognitive function associated to increased plasma bdnf . therefore , basic and clinical research regarding physical exercise and cognitive stimulation show the potential benefits of these activities , mainly when they are performed together . thus , we believe that exergames are a new strategy to stimulate neuroplasticity and improve cognitive functions ( figure 2 ) . executive function is the main cognitive functions stimulated by exergames due to decision making , mind flexibility , planning and inhibitory control required . however , it is unclear if older institutionalized persons with neurodegenerative diseases may have the same benefits . trophic factors traffic by vessels until blood - brain barrier and act on the brain potentiating neuroplasticity ( dashed arrow ) . bdnf : brain - derived neurotrophic factor ; igf-1 : insulin - like growth factor 1 ; nw : nintendo wii ; vegf : vascular endothelial growth factor ; wbb : wii balance board ( a hardware to play ) . these activities can also be associated to trophic factors released during the exercise , resulting in neuroplasticity . in addition , the physical effort resulting from exergames can generate similar known mechanisms of exercise , contributing to the improvement of physical function . in the future | exergames can be considered a dual task because the games are performed by a man - videogame interface , requiring cognitive and motor functions simultaneously . although the literature has shown improvements of cognitive and physical functions due to exergames , the intrinsic mechanisms involved in these functional changes have still not been elucidated .
the aims of the present study were ( 1 ) to demonstrate the known biological mechanisms of physical exercise regarding muscle adaptation and establish a relationship with exergames ; and ( 2 ) to present a neurobiological hypothesis about the neuroplastic effects of exergames on the cognitive function of institutionalized older persons .
these hypotheses are discussed . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
renal transplantation confers substantial benefits to children with end - stage renal disease ( esrd ) , including improved growth , longer life , and better quality of life . the advent of laparoscopic donor nephrectomy ( ldn ) has lead to a significant increase in the number of living donor renal transplants performed in pediatric recipients . benefits to the donor of ldn compared with odn include shorter postoperative hospital stay , reduced requirements for postoperative analgesia , and improved convalescence and cosmesis . a few studies have shown higher postoperative creatinine values among ldn recipients compared with odn recipients . observed that pediatric recipients of age < 18 years who underwent laparoscopic donor graft procurement had significantly more acute rejection episodes , and higher incidence of delayed graft function , with poor graft survival rates . these studies warrant careful analysis of the role of ldn grafts being transplanted into recipients in this age group . we compare here the surgical and functional outcomes of all pediatric living donor renal transplant recipients . the medical records of all pediatric transplant patients from 1985 through june 2006 were reviewed at muljibhai patel urological hospital . the etiology of end - stage renal disease ( esrd ) , demography of donors and recipients , vascular anatomy of the donor kidney , method of donor nephrectomy ( ldn vs odn ) , warm and total ischemia time , the need for bench surgery , and any intra and perioperative complications that occurred were analysed . postoperative renal function was measured by serum creatinine levels at day 0 , 1 , 2 , 7 , 14 , and 30 . the incidence of early and delayed graft function , acute rejection episodes , complication rates , and graft survival was recorded . early graft function was defined as > 25% decline of two separate serum creatinine samples taken within first 24 h. delayed graft function was defined as requirement of hemodialysis within seven - post transplantation . acute rejection was defined as treatment for rejection given for rising serum creatinine ( postrenal biopsy histopathologically confirmed ) . graft failure was defined as permanent return to dialysis or death with a functioning graft . kidney was procured through a flank incision overlying the 11 or 12 rib depending on the topography of the kidney . the incision was carried out through all the muscle layers , kidney dissected , and hilum bared . prior to ligation of the renal pedicle , patients received a bolus of 10 mg of intravenous frusemide and 100 ml of 20% mannitol . the kidney was then harvested through a flank incision , immediately placed in an ice bath , and perfused with a heparinized ringer lactate solution . nasogastric tube and urethral catheter was placed intraoperatively and patient was put in 45 lateral tilt position . pneumoperitoneum was created in closed technique with the initial flow rate of 1l / min . the kidney perfusion was maintained throughout the procedure with a urine output of 10 ml / min . was placed and deepened upto the peritoneum taking care not to incise the peritoneum at this point of time . prior to securing the renal artery , the patient received a bolus of 10 mg of intravenous frusemide and 100 ml of 20% mannitol . the kidney was retrieved through the preplaced pfannenstiel incision and was immediately placed in an ice bath and perfused with a solution of heparinized ringer lactate . a modified gibson incision was made and the renal bed prepared by dissecting the external iliac vein and internal / external iliac artery . appropriate measures were taken to preserve the cord structures in male recipients and secure the lymphatics . the donor renal vein was anastomosed to the recipient external iliac vein in an end - to - side fashion . standard end - to - end renal artery to internal iliac artery anastomosis was done with single artery grafts ( n = 46 ) . bench surgery was done in early branching renal artery ( n = 2 ) , and separate double anastomosis , one with external iliac ( end - to - side ) and other with internal iliac artery ( end - to - end ) was done for double renal artery ( n = 6 ) patients . kidney was procured through a flank incision overlying the 11 or 12 rib depending on the topography of the kidney . the incision was carried out through all the muscle layers , kidney dissected , and hilum bared . prior to ligation of the renal pedicle , patients received a bolus of 10 mg of intravenous frusemide and 100 ml of 20% mannitol . the kidney was then harvested through a flank incision , immediately placed in an ice bath , and perfused with a heparinized ringer lactate solution . all the donors underwent overnight hydration and enemas for bowel preparation . nasogastric tube and urethral catheter pneumoperitoneum was created in closed technique with the initial flow rate of 1l / min . the kidney perfusion was maintained throughout the procedure with a urine output of 10 ml / min . was placed and deepened upto the peritoneum taking care not to incise the peritoneum at this point of time . prior to securing the renal artery , the patient received a bolus of 10 mg of intravenous frusemide and 100 ml of 20% mannitol . the kidney was retrieved through the preplaced pfannenstiel incision and was immediately placed in an ice bath and perfused with a solution of heparinized ringer lactate . a modified gibson incision was made and the renal bed prepared by dissecting the external iliac vein and internal / external iliac artery . appropriate measures were taken to preserve the cord structures in male recipients and secure the lymphatics . the donor renal vein was anastomosed to the recipient external iliac vein in an end - to - side fashion . standard end - to - end renal artery to internal iliac artery anastomosis was done with single artery grafts ( n = 46 ) . bench surgery was done in early branching renal artery ( n = 2 ) , and separate double anastomosis , one with external iliac ( end - to - side ) and other with internal iliac artery ( end - to - end ) was done for double renal artery ( n = 6 ) patients . kidney was procured through a flank incision overlying the 11 or 12 rib depending on the topography of the kidney . the incision was carried out through all the muscle layers , kidney dissected , and hilum bared . prior to ligation of the renal pedicle , patients received a bolus of 10 mg of intravenous frusemide and 100 ml of 20% mannitol . the kidney was then harvested through a flank incision , immediately placed in an ice bath , and perfused with a heparinized ringer lactate solution . all the donors underwent overnight hydration and enemas for bowel preparation . nasogastric tube and urethral catheter pneumoperitoneum was created in closed technique with the initial flow rate of 1l / min . the kidney perfusion was maintained throughout the procedure with a urine output of 10 ml / min . was placed and deepened upto the peritoneum taking care not to incise the peritoneum at this point of time . prior to securing the renal artery , the patient received a bolus of 10 mg of intravenous frusemide and 100 ml of 20% mannitol . the kidney was retrieved through the preplaced pfannenstiel incision and was immediately placed in an ice bath and perfused with a solution of heparinized ringer lactate . a modified gibson incision was made and the renal bed prepared by dissecting the external iliac vein and internal / external iliac artery . appropriate measures were taken to preserve the cord structures in male recipients and secure the lymphatics . the donor renal vein was anastomosed to the recipient external iliac vein in an end - to - side fashion . standard end - to - end renal artery to internal iliac artery anastomosis was done with single artery grafts ( n = 46 ) . bench surgery was done in early branching renal artery ( n = 2 ) , and separate double anastomosis , one with external iliac ( end - to - side ) and other with internal iliac artery ( end - to - end ) was done for double renal artery ( n = 6 ) patients . the demographic profile and the etiology with respect to both the groups are depicted in table 1 . the mean age of recipients was 14.8 years ( range 5 - 18 ) in ldn and 13.9 years ( range 8 - 18 ) in odn . total ischemia time ( tit ) was significantly higher in grafts procured by laparoscopic approach . patient demography between the ldn and odn groups ldn : laparoscopic donor nephrectomy , odn : open donor nephrectomy ldn : laparoscopic donor nephrectomy , odn : open donor nephrectomy five patients in the ldn group received induction immunosuppression ( 4 received daclizumab and 1 basiliximab ) while none of the patients in odn received induction . the ldn group received prednisone all , calcineurin inhibitor [ cyclosporine ( 11 ) , tacrolimus ( 4 ) ] , and purine antagonists [ azathioprine ( 11 ) , mycophenotil ( 4 ) ] . the odn group received prednisone all , calcineurin inhibitors [ cyclosporine ( 35 ) , tacrolimus ( 0 ) , ( not given in 4 ) ] , and purine antagonists [ azathioprine ( 39 ) , mycophenotil ( 0 ) ] . cyclosporine was stopped in two odn patients at 3 and 12 years with stable serum creatinine . postoperative serum creatinine was comparable at day 1 ( p = 0.20 ) , day 2 ( p = 0.12 ) , day 7 ( p = 0.25 ) , day 14 ( p = 0.20 ) , 1 month ( p = 0.39 ) in ldn vs odn groups . there were two delayed graft functions in odn group . both of the patients had acute vascular rejection which required treatment with okt3 . the first patient required one session of hemodialysis on the third day while the second patient required two hemodialysis sessions on the second and fourth day . all graft survival at 1 year was 86.67 and 82.22% ( p = 0.34 ) in ldn and odn groups , respectively . serum creatinine ( mg / dl ) at various postoperative time ldn : laparoscopic donor nephrectomy , odn : open donor nephrectomy the cause of early adverse renal outcome and their complications are shown in table 4 . cause of the six grafts lost ( ldn , n = 1 and odn , n = 5 ) were : graft artery aneurysm in 1 ( ldn ) , graft artery thrombosis ( n = 1 ) , septicemia ( 1 ) , acute left ventricular failure ( 1 ) , acute vascular rejection ( 1 ) , and hypertensive encephalopathy ( 1 ) . early adverse renal function and complications laparoscopic donor nephrectomy has previously been demonstrated to be safe and efficacious in pediatric renal transplant in single institution studies . pediatric renal transplants pose unique challenges , including operative technical aspects , hemodynamics at the time of graft reperfusion , and increased immune reactivity as compared to adults , resulting in higher rejection rates.[810 ] troppmann et al . , in united network for organ sharing database study raised concerns about higher incidence of delayed graft function , acute rejection episodes , and higher discharge serum creatinine levels in ldn compared with recipients of odn . the authors hypothesized that probably immunological and hemodynamic properties of these young patients make them unsuitable for additional physiological insults due to laparoscopic renal procurement . it is also postulated that a combination of prolonged pneumoperitoneum and wit occurring during ldn predispose the allograft to increased risk of early graft dysfunction . there is a concern regarding impaired renal function secondary to prolonged warm ischemia in grafts with multiple vessels . however , desai et al . showed that long - term graft survival and graft function at 1 month and 1 year are not adversely impacted by the presence of multiple renal arteries in grafts procured laparoscopically . hypothesized that , due to decreased intravascular volume in these pediatric recipients , allograft receives suboptimal renal perfusion compared to that prior to nephrectomy . this can be deleterious resulting in increased risk of vascular thrombosis , delayed graft function , or primary nonfunction . the recipient outcome did not differ in either renal units harvested by ldn or odn ; graft survival at 1 year was comparable in both the groups . this may be related to a combination of decrease in the total operative time , adequate perioperative and intraoperative donor hydration , measures to reduce wit , and meticulous attention to recipient hydration . modifications in our ldn technique include : preplaced pfannenstiel kidney retrieval incision ; and bathing bare hilum in papaverine to avoid spasm of the renal artery . we ensure that donor veins are full at the time of bed preparation by infusing intravenous fluids . ureter , renal artery , and renal vein are clipped and cut in that order prior to graft retrieval . additionally , intraoperative attention is directed at maintaining recipient central venous pressure at 15 cm h2o and systolic blood pressure above 120 mm hg . if the systolic blood pressure remains low , intravascular volume expansion with colloids is instituted to achieve the desired hemodynamic parameters . just prior to vascular anastomosis declamping , 100 ml of 20% mannitol is given intravenously to diurese the graft . it is believed that pneumoperitoneum of 10 mm hg has a minimal affect on renal physiology . we thus maintain an insufflation pressure of 15 - 20 mm hg throughout the ldn procedure ; this has not been shown to have adverse effect on immediate postoperative renal function in our study . on the contrary , it aids in dissection by minimizing oozing and making the surgery quicker , thus effectively decreasing the operative time . although , the number of patients in our cohort is comparable to any published single institution series , we had no pediatric recipient aged 5 years . finally , our study was limited by its retrospective nature and use of historical odn cohort . further randomized prospective studies would clarify the safety and efficacy of the laparoscopic harvesting in pediatric renal transplantation . we found that in our experience , ldn does not adversely affect graft outcome in pediatric recipients of living donor renal transplants . laparoscopic donor nephrectomy was not associated with an increased risk of delayed graft function , acute rejection , or diminished graft function . in addition to shortening hospitalization and reducing postoperative pain for the adult donors , ldn confers improved convalescence and ameliorates cosmetic concerns . based on our findings , we find no contraindication to the continued use of ldn in pediatric renal transplantation . strict attention to perioperative donor and recipient fluid status and limited use of pneumoperitoneum should be considered for optimal graft outcome . | objective : to evaluate the surgical and functional outcomes of laparoscopic graft procurement in pediatric patients undergoing renal transplantation.materials and methods : a retrospective chart review of the cohort records of 54 pediatric living donor renal transplant recipients from 1985 through june 2006 was performed .
we compared results of laparoscopic donor nephrectomy ( ldn , n = 15 ) and open donor nephrectomy ( odn , n = 39 ) . parameters analysed included donor technique and morbidity , operative complications , immediate postoperative renal function , the incidence of early and delayed graft function , and long - term graft survival.results:the mean age of these recipients was 14.8 years ( 5 - 18 ) in the ldn group and 13.9 years ( 8 - 18 ) in odn group .
serum creatinine ( mg / dl ) was 1.5 0.7 vs 1.8 1.3 at day 1 ( p = 0.20 ) , 1.0 0.3 vs 1.4 1.3 at day 2 ( p = 0.12 ) , 1.1 0.9 vs 1.3 1.0 at day 7 ( p = 0.25 ) , 1.2 0.5 vs 1.6 1.8 ( p = 0.20 ) at day 14 , 1.1 0.7 vs 1.2 1.4 ( p = 0.39 ) at 1 month in ldn vs odn groups , respectively .
early graft function was 35.7 vs 46.4% in the respective groups .
there were two delayed graft function and one graft nonfunction in odn group . over all graft and patient survival at 1 year was 86.67 and 82.22% ( p = 0.34 ) in ldn and odn groups , respectively.conclusion:pediatric recipients of the ldn grafts have outcomes comparable to those of odn graft recipients .
laparoscopic donor nephrectomy is safe and efficacious for graft procurement for pediatric recipients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we present a case of acute gastric band slippage with gastric necrosis and massive haemoperitoneum necessitating an emergency laparotomy , gastrectomy and splenectomy . the patient had a swedish adjustable gastric band inserted laparoscopically using the pars flaccida technique several years earlier without complications . her weight at presentation was 70 kg ( bmi 27 ) having lost 15 kg since band insertion . she presented to the emergency department with symptoms of acute onset dysphagia , vomiting and epigastric pain lasting 8 h. examination on presentation revealed only mild epigastric tenderness and all vital signs were within the normal range . a plain x - ray was performed and was suggestive of a slipped gastric band , with o - sign present . an attempt to remove the gastric fluid the patient remained in the emergency department ( ed ) overnight due to incomplete resolution of her symptoms . six hours after her presentation to the ed , the patient suddenly became profoundly hypotensive and tachycardic with a distended peritonitic abdomen and was taken for emergency surgery . at laparotomy , the patient was found to have gastric band slippage , a distended necrotic gastric pouch , a denuded spleen and a massive intraperitoneal haemorrhage of 4 l. no isolated source of active bleeding could be identified . a splenectomy was performed to control haemorrhage and sleeve gastrectomy to remove the necrotic pouch . obesity is becoming an ever - increasing problem and is associated with numerous medical conditions , including diabetes mellitus , hypertension and obstructive sleep apnoea . slippage of the gastric band is a possible complication with the reported rates varying considerably . the result is most commonly a chronic , incomplete , obstruction of the gastric pouch . however , there is a small but increasing number of cases of acutely slipped gastric bands with associated with gastric necrosis , including several patient deaths [ 36 ] . however , a review of the literature reveals no cases of massive intraperitoneal haemorrhage or splenic involvement in such cases . we postulate that the gastric necrosis resulted in thrombosis of the short gastric vessels and this thrombus propagated into the splenic vein causing vascular outflow obstruction in the spleen . | we present a case of acute gastric band slippage with gastric necrosis and massive haemoperitoneum necessitating an emergency surgery .
the patient presented with an 8h history of dysphagia , vomiting and epigastric pain .
initial examination was unremarkable , but within 6h the patient suddenly deteriorated with a distended peritonitic abdomen . at laparotomy
the patient was found to have gastric band slippage , a distended necrotic gastric pouch , a denuded spleen and a massive intraperitoneal haemorrhage of approximately 4l .
a splenectomy was performed to control haemorrhage and sleeve gastrectomy to remove the necrotic pouch .
the patient made an uneventful recovery .
there are no reported cases of massive intraperitoneal haemorrhage or splenic involvement in cases of gastric band slippage .
we believe that the gastric necrosis lead to short gastric and splenic vein thrombus and splenic outflow obstruction .
this resulted in a subcapsular haematoma which subsequently ruptured causing acute deterioration . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
diffuse cutaneous mastocytosis results from extensive accumulation of mast cells in the skinit presents during infancy with blister formation either on normal skin or superimposed on infiltrated papules . diffuse cutaneous mastocytosis results from extensive accumulation of mast cells in the skin it presents during infancy with blister formation either on normal skin or superimposed on infiltrated papules . blistering skin eruption in children may pose a diagnostic challenge to the clinician ; a variety of hereditary and acquired conditions may manifest with blisters in the pediatric age group . epidermolysis bullosa tops the list of hereditary cause while the infections ( both bacterial and viral ) account for the bulk of acquired causes of blistering eruption in a child . diffuse cutaneous mastocytosis ( dcm ) is rarely considered in the differential diagnosis of blistering eruption during infancy . we report an infant of dcm who presented with infiltrated papules and vesicular eruptions ; perilesional biopsy revealed granular igm deposition at dermoepidermal junction ( dej ) on direct immunofluorescence ( dif ) microscopy . an 8-month - old male infant born of nonconsanguineous marriage presented with itchy lesions all over the body for 3 months . parents observed itchy , erythematous lesions initially over the scalp ; subsequently , the child developed similar lesions all over the body . parents also observed spontaneous eruption of blisters over the lesions on the trunk ; these would rupture in 34 days time and heal with postinflammatory depigmentation . cutaneous examination revealed erythematous papules and infiltrated plaques with superimposed grouped vesicles on the chest , abdomen , and back [ figure 1 ] . gentle stroking of the skin demonstrated erythema and wheals over the area ( positive darier 's sign ) . areas of hypo- and de - pigmentation were present over the face , neck , and back . histopathological study from the lesion on the chest showed subepidermal bulla and numerous mast cells with interspersed eosinophils and neutrophils throughout the dermis [ figure 2 ] ; toluidine blue staining revealed diffuse mast cell infiltration in the dermis and intracellular metachromatic granules [ figure 3 ] . dif microscopy from the perilesional skin revealed granular igm deposition at the dej [ figure 4 ] . ( b ) grouped vesicular eruptions on the epigastric region ( a ) subepidermal bulla with numerous mast cells and inflammatory cells ( h and e , 100 ) . ( b ) dense infiltrate of mast cells in the dermis ( h and e , 200 ) diffuse mast cell infiltration in the dermis and intracellular metachromatic granules - positive toluidine blue staining ( toluidine blue , 200 ) granular deposition of igm along the basement membrane zone ( dif , 200 ) cutaneous mastocytosis ( cm ) occurs due to abnormal accumulation of mast cells in the skin . it is an uncommon disease with a prevalence of 1 in 25,00030,000 in the general population . approximately two - third of cases of cm occur in the childhood ; nearly half of these patients have manifestations of disease before the age of 2 years . pediatric mastocytosis is slightly more common among males in contrast to adult patients where the male to female ratio is almost equal . although cm is usually sporadic , familial cases with autosomal dominant mode of inheritance have been reported . four morphological types of cm have been described : urticaria pigmentosa , solitary mastocytoma , dcm , and telangiectasia macularis eruptiva perstans . dcm is an extremely rare and the most severe clinical presentation of cm , characterized by entire skin infiltration of mast cells . tendency for blister formation ceases gradually with time after the age of two and the skin becomes less reactive . in cm , gentle brisk stroking of the skin causes urtication , flare , and sometimes blister formation due to release of histamine from mast cells . based on the age of onset of disease , orkin et al . described two forms of presentations of bullous dcm : the neonatal form and the late - onset disease . the former variant has a greater risk of extracutaneous involvement while the latter type ( as in our case ) shows minimal extracutaneous involvement and has a better prognosis . however , a recent review of 1747 cases of pediatric cm suggests that it is a clonal disease in 44% of cases . the typical childhood disease is linked to glu839lys c - kit mutation while the adult disease is often linked to asp816val c - kit mutation . the diagnosis of cm requires the triad of typical skin lesions , histological confirmation of focal mast cell infiltrates in the dermis , and the absence of criteria involving systemic involvement . histopathology is the gold standard for the diagnosis of bullous dcm and shows subepidermal bulla and increased accumulation of the mast cell in the superficial and mid - dermis . the special stains used to detect mast cells in tissues include giemsa , toluidine blue , and monoclonal antibodies that recognize tryptase or cd117 . it is hypothesized that activated mast cells release potent pro - inflammatory cytokines such as interleukin-8 which may initiate intense inflammation along the dej leading to blister formation . mast cell granules and protease heparin proteoglycan complexes that are released from mast cells may also induce cleavage of the basal membrane components directly or by activation of collagenolytic matrix metalloproteinases leading to the formation of subepidermal bulla . the presence of granular deposition of igm along the basement membrane zone ( bmz ) is an interesting finding in our case . granular staining of bmz with igm has been reported in heterogeneous group of diseases including systemic lupus erythematosus ( sle ) . in sle patients , it usually occurs in conjunction with other immunoreactants , whereas isolated igm deposition along the bmz is seen more frequently in non - sle subgroup of patients . the significance of igm deposition in dcm is unclear ; it could be due to the pronounced inflammation along the dej . there was no evidence of systemic involvement or features of autoimmune diseases in our case . recently , similar finding has been observed by slavescu et al . in a 6-month - old infant with bullous dcm . further studies in a large number of patients with dcm are required to confirm this finding . majority of cases of pediatric dcm subside partially or completely within 6 years of age . in other patients , those children with extensive bullous lesions , early onset of disease and those with symptoms of vasodilatation ( flushing or hypotension ) are at potential risk of experiencing shock or sudden death . drug therapy is aimed to stabilize the mast cell membrane and block the action of inflammatory mediators . the mainstay of treatment is histamine blockers and avoidance of triggering factors ( nonsteroidal anti - inflammatory drugs , opioids , and trigger foods which cause degranulation of mast cells ) . long - term follow - up of children with dcm is necessary as the disease may have reserved prognosis in at least few patients . granular deposition of igm along the dermoepidermal junction is a unique finding in our case . granular deposition of igm along the dermoepidermal junction is a unique finding in our case . granular deposition of igm along the dermoepidermal junction is a unique finding in our case . | diffuse cutaneous mastocytosis ( dcm ) occurs due to abnormal accumulation of mast cells in the skin .
we report an 8-month - old infant presented papulovesicular lesions , predominantly on the trunk .
skin biopsy revealed subepidermal bulla , interspersed with mast cells , eosinophils and neutrophils .
direct immunofluorescence microscopy of perilesional skin revealed nonspecific deposition of igm in granular pattern along the dermoepidermal junction . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
this is a cross - sectional study that was conducted during march and april 2010 . it aimed at assessing the extent patients accepted medical students in teaching hospitals of fom , ku . therefore , the population of this study includes patients across a variety of hospitals and clinics in kuwait . the teaching hospitals / clinics that students rotate in are 10 primary care centers , four secondary care centers and 10 tertiary care centers covering all specialties . we developed a self - administered structured questionnaire in english , and then we translated it into arabic . section i had a set of eight questions about the sociodemographic characteristics which are age , gender , nationality , religion , marital status , educational level , current occupation and monthly family income . the second section was about the patients reactions toward , and acceptability of , medical students . we asked if the patients permit medical students to read their medical file , present in the outpatient clinic during their consultations , attend ward rounds if they were admitted in the same ward , present in the operation theatre if their condition required a surgical intervention ( or delivery room in cases of pregnancy ) , take their history with or without the presence of the clinical tutor , present in the room while the doctor is examining them , examine them with or without the presence of a clinical tutor , present in the room while they are undergoing any diagnostic procedure , and perform diagnostic procedures on them ( examples given were drawing blood , inserting urinary catheter and endoscopy ) . the participants had to choose between permitting male students only , female students only , both males and females , or not permitting both genders . moreover , in this section of the questionnaire , we asked about who did the patients think was treating them in teaching hospitals ( doctor or student ) , which type of hospital did they prefer to be treated in ( teaching or non - teaching hospital ) and how did the presence of medical students in teaching hospitals affected the quality of health care . the questionnaire was pretested on 10 random patients in one of the teaching hospitals to ascertain the clarity of questions . we approached 995 patients in which 63 patients refused to participate ( refusal rate of 6.3% ) . the participants were inpatients and outpatients of four secondary care hospitals and 10 tertiary care hospitals / centers . the study objectives were explained to the participants . also , the participants were assured the confidentiality of the collected information and that they were free to decline participation in the study . regarding pediatrics patients , the study protocol and data collection instrument were reviewed and approved by the ethics committee of fom , ku and ministry of health 's joint committee for the protection of human subjects in research . permission to administer the questionnaire to the study population was obtained from the administration of each hospital . data were analyzed using the statistical package for social sciences ( spss ) with a two - tailed p - value < 5% which is considered as the cut - off value for statistical significance . we computed descriptive statistics for all variables to present their frequencies and percentages . also , we did cross - tabulations between each of the this was done by cross - tabulating the age of pediatrics patients with our outcome variables separately from the age of patients of other specialties . variables such as marital status , educational level and occupation of pediatrics patient were not cross - tabulated with the outcome variables because all patients in this specialty were not married , not employed , and not high school graduates . this is a cross - sectional study that was conducted during march and april 2010 . it aimed at assessing the extent patients accepted medical students in teaching hospitals of fom , ku . therefore , the population of this study includes patients across a variety of hospitals and clinics in kuwait . the teaching hospitals / clinics that students rotate in are 10 primary care centers , four secondary care centers and 10 tertiary care centers covering all specialties . we developed a self - administered structured questionnaire in english , and then we translated it into arabic . section i had a set of eight questions about the sociodemographic characteristics which are age , gender , nationality , religion , marital status , educational level , current occupation and monthly family income . the second section was about the patients reactions toward , and acceptability of , medical students . we asked if the patients permit medical students to read their medical file , present in the outpatient clinic during their consultations , attend ward rounds if they were admitted in the same ward , present in the operation theatre if their condition required a surgical intervention ( or delivery room in cases of pregnancy ) , take their history with or without the presence of the clinical tutor , present in the room while the doctor is examining them , examine them with or without the presence of a clinical tutor , present in the room while they are undergoing any diagnostic procedure , and perform diagnostic procedures on them ( examples given were drawing blood , inserting urinary catheter and endoscopy ) . the participants had to choose between permitting male students only , female students only , both males and females , or not permitting both genders . moreover , in this section of the questionnaire , we asked about who did the patients think was treating them in teaching hospitals ( doctor or student ) , which type of hospital did they prefer to be treated in ( teaching or non - teaching hospital ) and how did the presence of medical students in teaching hospitals affected the quality of health care . the questionnaire was pretested on 10 random patients in one of the teaching hospitals to ascertain the clarity of questions . we approached 995 patients in which 63 patients refused to participate ( refusal rate of 6.3% ) . the participants were inpatients and outpatients of four secondary care hospitals and 10 tertiary care hospitals / centers . the study objectives were explained to the participants . also , the participants were assured the confidentiality of the collected information and that they were free to decline participation in the study . regarding pediatrics patients , the study protocol and data collection instrument were reviewed and approved by the ethics committee of fom , ku and ministry of health 's joint committee for the protection of human subjects in research . permission to administer the questionnaire to the study population was obtained from the administration of each hospital . data were analyzed using the statistical package for social sciences ( spss ) with a two - tailed p - value < 5% which is considered as the cut - off value for statistical significance . we computed descriptive statistics for all variables to present their frequencies and percentages . also , we did cross - tabulations between each of the this was done by cross - tabulating the age of pediatrics patients with our outcome variables separately from the age of patients of other specialties . variables such as marital status , educational level and occupation of pediatrics patient were not cross - tabulated with the outcome variables because all patients in this specialty were not married , not employed , and not high school graduates . more than 75% ( 713 ) of the participants were either medical or surgical patients , while the rest were either pediatrics or obstetrics / gynecological patients ( table 1 ) . half of the participants ( 466 ; 50% ) were younger than 36 years old ( meanstandard deviation = 36.7919.841 ) . of the 932 patients , 498 ( 53.4% ) were females , and 587 ( 63% ) were married . almost all participants were muslims ( 876 ; 94% ) . around three - quarters ( 690 ; 74% ) of the patients were non - university / college graduates , and more than half of them ( 515 ; 55.3% ) were not employed . regarding the monthly family income of the participants , 61.7% ( 575 ) had an income of less than 1000 kuwaiti dinars ( kd ) per months . sociodemographic characteristics of patients in teaching hospitals ; kuwait , april 2011 over 85% ( 801 ) of our participants permit both male and female students to read their medical file ( table 2 ) . also , around three - quarters of the patients permit both genders of medical students to present in the outpatient clinic ( opd ) during their consultation ( 685 ; 73.5% ) , and during ward rounds if the patients were admitted in the same ward ( 720 ; 77.3% ) . when patients were asked about their acceptance regarding the presence of medical students in the operation theatre if their condition required a surgical intervention , 26.7% ( 249 ) of them refused both males and females students to be present , while 57.7% ( 538 ) agreed on both genders of students to be present . regarding history taking , about 80% ( 742 ) of the participants would permit both genders of medical students to take their history with the presence of a supervising doctor ; however , this acceptance dropped to 51.2% ( 477 ) when the patients were asked if they would permit the students to take their history without the presence of a supervising doctor . although patients showed a high refusal ( 580 ; 62.2% ) in allowing both genders of medical students to examine them without a supervising doctor , the majority of the patients would allow both genders of students to be present while the doctor is examining them ( 535 ; 57.4% ) , and to examine them with the presence of a supervising doctor ( 503 ; 54% ) . the same applied to observing and performing procedures , where more than half of the participants refused both genders of students to perform diagnostic / other procedures for them , but 60.9% ( 568 ) of them would allow both genders of students to observe these procedures done for them by a doctor . patients reactions toward the presence of medical students in teaching hospitals ; kuwait , april 2011 ( n=932 ) the chi - square analysis showed that patient 's gender , occupation and income were statistically associated ( p - value < 0.001 , 0.04 and 0.006 respectively ) with the acceptance of patients in allowing medical students to read their medical files ( table 3 ) . male patients were more likely to accept male students , while female patients preferred female students more . also , it appeared that patients who allow a specific gender of students to read their medical files were not employed and had low income . moreover , obstetrics / gynecology patients were more likely to accept only female students in reading their medical files ( p - value < 0.001 ) . patients reactions regarding medical students reading their medical files and present during ward rounds in teaching hospitals ; kuwait , april 2011 ( n=932)a significant p - values are discussed in the text . the total number of patients without pediatrics patients is 825 . the total number of pediatrics patients is 107 . the association of these variables was tested without including pediatrics patients . table 3 shows that the acceptance of patients in allowing medical students to be present during ward rounds if they were admitted in the same ward was found to be statistically associated to the patient 's gender ( p - value < 0.001 ) , occupation ( p - value 0.004 ) and specialty ( p - value < 0.001 ) . female patients preferred female students , while male patient preferred male students to present during ward . obstetrics / gynecology patients preferred female students , and were more likely to refuse medical students to join ward rounds . regarding the acceptance of patients toward the presence of medical students in opd ( table 4 ) , patient 's gender , marital status , occupation and specialty were found to be statistically associated ( p - value < 0.001 , 0.023 , 0.001 and < 0.001 respectively ) . in general , female patients appeared to have a higher refusal of students . moreover , patients would prefer that the student attending the opd to be of the same gender as theirs . patients who were not married would accept students to be present in the opd during their consultation compared to married patients . moreover , patients who were not employed showed a higher acceptance of only female students to be present in the opd compared to employed patients . the highest acceptance of students to be present in the opd was found among pediatrics patients , while the highest refusal was found among obstetrics / gynecology patients . obstetrics / gynecology patients reported higher acceptance of only female students compared to patients from other specialties , while surgical patients reported a higher acceptance of only male students . patients reactions regarding medical students presenting in outpatient clinics ( opd ) and taking history with and without the presence of a supervising doctor in teaching hospitals ; kuwait , april 2011 ( n=932)a
significant p - values are discussed in the text . both the acceptance of the patients to allow students to take their history with the presence of a doctor and without the presence of a doctor ( table 4 ) were found to be statistically associated to the gender of the patient ( p - value < 0.001 for both ) , where a higher refusal was noted among female patients . acceptance of patients to allow medical students to take their history with the presence of a supervising doctor was also statistically associated to the specialty ( p - value 0.014 ) . the highest acceptance of students to take the history with a doctor was found among pediatric patients , while the highest refusal of students was found among obstetrics / gynecology patients . table 5 demonstrates that the patients gender was found to be significantly associated to the patients permission of medical students to be present while the doctor is examining them , to examine them in the presence of a supervising doctor , and to examine them without the presence of a doctor ( p - value < 0.001 ) . female patients revealed a higher refusal for both genders of students compared to male patients . it was also noted that patients acceptance was higher for students of similar gender to theirs . the refusal was very high for situations where students examine the patients without the presence of a supervising doctor . furthermore , a higher refusal was found among obstetrics / gynecological patients in accepting medical students to present during their examination by a doctor , examine them with the presence of a supervising doctor and without a supervising doctor compared to patients of other specialties ( p - value < 0.001 ) . obstetrics / gynecology patients also had a higher acceptance of female students , while surgical patients had a higher acceptance of male students . regarding the same patient - student interaction scenarios , a higher acceptance of only female students was found in patients who were not employed ( p - value 0.031 ) . in addition , kuwaiti and muslim patients appeared to have a higher refusal to be examined by both genders of student with the presence of a doctor compared to non - kuwaiti and non - muslim patients ( p - value 0.015 and 0.044 respectively ) . patients reactions regarding medical students observing the doctor examining them and examining them with and without the presence of a doctor in teaching hospitals ; kuwait , april 2011 ( n=932)a
significant p - values are discussed in the text . our statistical analysis ( table 6 ) showed that the patients gender , occupation and specialty were significantly associated to the patients permission of medical students to observe procedures done on them , perform procedures on them and being present in the operation theatre if their condition required a surgical intervention . similar to other outcomes , a higher percentage of female patients refused both genders of student to observe or perform procedures on them , and to present in the operation theatre compared to male patients ( p - value < 0.001 ) . also , a higher percentage of female patients would permit only female students to do so , while a higher percentage of male patients would permit only male students . it was also noted that a higher percentage of patients who were not employed would permit only female students to observe procedures ( p - value 0.001 ) or perform procedure on them ( p - value < 0.001 ) and present in operation theatre ( p - value 0.017 ) . moreover , a higher percentage of obstetrics / gynecology patients would refuse both genders of students , and accept more female students to observe procedures done for them , perform procedures on them and to be present in the operation theatre during their surgeries ( p - value < 0.001 , 0.006 and < 0.001 respectively ) . the age of patients in specialties other than pediatrics found to be statistically associated to the allowance of medical students to be present in operation theatre ( p - value 0.021 ) . patients reactions regarding medical students observing procedures done for them , performing procedures on them and presenting in operation theatres in teaching hospitals ; kuwait , april 2011 ( n=932)a
significant p - values are discussed in the text . the association of these variables was tested without including pediatrics patients . when asked about whom is treating them in teaching hospitals , 14.7% ( 137 ) of the patients thought that medical students were treating them , while 85.3% ( 795 ) thought that the doctors were doing so . moreover , about two - thirds ( 616 ; 66.1% ) of the participants preferred to receive their treatment in teaching hospitals more than non - teaching hospitals . a minority ( 73 ; 7.8% ) of our participants believed that the presence of medical students in hospitals worsen the quality of health care , while the majority ( 436 ; 46.8% ) believed that it improves the quality of health care . the rest of the patients ( 423 ; 45.4% ) believed that the quality of health care was not affected by the presence of medical students in hospitals . more than 75% ( 713 ) of the participants were either medical or surgical patients , while the rest were either pediatrics or obstetrics / gynecological patients ( table 1 ) . half of the participants ( 466 ; 50% ) were younger than 36 years old ( meanstandard deviation = 36.7919.841 ) . of the 932 patients , 498 ( 53.4% ) were females , and 587 ( 63% ) were married . almost all participants were muslims ( 876 ; 94% ) . around three - quarters ( 690 ; 74% ) of the patients were non - university / college graduates , and more than half of them ( 515 ; 55.3% ) were not employed . regarding the monthly family income of the participants , 61.7% ( 575 ) had an income of less than 1000 kuwaiti dinars ( kd ) per months . over 85% ( 801 ) of our participants permit both male and female students to read their medical file ( table 2 ) . also , around three - quarters of the patients permit both genders of medical students to present in the outpatient clinic ( opd ) during their consultation ( 685 ; 73.5% ) , and during ward rounds if the patients were admitted in the same ward ( 720 ; 77.3% ) . when patients were asked about their acceptance regarding the presence of medical students in the operation theatre if their condition required a surgical intervention , 26.7% ( 249 ) of them refused both males and females students to be present , while 57.7% ( 538 ) agreed on both genders of students to be present . regarding history taking , about 80% ( 742 ) of the participants would permit both genders of medical students to take their history with the presence of a supervising doctor ; however , this acceptance dropped to 51.2% ( 477 ) when the patients were asked if they would permit the students to take their history without the presence of a supervising doctor . although patients showed a high refusal ( 580 ; 62.2% ) in allowing both genders of medical students to examine them without a supervising doctor , the majority of the patients would allow both genders of students to be present while the doctor is examining them ( 535 ; 57.4% ) , and to examine them with the presence of a supervising doctor ( 503 ; 54% ) . the same applied to observing and performing procedures , where more than half of the participants refused both genders of students to perform diagnostic / other procedures for them , but 60.9% ( 568 ) of them would allow both genders of students to observe these procedures done for them by a doctor . patients reactions toward the presence of medical students in teaching hospitals ; kuwait , april 2011 ( n=932 ) the chi - square analysis showed that patient 's gender , occupation and income were statistically associated ( p - value < 0.001 , 0.04 and 0.006 respectively ) with the acceptance of patients in allowing medical students to read their medical files ( table 3 ) . male patients were more likely to accept male students , while female patients preferred female students more . also , it appeared that patients who allow a specific gender of students to read their medical files were not employed and had low income . moreover , obstetrics / gynecology patients were more likely to accept only female students in reading their medical files ( p - value < 0.001 ) . patients reactions regarding medical students reading their medical files and present during ward rounds in teaching hospitals ; kuwait , april 2011 ( n=932)a significant p - values are discussed in the text . table 3 shows that the acceptance of patients in allowing medical students to be present during ward rounds if they were admitted in the same ward was found to be statistically associated to the patient 's gender ( p - value < 0.001 ) , occupation ( p - value 0.004 ) and specialty ( p - value < 0.001 ) . female patients preferred female students , while male patient preferred male students to present during ward . in addition , employed patients revealed higher acceptance to students compared to unemployed patients . obstetrics / gynecology patients preferred female students , and were more likely to refuse medical students to join ward rounds . regarding the acceptance of patients toward the presence of medical students in opd ( table 4 ) , patient 's gender , marital status , occupation and specialty were found to be statistically associated ( p - value < 0.001 , 0.023 , 0.001 and < 0.001 respectively ) . in general moreover , patients would prefer that the student attending the opd to be of the same gender as theirs . patients who were not married would accept students to be present in the opd during their consultation compared to married patients . moreover , patients who were not employed showed a higher acceptance of only female students to be present in the opd compared to employed patients . the highest acceptance of students to be present in the opd was found among pediatrics patients , while the highest refusal was found among obstetrics / gynecology patients . obstetrics / gynecology patients reported higher acceptance of only female students compared to patients from other specialties , while surgical patients reported a higher acceptance of only male students . patients reactions regarding medical students presenting in outpatient clinics ( opd ) and taking history with and without the presence of a supervising doctor in teaching hospitals ; kuwait , april 2011 ( n=932)a
significant p - values are discussed in the text . both the acceptance of the patients to allow students to take their history with the presence of a doctor and without the presence of a doctor ( table 4 ) were found to be statistically associated to the gender of the patient ( p - value < 0.001 for both ) , where a higher refusal was noted among female patients . acceptance of patients to allow medical students to take their history with the presence of a supervising doctor was also statistically associated to the specialty ( p - value 0.014 ) . the highest acceptance of students to take the history with a doctor was found among pediatric patients , while the highest refusal of students was found among obstetrics / gynecology patients . table 5 demonstrates that the patients gender was found to be significantly associated to the patients permission of medical students to be present while the doctor is examining them , to examine them in the presence of a supervising doctor , and to examine them without the presence of a doctor ( p - value < 0.001 ) . female patients revealed a higher refusal for both genders of students compared to male patients . it was also noted that patients acceptance was higher for students of similar gender to theirs . the refusal was very high for situations where students examine the patients without the presence of a supervising doctor . furthermore , a higher refusal was found among obstetrics / gynecological patients in accepting medical students to present during their examination by a doctor , examine them with the presence of a supervising doctor and without a supervising doctor compared to patients of other specialties ( p - value < 0.001 ) . obstetrics / gynecology patients also had a higher acceptance of female students , while surgical patients had a higher acceptance of male students . regarding the same patient - student interaction scenarios , a higher acceptance of only female students was found in patients who were not employed ( p - value 0.031 ) . in addition , kuwaiti and muslim patients appeared to have a higher refusal to be examined by both genders of student with the presence of a doctor compared to non - kuwaiti and non - muslim patients ( p - value 0.015 and 0.044 respectively ) . patients reactions regarding medical students observing the doctor examining them and examining them with and without the presence of a doctor in teaching hospitals ; kuwait , april 2011 ( n=932)a
significant p - values are discussed in the text . the association of these variables was tested without including pediatrics patients . our statistical analysis ( table 6 ) showed that the patients gender , occupation and specialty were significantly associated to the patients permission of medical students to observe procedures done on them , perform procedures on them and being present in the operation theatre if their condition required a surgical intervention . similar to other outcomes , a higher percentage of female patients refused both genders of student to observe or perform procedures on them , and to present in the operation theatre compared to male patients ( p - value < 0.001 ) . also , a higher percentage of female patients would permit only female students to do so , while a higher percentage of male patients would permit only male students . it was also noted that a higher percentage of patients who were not employed would permit only female students to observe procedures ( p - value 0.001 ) or perform procedure on them ( p - value < 0.001 ) and present in operation theatre ( p - value 0.017 ) . moreover , a higher percentage of obstetrics / gynecology patients would refuse both genders of students , and accept more female students to observe procedures done for them , perform procedures on them and to be present in the operation theatre during their surgeries ( p - value < 0.001 , 0.006 and < 0.001 respectively ) . the age of patients in specialties other than pediatrics found to be statistically associated to the allowance of medical students to be present in operation theatre ( p - value 0.021 ) . patients reactions regarding medical students observing procedures done for them , performing procedures on them and presenting in operation theatres in teaching hospitals ; kuwait , april 2011 ( n=932)a
significant p - values are discussed in the text . the association of these variables was tested without including pediatrics patients . when asked about whom is treating them in teaching hospitals , 14.7% ( 137 ) of the patients thought that medical students were treating them , while 85.3% ( 795 ) thought that the doctors were doing so . moreover , about two - thirds ( 616 ; 66.1% ) of the participants preferred to receive their treatment in teaching hospitals more than non - teaching hospitals . a minority ( 73 ; 7.8% ) of our participants believed that the presence of medical students in hospitals worsen the quality of health care , while the majority ( 436 ; 46.8% ) believed that it improves the quality of health care . the rest of the patients ( 423 ; 45.4% ) believed that the quality of health care was not affected by the presence of medical students in hospitals . patients acceptance regarding the involvement of medical students in hospitals was found to vary in different aspects . the majority of our participants would allow medical students to read their medical file , present during ward rounds , and present in the opd during their consultations . this high allowance might be due to the minimal direct contact between the patient and the student , and minimal involvement of students in providing medical care . this was also shown in previous studies where the majority of patients would accept students to be present during their consultations ( 4 , 5 , 8) . moreover , it was demonstrated in previous studies that patients learn more about their condition when the doctor teaches the students ( 13 ) . a minority of our participants would refuse students to take their medical history with the presence of a supervising doctor ; however , this refusal reported to be very high ( i.e. , almost half of the participants ) when the patients were asked if they would permit medical students to take their history without a doctor . a possible reason for this increase in refusal is that patients might had a low confidence in medical students skills in gathering a complete medical history that could help in reaching the diagnosis . also , the patients might have thought that it would be a waste of their time to give their history to students when it was already given to doctors . another possible reason , which was demonstrated in previous studies , is that a large number of patients do not like to discuss sexual issues and personal matters with medical students ( 12 , 14 , 15 ) . while being examined by their treating doctors , a large number of patients in our study would refuse to be observed by medical students this refusal slightly increased when we asked the patients to allow students to examine them with the presence of a supervising doctor ; however , this refusal increased dramatically ( i.e. , more than half of the participants refused ) when patients were asked to allow students to examine them without the presence of a doctor . ( 5 ) , where only 7.2% of their participants refused to be examined by a students with the presence of a doctor , and 33.6% of their participants refused to be examined by a student alone . this high refusal could be due to the belief that medical students would harm the patients , and would not do a proper examination that detects findings without supervision . in addition , some of those who refused might had sexual problems ( e.g. , obstetrics / gynecological complaints or urological diseases ) that required examination of sensitive body areas , such as female breast and genitalia . more than one - quarter of our participants would refuse medical students to be present in the operation theatre if their condition required a surgical intervention . it seemed that a large number of patients refuse to be exposed in front of students , and they might be afraid that students may participate in their operation leading to worse surgical outcomes . the refusal regarding allowing medical students to observe diagnostic / other procedures done on the patients was doubled , and reached more than half of the participants , when the patients were asked if they would permit medical students to perform such procedures on them . this high refusal might have resulted because the patients had an idea that the students were not well trained to perform safe procedures , thus they might harm them . female patients showed a lower acceptance of both genders of students and a higher acceptance of only female students compared to male patients , a finding that is corroborated by other studies ( 4 , 7 , 14 ) . this is most likely because of the embarrassment to being exposed in front of students , especially male students . similar association was found also between the occupation of the patients and the reaction toward medical students ; patients who were not employed usually showed a lower acceptance of both genders of students and a higher acceptance of only female students . this is due to the fact that the majority of the participants who were not employed were females . similar to what was found by others , patients in different specialties showed different acceptance for students in most of our outcome variables ( 10 , 11 ) . this could be because kids are less likely to get embarrassed when exposed in front of others , and a large number of pediatrics patients were very young to understand what is going on around them allowing parents to be cooperative with students . on the other hand , obstetrics / gynecology patients showed a higher refusal to both genders of students , and a higher acceptance to only female students compared to patients in other specialties , most probably because of the embarrassment of exposing the body system ( i.e. , urogenital system ) involved in this specialty , and the fact that all patients of this specialty are females . according to the previously discussed results , a proper intervention aiming to improve bedside teaching , especially in situations that most patients are unwilling to allow medical students to participate , should start in fom , ku . simulation and standardization would be a good option for kuwait since ku lacks a clinical skills simulation center . simulation appeared to provide an opportunity to learn new skills and to practice previously acquired ones ( 16 ) , and to learn from mistakes in a safe , nonthreatening teaching environment ( 17 ) . also , it increases the students self - confidence in performing clinical skills ( 18 , 19 ) . moreover , the use of standardized patients in teaching clinical skills was shown to be useful in improving the performance of medical students in their clinical examinations ( 20 ) . although muslim women are sensitive to getting exposed in front of males , our results revealed that there was no association between the religion of the patient and the acceptability of medical students . mclean et al . ( 21 ) found that muslim women 's do not prefer to be examined by male students ; however , they did not compare their participants with non - muslim women . our result indicates that being a female patient , either muslim or not , by itself is enough to result in higher rejection of male students . surprisingly , more than 100 patients of our participants thought that medical students were responsible for treating patients in teaching hospitals . although a larger number of the staff of teaching hospitals are academics ( i.e. , professors ) compared to non - teaching hospitals , one - third of our participants preferred to be treated in non - teaching hospitals . the large involvement of medical students in the health care system of kuwait could have resulted in this . almost half of the participants ( 436 patients ) believed that the presence of medical students in hospitals improve the quality of health care , while a small minority ( 73 patients ) believed that it would worsen the quality , and 423 believed that it would not affect the quality . this variation of beliefs is most likely because some patients thought that when students spend a lot of time to clerk a case in details , they might detect significant findings that were missed by the doctors , and doctors spend more time discussing their condition when students are present . however , other patients might have thought that doctors will spend more time teaching students than caring for their patients . ( 13 ) found that there was no loss of quality of care , as perceived by patients , when students are present in consultations . in conclusion , the acceptability of patients to medical students appeared to be affected by the nature of interaction between the patient and the student , the presence of a supervising doctor during this interaction , the students and patients gender , and the specialty the patient 's in . in general , patients would prefer not to interact with students without the presence of a supervising doctor when compared to interactions with the doctors presence . overall , the highest acceptability appeared to be in pediatrics , and the lowest acceptability was in obstetrics / gynecology . clinical tutors must take advantage of patients who accept medical students , especially obstetrics / gynecology patients who accept male students for bedside teaching , in order to improve students learning process . improving the communication skills of medical students and clinical tutors in an attempt to increase the chances of convincing patients in accepting students should be considered by the fom , ku as this might improve bedside teaching in kuwait . also , using simulation and standardization should be considered to address scenarios that most patients are unwilling to allow students to participate . the authors have not received any funding or benefits from industry or elsewhere to conduct this study . | backgroundworldwide , patients are the cornerstone of bedside teaching of medical students . in this study , the authors aimed to assess patients acceptability toward medical students in teaching hospitals of the faculty of medicine of kuwait university.methodsninehundred and ninety five patients were approached in 14 teaching hospitals ; 932 patients agreed to participate ( refusal rate is 6.3% ) .
a self - administered questionnaire was used to collect data.resultsin general , higher acceptance of students by patients was found when there is no direct contact between the patient and the student ( e.g. , reading patients files , presenting in outpatient clinic , observing doctors performing examination or procedures ) compared to other situations ( e.g. , performing physical examination or procedures ) .
pediatrics patients showed higher acceptance of students compared to patients in other specialties , while obstetrics / gynecology patients showed the highest refusal of students .
gender of patients ( especially females ) and students appeared to affect the degree of acceptance of medical students by patients .
majority of the patients ( 436 ; 46.8% ) believed that the presence of medical students in hospitals improves the quality of health care.conclusionpatients are an important factor of bedside teaching .
clinical tutors must take advantage of patients who accept medical students .
clinical tutors and medical students should master essential communication skills to convince patients in accepting students , thus improving bedside teaching . also , using simulation and standardization should be considered to address scenarios that most patients are unwilling to allow students to participate . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 59-year - old male visited the wonkwang dental hospital complaining of tooth pain around the left maxillary molars . an intraoral examination revealed deep dental caries in the second and third molars and moderate mobility of the third molar . panoramic and periapical radiographs showed a carious lesion on the teeth extending into the subgingival area , but the radiographs did not show a bony destructive lesion in the left maxillary posterior region ( fig . 1 ) . since the endodontic treatment of subgingival carious lesions can not be guaranteed to be successful , extraction was considered . however , bronj was a concern because the patient had been administered pamidronate for two years , followed by zoledronate for five years , to treat multiple myeloma . moreover , the patient did not accept extraction as a treatment option , so tooth extraction was postponed . this patient had been diagnosed with multiple myeloma ( igg kappa type ) nine years previously and had undergone multimodal examinations and treatment at the wonkwang medical hospital . the diagnosis of multiple myeloma was based on multiple tests , including serum and urine protein electrophoresis , bone marrow biopsy , and radiographs of the bones commonly involved in multiple myeloma . plain pelvic radiographs showed diffuse decreased bone density and a compression fracture ( wedge deformity ) of t12 ( fig . the patient was initially treated with melphalan - based high - dose chemotherapy and autologous stem cell transplantation followed by interferon maintenance therapy . the patient returned to our emergency dental hospital four months later because he suddenly suffered from extreme pain due to a vertical fracture of the left maxillary second molar . ten days after the tooth extraction , the patient complained of discomfort and occasional pain around the extraction wound . approximately 50 days after the extraction , pus discharge was observed from the wound ( fig . we continued to administer antibiotics and analgesics , in addition to saline rinsing of the wound . a panoramic radiograph and computed tomograph performed 11 months later showed the pathologic bony fracture , sequestra formation , and irregular bone destruction ( fig . the premolars and first molar were extracted , followed by the surgical removal of necrotized bone fragments and alveoloplasty ( fig . after the removal of the necrotic bone and the surrounding tissue , the symptoms were relieved . sudden pain and gingival swelling occurred in the right mandibular posterior teeth six months later . a periapical radiograph showed only moderate periodontitis and proximal caries on the distal surface of the first molar , but no specific finding of osteolysis related to osteonecrosis around the root surface was observed ( fig . the interseptum of the right lower second molar was observed to be necrotic during surgery ( fig . the diagnosis of bronj in the left maxilla and right mandible in a multiple myeloma patient was made based on these clinical and radiographic findings . the diagnosis of multiple myeloma is based on several criteria , including the identification of an atypical plasma cell population on biopsy , abnormalities of immunoglobulin production , and evidence of end - organ damage , such as osteolytic bone lesions , anemia , hypercalcemia , or renal insufficiency.13 multiple myeloma is common in patients older than 40 years of age , with a peak incidence rate at 60 - 70 years , and is rare in people younger than 30 years of age.14 this patient was diagnosed at 50 years of age . the initial laboratory findings were 3.14 g / dl of serum m protein , clonal plasma cells comprising more than 10% of the bone marrow , and extensive osteolytic bone lesions without anemia , hypercalcemia , or renal insufficiency . therefore , the patient was diagnosed with multiple myeloma of the igg kappa type at durie - salmon stage iiia . multiple myeloma commonly shows numerous punched - out areas of radiolucency on plain radiographs.15 the osteolytic lesions of multiple myeloma are most commonly observed in the pelvis , spine , ribs , and skull.16 radiographic evidence of multiple myeloma in the jaw bones usually appears after extensive involvement of other bones , particularly the skull.817 the mandible is more commonly affected by multiple myeloma than the maxilla , and the posterior region is more commonly involved than the anterior region.18 in this case , the characteristic radiographic features of multiple myeloma were the punched - out appearance of the skull , the absence of detectable jaw lesions , and osteoporotic changes in the spine and pelvis . this presentation was similar to what has been described in other studies.17 interestingly , the jaw lesion , including the maxilla and mandible , did not show the characteristic bony rarefaction of multiple myeloma despite having existed for nine years . bronj is a severe complication of bisphosphonate therapy.9 because of the prolonged duration of bisphosphonate treatment in multiple myeloma patients , bronj has frequently been observed in patients with multiple myeloma . with the increasing use of the bisphosphonate class of drugs , dental professionals are likely to encounter more cases of bronj.19 the diagnostic criteria for bronj developed by the american association of oral and maxillofacial surgeon ( aaoms ) include a history of bisphosphonate use , no history of radiotherapy , and the presentation of exposed , necrotic jaw bone for more than eight weeks.20 dental procedures or traumatic injuries are another significant factor contributing to the likelihood of osteonecrosis in the jaw.21 theoretically , trauma to the mucosa and the exposure of bone and surrounding tissues to microbial flora creates an acidic inflammatory milieu.19 in this case , the exposed bone area of the left maxilla was relatively large . the left maxilla had a pathologic bony fracture , sequestra formation , and irregular bone destruction , which are characteristic features of bronj on computed tomography . bronj of the left maxilla occurred after tooth extraction , suggesting that an invasive dental procedure and the long administration of bisphosphonates were likely the etiologic factors . the right lesion occurred spontaneously , with the most likely etiologic factor being the prolonged administration of bisphosphonates . in this case report interestingly , the maxillary and mandibular lesion showed no bony rarefaction , which is characteristic of multiple myeloma , but did show an osteonecrotic lesion related to bisphosphonate administration . | a 59-year - old male who had suffered from multiple myeloma for nine years and had been administered bisphosphonates for seven years visited a dental hospital for pain relief due to extensive caries in his left maxillary molars .
the molars were extracted , leaving an exposed wound for three months .
the radiograph showed sequestra formation and irregular bone destruction in the left maxilla .
sudden pain and gingival swelling in the right mandibular molar area occurred six months later .
the interseptum of the right lower second molar was observed to be necrotic during surgery .
these findings coincided with the features of bisphosphonate - related osteonecrosis of the jaw ( bronj ) . in this case , the long intravenous administration of bisphosphonates and tooth extraction were likely the etiologic factors of bronj in a patient with multiple myeloma ; moreover , the bilateral occurrence of bronj is a characteristic feature . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
systemic sclerosis ( ssc ) is a connective tissue disorder characterized by vascular lesion and widespread fibrosis in organs such as skin , gut , lung , heart , and kidneys . clinically , there is a broad spectrum of symptoms from widespread severe skin thickening ( diffuse ) to skin thickening limited to distal extremities and/or face ( limited ) . in the diffuse form , skin involvement is limited to hands , body , and face ; whereas in the limited form , skin involvement is limited to hands and extremities lower than elbows and knees . cardiac involvement in ssc seems to be more prevalent than previously thought,1 as shown by improved invasive and non - invasive diagnostic techniques for detecting heart disease.25 cardiopulmonary , renal , and extensive skin involvement is poor prognosis and the leading cause of early death in ssc.6 to determine the abundance of cardiac involvement , the present study drew upon such different modalities as autopsy , exercise test , radioisotope scan , chest x - ray , ecg , and echocardiography.68 the severity of cardiac disease is usually determined using the two scoring methods of clement and medsger . the former is currently less favored in clinical trials , but the latter is regarded as more practical and is accepted by international ssc study groups . the present study was designed to address the dearth of data on the severity and frequency of cardiac involvement in ssc patients in iran . the ssc data bank in firouzgar hospital rheumatology department contains information on 67 patients ( until january 2007 ) . patients fulfilling the preliminary criteria of the american rheumatism association were recruited into this study , and 4 patients diagnosed as having ssc overlap with other connective tissue disease in addition to 5 patients whose cardiac involvement was secondary to pulmonary involvement were excluded . in total , 58 patients were included in the study . during a 6-month period after the first visit to our clinic , core set variables of all the patients in this case series were assessed to define each organ system involvement . for cardiac involvement , traditional criteria hinging on the presence of 1 or more dichotomous variables , i.e. presence or absence of cardiomegaly , pericardial effusion , ventricular arrhythmias , conduction disturbances , axis deviations , and pathological q waves ( myocardial necrosis ) , were employed.2 , 6 for cardiac severity , the preliminary severity scale , published by international ssc study groups , was utilized and the patients files were reviewed retrospectively.810 the preliminary scale introduced by medsger proposes a 9-organ disease severity scale for ssc , with the scale has both irreversible ( damage ) and reversible components ( activity ) , and the severity grading for each organ system ranges from 0 ( no document ) to 4 ( end - stage disease ) . in the cardiac scoring scale , grade 0 represents normal heart ( no cardiac involvement ) , grade 1 denotes mild involvement [ electrocardiography ( ecg ) conduction defect and a left ventricular ejection fraction ( lvef ) of 4549% ] , grade 2 signifies moderate involvement ( arrhythmia , lvef = 4044%),8 , 9 grade 3 indicates severe involvement ( lvef < 40% ) , and grade 4 stands for end stage ( congestive heart failure and arrhythmia requiring treatment ) . for the cardiac severity scale , each variable was primarily attributed to ssc rather than to another disorder . for example , if patients with mild ( grade 1 ) cardiac involvement developed superimposed bacterial pneumonia with transient severe dyspnea and fibrillation ( grade 2 , moderate ) due to hypoxia , the cardiac score was evaluated after pneumonia had resolved . the relationship between cardiac involvement severity ( cardiac scoring ) and disease stage was assessed by analyzing the time periods in two disease subsets : early and late stages of the disease . early stage was defined as diffuse cutaneous ( dcssc ) < 3 years and limited cutaneous ( lcssc ) < 5 years . the analyses were performed using spss software version 9 released for microcomputers . the chi - square test was used for the detection of any correlation between cardiac severity and the two subsets of scleroderma , and the fisher exact test was employed for the comparison of cardiac severity in the early and late stages of the 2 disease subsets . the kendall tau correlation coefficient was used to assess the correlation between cardiac severity and severity of other organ involvement . table 1 depicts the general characteristics of the patients . there were 58 patients with a mean age sd of 40.913.7 years and a female to male ratio of 53/5 , of whom 24 ( 41.4% ) patients were in the dcssc subset . the mean total skin score in all the patients was 16.6 , based on the modified rodnan scoring system , and the mean duration from symptom onset to study entry was 7.38.5 years for the dcssc and 8.48.2 years for the lcssc subsets ; there was no statistically significant difference ( p value = 0.638 ) . cardiac involvement was detected in 13 ( 22.4% ) and conductive disturbance in 6 ( 10.3% ) out of the 58 ssc study patients . axis deviation was found in 6 ( 10.3% ) patients , all with left axis deviation . additionally , abnormal q waves and arrhythmia were found in 1 ( 1.7 ) and 2 ( 3.5 ) patients , respectively . cardiomegaly on chest x - ray , echocardiography , or ecg was found in 10 ( 17.2% ) patients : 4 in the limited and 6 in the diffuse disease subtypes . echocardiography revealed pericardial effusion in 9 ( 15.5% ) patients , with a moderate - to - severe degree of pericardial effusion in 3 ( 5.1% ) persons . as table-3 demonstrates , there was no difference in terms of cardiac involvement between the 2 forms of scleroderma . with respect to the cardiac severity scoring of the patients , 45 ( 77.6% ) patients scored zero ( normal heart ) ; cardiac involvement in 13 of the 58 ( 22.4% ) patients was detected . seven and 5 patients in the limited and diffuse disease subsets , respectively , had mild cardiac involvement ( grade 1 ) ; moderate to severe cardiac involvement was not observed in either of the two subsets ; and only 1 patient with diffuse skin involvement had end - stage cardiac involvement . a comparison of the limited and diffuse subsets of patients with no cardiac involvement as group 1 and the others with mild - to - severe involvement as group 2 yielded no statistically significant difference ( p value = 0.96 ) in regard to the relationship between the severity of cardiac involvement and that of other systems , cardiac severity showed no correlation with the severity of dermal , peripheral vascular , renal , tendinous , muscular , and gastrointestinal systems . there was , however , a significant correlation between cardiac severity and pulmonary severity ( kendall tau = 0.27 , p value = 0.04 ) . the relationship between cardiac severity ( cardiac scoring ) and disease stage in the two disease subsets was evaluated , and the time scales were analyzed in the two disease subsets in terms of early and late stages ; early stage was defined as dcssc < 3 years and lcssc < 5 years . there were 8 ( 23.5 ) patients with the dcssc subtype in the early disease stage < 3 years ( table 3).there was no difference in the severity grade of the two disease subtypes between the early and late stages ( in early stage : p value = 0.136 and = 3.564 ; in late stage : p value = 0.433 and = 0.332 ) . the female to male ratio in the present study population at a mean agesd of 40.913.7 years was 53/5 , which does not chime in with the results of pervious epidemiological studies of ssc reporting that the disease is 34 times more common in women . nonetheless , the onset of ssc in this study is in the fourth and fifth decades of life as is the case in other similar studies.11 , 12 the mean disease duration from onset to entry in the lcssc and dcssc subtypes was 8.4 and 7.3 years , respectively . this means that the patients referred for treatment in the late disease stages , contributing to sample collection bias in the present study . from a total of 58 ssc patients , 13 ( 22.4% ) persons were found to have cardiac involvement and most of these patients ( 12/13 [ 92% ] ) showed mild severity of involvement . in the janosik et al.13 study , pathological involvement of the pericardium was observed in 70%80% of the patients at autopsy , while clinical manifestation was present in 7%20% of the study subjects . they reported an association between pericardial effusion and cardiac involvement ; pericardial effusions were small or large and had developed rapidly in some cases due to renal failure . echocardiography revealed pericardial effusion in 9 ( 15.5% ) patients , moderate - to - severe pericardial effusion in 3 ( 5.1% ) patients , and no renal failure in our study population . it is deserving of note that echocardiography tends to be abnormal in 50% of patients and includes evidence of pericardial thickening or fluid , while clinical presentations of pericarditis and of tamponade are infrequent.16 in this series , we found axis deviation in 6 ( 10.3% ) patients , all with left axis deviation . arrhythmia and abnormal q waves were present in 2 and 1 patient in each disease subset . et al.14 study , electrocardiography abnormalities , including arterial and ventricular arrhythmias and conduction disturbances by ambulatory electrocardiography study , confirmed a high prevalence of both supraventricular and ventricular tachyarrhythmia . in our study , cardiomegaly on chest x - ray , echocardiography , or ecg were found in 10 ( 17.2% ) patients : 4 in the limited and 6 in the diffuse disease subtypes . in the clements p. j. et al . 15 study of 90 patients , 44 ( 49% ) patients were found with cardiac involvement , which was comprised of arrhythmia in 4 ( 4.4% ) , cardiomegaly in 16 ( 17.8% ) , conduction defect in 9 ( 10% ) , pericardial effusion in 9 ( 10% ) , axis deviation in 18 ( 20% ) , and pathological q wave in 12 ( 13.3% ) . the sd of the duration of ssc prior to entry was 6.67.8 years , and 39 patients entered the study within 3 years of disease onset . in a study of cardiac involvement by geirsson a. j. et al.,16 40 patients with ssc and disease duration of 6 years were included in study . cardiomegaly and arrhythmia at rest were 57% and 7.5% in the diffuse and crest syndrome , respectively . there were 9 ( 15.5% ) patients with mild - to - severe pericardial effusion in our study as opposed to the 17.6% figure in the pittsburgh study;8 the incidences of pericarditis were , however , similar . in the mc whorter et al.17 study , the incidence of pericardial effusion was 50% and that of tamponade was not high as well . coronary involvement was evaluated via non - invasive procedures in the present study , and no serological correlation with specific auto - antibodies was done , which can be deemed a limitation of our study . forty - five ( 77.6% ) of our study population scored zero for cardiac involvement ( normal heart ) . as was mentioned above , evidence for cardiac involvement was relatively infrequent ; a comparison between the limited and diffuse subsets of patients with no cardiac involvement as group 1 and the others with mild - to - severe involvement as group 2 yielded no difference in terms of frequency between the two groups ( p - value = 0.46 ) . an assessment of the relationship between the severity of cardiac involvement ( cardiac scoring ) and lung involvement showed no correlation with the severity of skin involvement . visceral involvement in the diffuse subset patients was high in the early disease stage and skin stiffness was low in the late stage . visceral involvement gradually decreased but did not cure spontaneously . in the existing literature , the incidence of visceral involvement in the limited form is similar to that of the diffuse form except for renal and dermal involvement , which is gradual.1820 by contrast , 66.7% of the patients in the diffuse subset in the present study were in the late disease stage , denoting the lack of a relationship between skin involvement and severity of lung and cardiac disease . on the other hand , skin severity is not a good indicator of the severity of visceral organ involvement , especially in the late stage . we found no difference in the severity of cardiac involvement between the two disease subsets in the early and late stages . this result may be in consequence of either the low incidence of cardiac involvement , rendering the number of cases in each disease stage insufficient to divulge any difference , or collection bias as the patients were recruited into the study long after the disease onset . in the furst et al.22 study , patients with progressive ssc were matched for sex , age , and disease duration and the results showed a relationship between muscle involvement and severity of skin disease . a point of significance is that the present study represents only a small group of ssc patients in iran . furthermore , the fact that the majority ( 55% ) of our patients were in the late disease stage precludes any generalization of the results . the present study represents a baseline estimate of the occurrence and severity of cardiac involvement in a small group of iranian ssc patients . in this case series of 58 patients , a low incidence of cardiac involvement our study also demonstrates the relative ease and applicability of severity scale measures for an assessment of cardiac involvement in ssc sufferers . future studies are required to shed further light on the correlation between cardiac involvement and severity and specific auto - antibodies in scleroderma . | background : cardiac involvement in systemic sclerosis ( ssc ) is more prevalent than previously thought . in this study , the frequency and severity of cardiovascular involvement were assessed in ssc patients referred to firouzgar hospital.methods:fifty-eight patients with ssc , selected from the data bank of ssc patients , were reviewed for the frequency and severity of 8 organ involvements in this case series.the preliminary severity scale , published by international ssc study groups , was employed for the determination of the severity grade in the cardiovascular system . in the cardiac scoring scale ,
grade 0 represents normal heart ( no cardiac involvement ) , grade 1 denotes mild involvement [ electrocardiography ( ecg ) conduction defect and a left ventricular ejection fraction ( lvef ) of 4549% ) ] , grade 2 signifies moderate involvement ( arrhythmia , lvef = 4044% ) , grade 3 indicates severe involvement ( lvef < 40% ) ] , and grade 4 stands for end stage ( congestive heart failure and arrhythmia requiring treatment).results : in this study , 24 ( 41.4% ) patients were in the diffuse cutaneous ( dcssc ) subset .
the female to male ratio was 10.5:1 , and the mean duration from symptom onset to diagnosis was 7.35 years for the dcssc subset and 8.41 years for the limited cutaneous ( lcssc ) subset of disease , there being no significant difference .
cardiac involvement in this series was seen in 13 ( 22.4% ) cases ; and there was no significant difference in terms of frequency and severity between the two disease subgroups ( p value = 0.96 and p value = 0.46 respectively).conclusion : our findings showed that the cardiac involvement in this series was infrequent and that there was no significant difference in the severity of cardiovascular involvement between the two subtypes of ssc in the late stage of the disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
brave new world revisited , by aldous l. huxley ( 18941963 ) in many biological systems , including human societies , individuals adopt deceptive tactics to change the perception and behavior of others . perpetrators may deceive by purposely attempting to convince others to believe false information ( i.e. , the pinocchio effect in humans ) , or by misleading them through the deliberate omission or concealment of key information that could jeopardize their interests . the range of traits , behaviors and circumstances involved in the deceit may be very diverse across species , but the ultimate goal is to gain some kind of benefit or to avoid loss , hence leading to an increase in evolutionary fitness . because of the potential benefits of misleading signals , the art of deception is commonly practiced by many species and , paradoxically , essential for the proper workings of interactions among individuals and groups ( e.g. , some lies are altruistic and pro - social , making for smoother communication in humans ) . interestingly , the deceit only works when embedded within signaling systems with a certain degree of reliability where signals are reliable often enough because , on average , they convey information that are honest , thus making the response beneficial to receivers ( for a review of the topic see searcy and nowicki ) . and indeed , deceptive signaling can be identified only if we first know what constitutes a reliably honest communication within our specific study system . although arguably one of the most intriguing evolutionary questions , our own interest here does not revolve around the actual issue of reliability and deceit of signaling systems . instead , we ask a question about the reliability of the context we adopt to interpret the issue and what happens when the function of animal signals is inferred from a look - alike true assumption . across the animal and plant kingdoms , mimicry has evolved in response to common selective pressures that favor individuals that can conceal their identity and avoid recognition by ( more or less ) closely resembling their model . for many mimicry systems , body shape , size , color and patterns are the primary signaling mechanisms used to deceive receivers , and the conspicuous eyespots at the end of animals ' backs , heads , tails and wings are certainly among the most intriguing forms of these deceptive adaptations . because eyespots are most commonly found in lepidoptera , their role has been primarily discussed and examined in this group and several studies over the last few years have supported the two main long - standing hypotheses invoked to explain their occurrence : ( 1 ) intimidation eyespots frighten predators by mimicking the eyes of the predators own dangerous enemies ; ( 2 ) deflection eyespots deflect the attacks of predators to non - vital regions of the body ( for a comprehensive review see kodandaramaiah ) . although the eye - mimicry hypothesis has been the most cited explanation for the intimidating nature of eyespots , experimental support for it has become available only recently . aside from butterflies and moths , eyespots are a common feature in many other insect groups , birds , reptiles and several fish species ( fig . 1 ) . because of their widespread occurrence and similarity in shapes and forms across species , it has been tempting to assume that they evolved to perform similar adaptive functions , particularly in the context of protection against predators . and indeed , both the intimidation and deflection hypotheses have been proposed to explain the occurrence of eyespots in fish for instance , although empirical evidence in support of either idea has been noticeably missing . interestingly , quite a different story has emerged from more recent studies that have gone far enough to test experimentally the function of fish eyespots in nature . reef fishes , eyespots are particularly common in damselfishes ( a and b ) , blennies ( c ) and butterfly fishes ( d and e ) . photos courtesy of n. thake . eyespots have been observed to occur on the tails and dorsal fins of juveniles in a number of coral reef fish species . located posteriorly , they have long been assumed to misdirect a predator s attack away from vital parts of the body such as the head , by mimicking the real eyes but being located in a less vital region of the body , such as the dorsal fin . eyespots in coral reef fishes have also been expected to deflect a predator s attention away by confusing a predator about its actual distance from a potential prey assuming that a larger eyespot relative to the real eye would induce a predator to initiate an attack from a greater distance than it normally would . remarkably , the assumption that eyespots in these species have such anti - predator function and larger eyespots relative to the size of real eyes better serve as a decoy , thereby increasing juvenile survivorship in the wild , remained untested until recently . using a mark - recapture experiment , gagliano demonstrated that eyespots of the ambon damselfish ( pomacentrus amboinensis ) may not confer the long - assumed protection from predators and suggested that these markings may serve other purposes . in our recent paper , we investigated this alternative of a non - predatory function of eyespots in this species and showed that these markings have a deceptive function in the context of intrasexual ( male - male ) competition . specifically , we examined the possible functional role of the dorsal eyespots in p. amboinensis by exploring differences in body shape among age and gender groups , based on the fact that : ( 1 ) all juveniles are females and all have an eyespot , and ( 2 ) most individuals lose their eyespots on maturation , yet a few retain them into adulthood . we demonstrated that the eyespot retention is gender - specific , where eye - spotted adults are always sexually mature males , and these eye - spotted males more closely resemble the size and body shape of immature females than that of the males they actually are ( i.e. , mimicry ) . moreover , age data of p. amboinensis with and without eyespots indicated that the functional significance of these markings switches within a lifetime from serving as an honest signal of the sexual immaturity of juveniles to reduce aggression by mature males to a deceptive signal of age and non - breeding status . what our study really highlights , however , is a much more perilous trap . obviously , evidence shown in one system may not necessarily be a panacea for all systems . something said often enough does not make it so ; our study reminds us that hypotheses should be tested and evaluated within their specific context if we are to avoid the risk of developing our science on widely accepted , but not always correct premises . across the animal and plant kingdoms , mimicry has evolved in response to common selective pressures that favor individuals that can conceal their identity and avoid recognition by ( more or less ) closely resembling their model . for many mimicry systems , body shape , size , color and patterns are the primary signaling mechanisms used to deceive receivers , and the conspicuous eyespots at the end of animals ' backs , heads , tails and wings are certainly among the most intriguing forms of these deceptive adaptations . because eyespots are most commonly found in lepidoptera , their role has been primarily discussed and examined in this group and several studies over the last few years have supported the two main long - standing hypotheses invoked to explain their occurrence : ( 1 ) intimidation eyespots frighten predators by mimicking the eyes of the predators own dangerous enemies ; ( 2 ) deflection eyespots deflect the attacks of predators to non - vital regions of the body ( for a comprehensive review see kodandaramaiah ) . although the eye - mimicry hypothesis has been the most cited explanation for the intimidating nature of eyespots , experimental support for it has become available only recently . aside from butterflies and moths , eyespots are a common feature in many other insect groups , birds , reptiles and several fish species ( fig . 1 ) . because of their widespread occurrence and similarity in shapes and forms across species , it has been tempting to assume that they evolved to perform similar adaptive functions , particularly in the context of protection against predators . and indeed , both the intimidation and deflection hypotheses have been proposed to explain the occurrence of eyespots in fish for instance , although empirical evidence in support of either idea has been noticeably missing . interestingly , quite a different story has emerged from more recent studies that have gone far enough to test experimentally the function of fish eyespots in nature . reef fishes , eyespots are particularly common in damselfishes ( a and b ) , blennies ( c ) and butterfly fishes ( d and e ) . photos courtesy of n. thake . eyespots have been observed to occur on the tails and dorsal fins of juveniles in a number of coral reef fish species . located posteriorly , they have long been assumed to misdirect a predator s attack away from vital parts of the body such as the head , by mimicking the real eyes but being located in a less vital region of the body , such as the dorsal fin . eyespots in coral reef fishes have also been expected to deflect a predator s attention away by confusing a predator about its actual distance from a potential prey assuming that a larger eyespot relative to the real eye would induce a predator to initiate an attack from a greater distance than it normally would . remarkably , the assumption that eyespots in these species have such anti - predator function and larger eyespots relative to the size of real eyes better serve as a decoy , thereby increasing juvenile survivorship in the wild , remained untested until recently . using a mark - recapture experiment , gagliano demonstrated that eyespots of the ambon damselfish ( pomacentrus amboinensis ) may not confer the long - assumed protection from predators and suggested that these markings may serve other purposes . in our recent paper , we investigated this alternative of a non - predatory function of eyespots in this species and showed that these markings have a deceptive function in the context of intrasexual ( male - male ) competition . specifically , we examined the possible functional role of the dorsal eyespots in p. amboinensis by exploring differences in body shape among age and gender groups , based on the fact that : ( 1 ) all juveniles are females and all have an eyespot , and ( 2 ) most individuals lose their eyespots on maturation , yet a few retain them into adulthood . we demonstrated that the eyespot retention is gender - specific , where eye - spotted adults are always sexually mature males , and these eye - spotted males more closely resemble the size and body shape of immature females than that of the males they actually are ( i.e. , mimicry ) . moreover , age data of p. amboinensis with and without eyespots indicated that the functional significance of these markings switches within a lifetime from serving as an honest signal of the sexual immaturity of juveniles to reduce aggression by mature males to a deceptive signal of age and non - breeding status . what our study really highlights , however , is a much more perilous trap . obviously , something said often enough does not make it so ; our study reminds us that hypotheses should be tested and evaluated within their specific context if we are to avoid the risk of developing our science on widely accepted , but not always correct premises . | deception is ubiquitous in plant and animal kingdoms and is widely thought to provide selective advantages to the individual and evolutionary success to the species .
mimicry , a form of deception whereby an individual imitates their model to advantage by closely resembling their behavior or appearance , is particularly well documented and represented by the peripheral eyespots seen on the wings of many butterfly species .
the significance of butterfly eyespots has been convincingly demonstrated to serve as an anti - predatory function either by imitation of a predator s own dangerous enemies ( intimidation hypothesis ) or by deflecting predator strikes toward less - vital parts of the body ( deflection hypothesis ) .
a convincing and compelling explanation in butterflies , the functional role of eyespots as anti - predatory devices has become a widely held and firmly entrenched belief that has been freely adopted into other systems . here
we comment on a recent paper that demonstrates a vastly different role for eyespots , that of intra - specific male - male competition , and make the point that even long - held beliefs need to be tested and challenged under different contexts if we are not to be deceived ourselves . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 30-year - old male presented with diplopia in left eye for 20 days following occupational accident over the left side of his nose . he being a carpenter by profession , sustained the injury while working with a nail gun , as one of the nails had been wrongly placed and bounced off the concrete wall and hit the left lateral aspect of his nose , leaving a small laceration , which had healed by the time he presented . the left eye was congested with hyperglobus and the extra - ocular movements were restricted and painful [ fig . 1 ] . a provisional diagnosis of orbital floor fracture with entrapment of orbital tissue , with or without a retained foreign body was made . occipito - mental view 10 and 30 radiographs were taken , revealing the presence of a metallic foreign body [ fig . 2 ] . congestion and hyperglobus of left eye ( arrow showing a faint scar indicating point of entry ) occipito - mental view radiograph showing metallic foreign body the exact site and position of the foreign body was confirmed by a computed tomography ( ct ) scan , a metallic foreign body lodged in the left orbit without any bone injury and settled in the posterior part of the orbit [ fig . there was a faint scar over the left lateral aspect of the nose [ fig . 1 ] . 3-dimensional ct scan pictures showing a metallic foreign body in the posterior part of left orbit ( a ) frontal view ( b ) 45 lateral view the high velocity sharp projectile had pierced the skin of left lateral side of the nose and into the supporting tissues of the eye and lodged in the posterior aspect of the orbit . patient was informed about the foreign body present in his left eye and the treatment options . left lateral eyebrow incision was given exposing the supra - orbital margin and orbital roof [ fig . blunt dissection was done through the orbital fat and other soft tissues and the nail head was detected using an image intensifier [ fig . 4b ] which was removed along the axis of curvature of the nail without damaging the eye globe and adjacent tissues [ fig . 5 ] . post surgery , the patient recovered with complete resolution of diplopia with normal extra ocular movements of the left eye . ( a ) left lateral eyebrow incision and exploration ( b ) image intensifier showing nail in the orbit metallic foreign body removed from the left orbit first , a rare presentation with a nail in the orbit that the patient did not know . secondly , the late presentation of the patient ( 20 days post injury ) had camouflaged the entry wound which made the initial diagnosis difficult , until a radiograph was done . thirdly , due to its peculiar point of entry ( left lateral aspect of nose ) through which the metallic foreign body could enter the posterior part of orbit and finally the mechanism of injury , the nail head piercing the soft tissues despite being blunt . it is emphasized that even a tiny foreign body retained within the structures of the orbit can cause immediate or delayed complications including chronic orbital inflammation , osteomyelitis , thrombotic vasculitis , and diffuse infections in the form of septicopyaemia . the retained foreign bodies in the orbit can also cause orbital hematoma , orbital cellulitis , ocular dysmotility , proptosis , orbital abscess , and blindness . imaging is of crucial importance while managing foreign bodies which include ct and magnetic resonance imaging ( mri ) scans and intra - operative image intensifiers , which help determine foreign body location and its topographic relationships with neighboring structures ( e. g. eyeball and optic nerve ) . mri is not preferred while dealing with intra - orbital metallic foreign bodies as they may cause even more tissue damage . the approach to remove orbital foreign bodies may vary on the position of the foreign bodies and surgeon 's preference . a transcranial approach , is necessary to remove orbital foreign bodies that are not readily removable because of their location , this approach is most likely to minimize complications , although the approach calls for technical competence and is time - consuming . the krnlein - reese - berk orbitotomy provides a satisfactory access to the lateral and posterior orbit , which is of particular importance in the case of a deeply penetrating foreign body ( metallic or glass ) . krnlein - reese - berk orbitotomy as it provides wider exposure of the orbital cavity and in fewer surgical complications . we used an lateral eyebrow approach to access the supra - orbital margin area and the superior - lateral aspect of the orbital roof , as the head of the nail ( foreign body ) was localized by the help of 3-dimensional ct pictures and with the aid of image intensifier ( intra - operative ) . the approach we used was precise with less tissue loss and scarring when compared to transcranial approach and krnlein - reese - berk orbitotomy . this was possible as the foreign body was well localized pre - operative and even intra - operative by using different imaging modalities . best outcome in managing orbital foreign bodies will be achieved by a through pre surgical work up which includes evaluation of clinical signs and symptoms , deliberate use of different imaging modalities and to plan a appropriate surgical approach . | a 30-year - old male presented with diplopia for 20 days post occupational accident involving left side of his nose , while he was working with a nail gun .
he was fully conscious and did not have any neurological deficits .
patient narrated the mechanism of injury and was sure that the nail fell down after hitting the left side of his nose .
he had normal vision , but extra ocular movements were restricted and painful .
computed tomography ( ct ) scan revealed a curved metal object lodged in the posterior aspect of the left orbit extending diagonally from medial wall to the anterior - superior aspect of the orbital roof .
the object was removed via a small surgical approach , inflicting least possible surgical trauma .
post surgery , the patient recovered with complete resolution of diplopia .
the original aspects of this case are the lack of signs of a foreign body entry and its relative harmlessness in spite of its large size . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
pancreatic and peripancreatic tuberculosis ( ppt ) is a rare non - neoplastic lesion and its clinical and radiological findings may be similar to those of pancreatic malignancy . therefore , diagnosis of the ppt is very difficult , and most of previously reported cases were diagnosed after exploratory laparotomy for suspected pancreatic malignancy . abdominal infection with tb commonly affects the ileo - cecal region , spleen , liver and kidney . pancreatic tb presents with a wide spectrum of symptoms such as abdominal pain , constitutional symptoms , obstructive jaundice , iron - deficiency anemia , pancreatic abscess , massive gastro - intestinal bleeding , acute / chronic pancreatitis , secondary diabetes , splenic vein thrombosis and a pancreatic mass mimicking malignancy . we present a series of ppt cases to emphasize the differential diagnosis of a pancreatic mass and to discuss the role of ultrasound / endoscopic ultrasound - guided fine - needle aspiration cytology ( us / eus - fnac ) as a technique of good modality in preoperative diagnosis of ppt . we analyzed a total of 14 diagnosed cases of primary tb involving the pancreas ( 7 cases ) and peripancreatic region ( 7 cases ) . all the cases of ppt diagnosed by us / eus - fna of the pancreas over a period of 5 years ( 2006 - 2010 ) were retrieved from our hospital information system records . all the patients underwent us - fnac except two cases ( eus - fna ) , which was performed by the clinician , radiologist and the cytopathologist . a 22-gauge needle , 9 cm in length , was inserted into the lesion by the radiologist under ultrasound guidance . a 10/20 ml syringe fitted to a syringe holder a minimum of one to two fna passes were taken from each lesion and the slides were immediately checked for adequacy of representative material . both air - dried and alcohol - fixed smears were made ( 5 - 8 smears ) from the aspirated material in each case . may - grnwald giemsa ( mgg ) , hematoxylin - eosin ( h and e ) , papanicolaou ( pap ) stain , smears for fungus , acid - fast bacilli ( afb ) along with fna samples for culture , polymerase chain reaction ( pcr ) assay and cell blocks ( if any ) were evaluated . this included 10 males and 4 females with age ranging from 15 to 58 years ( mean age 37 years ) , who were detected to have ppt from 2006 to 2010 at our institute . we reviewed the clinical , radiological [ ultrasonographic , magnetic resonance imaging ( mri ) and computed tomography ( ct ) features ] and laboratory findings of all patients . in most of the cases , the cytological diagnosis was correlated with histopathological reports wherever available ( cell blocks in two cases ) . on follow - up , ranging from 6 months to 1.5 years after anti - tubercular treatment ( att ) , 12 patients showed good response to att , one patient had drug - resistant tb , and one patient was lost to follow - up . the majority of patients were in the fourth to fifth decade ( 30 - 45 years ) . the duration of symptoms spanned between 2 and 12 months , with a mean duration of 7 months . the most common symptom was abdominal pain localized to the epigastrium , fever and weight loss . all patients had history of tb displaying the isolated pancreatic ( 7/14 cases ) and peripancreatic ( 7/14 cases ) involvement as the primary manifestation [ table 1 ] . ultrasonography ( us ) showed bulky homogenous pancreas in five patients and hypoechoic mass in nine cases . ct findings demonstrated hypodense collections within the pancreas in five patients and complex hypoechoic pancreatic mass lesion in nine patients . ct findings in case 14 showed pancreatic mass with multiples lymph nodes and liver nodules . mri was done in three cases and showed a sharply delineated mass with heterogeneous enhancement located in the pancreatic head . cytology smears showed necrosis in 12 cases in which predominant necrosis was found in 6 and focal necrosis in 6 cases , epithelioid cell granulomas in 8 cases , normal pancreatic acini in the background in 4 cases , and inflammatory cells comprising mainly polymorphs and lymphocytes in all cases . necrosis , epithelioid cell granulomas and inflammatory cells [ figure 1 ] were seen in eight cases . multinucleated giant cells were seen only in one case . ziehl - neelsen stain ( zn stain ) for afb [ figure 2 ] was positive in 9 out of 14 cases . pcr was performed in 10 out of 14 cases , of which 8 cases showed mycobacterium tuberculosis dna in fna samples [ figure 3 ] . cell blocks were made in two cases ( 2/14 ) and showed multinucleated giant cells , epithelioid histiocytes and necrosis . no histopathological examination was done due to preoperative cytological diagnosis of ppt and patients responded well to att . follow - up was available in all cases up to 1.5 years , and 12 cases showed good response with att . case 6 was lost to follow - up , and case 8 was drug resistant with att . summary of us / eus guided fnac cases of pancreatic and peripancreatic tuberculosis ( n=14 ) smear shows epithelioid cell granulomas , necrosis and inflammatory cells composed of neutrophils and lymphocytes ( mgg , 400 ) fna smear shows necrosis and inflammatory cells . zn stain for afb is positive ( zn stain , 1000 ) polymerase chain reaction in pancreatic tuberculosis shows is6110 gene ( 123 bp ) in three fna samples in lanes 4 , 5 and 6 . lane 1 is ladder ( 100 bp ) precaution on using diagnostic cytology in ppt is that the site of needle piercing should be cleaned with spirit and betadine . we should take consent from the patient before fnac , and the patient should have normal prothrombin time ( pt ; 11 - 16 s ) and activated partial thromboplastin time ( appt ; 30 - 40 s ) levels . always 22 - 23 g spinal needle of 9 cm in length has to be used in the exact lesion by radiologist and cytopathologist team . clinician should be present during the procedure to avoid any serious complication such as peritonitis , perforation , severe pain , major hemorrhage and exacerbation of pancreatitis . precaution on using diagnostic cytology in ppt is that the site of needle piercing should be cleaned with spirit and betadine . we should take consent from the patient before fnac , and the patient should have normal prothrombin time ( pt ; 11 - 16 s ) and activated partial thromboplastin time ( appt ; 30 - 40 s ) levels . always 22 - 23 g spinal needle of 9 cm in length has to be used in the exact lesion by radiologist and cytopathologist team . clinician should be present during the procedure to avoid any serious complication such as peritonitis , perforation , severe pain , major hemorrhage and exacerbation of pancreatitis . extrapulmonary organ involvement by tb is expected to occur in 10 - 15% of the patients non - infected by hiv . with the increasing use of immunosuppressant drugs and the emergence of aids , there has been a reappearance of tb and the frequency is about 50 - 70% in patients infected by hiv . the main symptoms at presentation of ppt in our cases were abdominal pain , weight loss , fever , recurrent vomiting and jaundice . majority of our patients showed strongly positive tuberculin test ( 70% ) and increased erythrocyte sedimentation rate ( esr ) . a previous study showed high esr with positive tuberculin test in over two - thirds of the cases , authors also demonstrated that those patients had a strongly positive tuberculin test ( 50% ) and normal sedimentation rate revealed elevated c - reactive protein in their other study . ppt presents with a wide spectrum of symptoms such as abdominal pain ( 100% ) , constitutional symptoms such as anorexia , weight loss and night sweat , fever , obstructive jaundice , iron - deficiency anemia , pancreatic abscess , massive gastrointestinal bleeding , acute pancreatitis , chronic pancreatitis , secondary diabetes , splenic vein thrombosis , and a pancreatic mass mimicking malignancy . most of our patients ( over ~75% ) showed isolated pancreatic and peripancreatic mass mimicking pancreatic malignancy . earlier studies showed that pancreatic mass mimicking pancreatic malignancy is seen in over 50% of patients . the presence of fever with a pancreatic mass , as in our case , favors tb ; however , malignant lymphoma should also be considered in such a clinical situation . most common location of ppt as a mass has been reported in the head or body as in our cases ; however , occasionally isolated involvement of the pancreatic tail has also been described , as in one of our case . abdominal tb includes the infection of varying combinations of the intestinal tract , peritoneum , lymph nodes and solid organs such as the liver , spleen and pancreas . isolated abdominal organ involvement , especially of the pancreas , is unusual , even in the setting of miliary disease ( ranging from 2.1 to 4.7% ) . a definitive diagnosis of ppt will prevent unnecessary surgery , and in the setting of suspected malignancy will change the diagnosis to one of a treatable infection ; however , a definitive diagnosis of ppt is only achieved with histological confirmation . most patients have been diagnosed at laparotomy , however , if tb is suspected and confirmed , then surgery is not necessary , making fnac a very useful diagnostic technique . the success rate of image - guided percutaneous fnac of previous studies in diagnosing pancreatic tb is less than 50% , while our series established the diagnosis in ~70 to 86% by fna cytology . eus - fna cytology / biopsy has proven to be an excellent tool for the cytological diagnosis of pancreatic and peripancreatic masses in 80 - 95% of cases . afb were identified only in 20 - 40% of cases and culture results were positive in 77% of cases even when intraoperative specimens were sent for direct smear and culture . a study showed caseating granulomas in 75 - 100% of cases while other study of 21 consecutive patients with pancreatic / peripancreatic tb by eus - fna showed 13 patients ( 61.9% ) with granulomatous inflammation on histopathological examination , and 10 of 15 patients ( 66.7% ) were positive on a tb pcr assay . zn staining was positive in 4 of 15 patients ( 26.7% ) , and 3 of 8 patients ( 37.5% ) had cultures positive for m. tuberculosis . in a previous case report , contrast - enhanced ct abdomen in a 24-year - old male showed pancreatic head mass invading portal vein , splenic artery and hepatic artery . on eus , a pancreatic head mass infiltrating portal vein was seen . with provisional diagnosis of unresectable carcinoma of pancreas , eus - fnac it should be suspected clinically in patients with a pancreatic mass , particularly if the patient is young , not jaundiced , coming from an endemic area with a normal endoscopic retrograde cholangiopancreatography ( ercp ) . these findings are non - specific and may be seen with focal pancreatitis of any etiology , similar to pancreatic carcinoma . the imaging findings may suggest the possibility of tb , but none of the findings are pathognomic for pancreatic tb . ct scan findings include hypodense lesions and irregular borders usually in the head of the pancreas , diffuse enlargement of the pancreas or enlarged peripancreatic lymph nodes . the presence of hypodense lymph nodes with rim enhancement in the peripancreatic region , ascites and/or mural thickening affecting the ileo - cecal region may suggest the possibility of tb . mri findings of focal pancreatic tb include a sharply delineated mass located in the pancreatic head , showing heterogeneous enhancement . these lesions usually are hypointense on fat - suppressed t1-weighted images and show a mixture of hypointensity and hyperintensity on t2-weighted images . the common bile duct and the pancreatic duct have been reported to be normal in patients with pancreatic tb , even if the tuberculous mass is centrally positioned in the pancreatic head . radiological features including us , ct or endoscopic ultrasound ( eus ) usually show multicystic pancreatic masses , most frequently in the head of the pancreas . pancreatic lesions resulting from m. tuberculosis infection are often heterogeneous and multicystic and can mimic pancreatic cystic neoplasm . when the diagnosis is suspected , a detailed screening for tuberculosis and us - fna of the pancreatic lesions can confirm the diagnosis , and therefore avoid an unnecessary explorative laparotomy or pancreatic resection . the majority of cases of pancreatic tb respond well to 6 - 12 months of att and their prognosis is good . us - guided fna was performed in pancreatic head mass in a 31-year - old female with history of hiv positivity , and 50 ml of purulent , turbid fluid was aspirated . zn stain revealed afb in the smears . a series of three eus - guided fna ppt cases and review of current literature on clinical presentation , diagnostic dilemmas and the role of eus were studied . authors concluded that endoscopic ultrasound is the diagnostic modality of choice for pancreatic tuberculosis facilitating high resolution imaging , as well as sampling of tissue for staining , cytology , culture and polymerase chain reaction assay . ct - guided fna in two female cases was done with history of epigastric pain radiating to back , and smears revealed caseous necrosis with positive afb on zn staining . earlier single case reports showed epithelioid cell granulomas and smears were positive for afb in zn stain . pcr is a recent diagnostic - based assay test which detects m. tuberculosis dna in the resected specimens . it is a highly specific assay and may give a positive result even when special staining techniques and culture of these tissues are negative . pcr was performed in 10 of our 14 cases , of which 8 cases showed m. tuberculosis dna in fna samples . these tests are more sensitive and more quickly available for definitive diagnosis , compared to microscopy and culture . all the patients showed a good response to att , except one ( drug resistant ) in our study . most cases of pancreatic tuberculosis respond well to att as a primary treatment or after surgery , with isoniazid / rifampin / pyrazinamide / ethambutol or streptomycin for 6 - 12 months , as in our cases . twelve of 14 cases showed good response to att in our study , except 2 in which one case was lost to follow - up and other one was drug resistant . the approach for noninvasive diagnostic techniques in pancreatic tb relies mainly on us and ct abdomen . ct scan findings reveal hypodense lesions and irregular borders mostly in the head of the pancreas , diffuse enlargement of the pancreas or enlarged peripancreatic lymph nodes . in contrast to noninvasive techniques , invasive diagnostic techniques like eus - guided biopsy , ct / us - guided percutaneous biopsy and surgical biopsy ( open or laparoscopic ) are more reliable and definitive for microbiological and pathological examination . us - fnac is a safe , reliable and cost - effective method for preoperative diagnosis of ppt . clinical symptoms and accurate diagnostic approach by us - fnac of ppt are the primary techniques which are needed to avoid performing redundant laparotomy . despite its rarity , ppt should be considered for differential diagnosis of pancreatic and peripancreatic cystic mass in endemic developing countries . | background : pancreatic and peripancreatic tuberculosis is an extremely uncommon disease , presenting as hypoechoic mass on ultrasonography and imaging mimicking malignancy .
consequently , it represents a diagnostic challenge.aims:to study 14 unusual cases of pancreatic and peripancreatic tuberculosis undergoing ultrasound-/endoscopic - guided fine - needle aspiration cytology ( fnac ) in the 5-year period from 2006 to 2010.materials and methods : endoscopic - guided fnac was done in two cases , while ultrasound - guided fnac was performed in 12 cases using 22-g needles via a percutaneous transabdominal approach .
the aspirated material was quickly smeared onto glass slides , air dried , and wet fixed in 95% ethyl alcohol for subsequent papanicolaou staining.results:all pancreatic and peripancreatic tuberculosis cases showed solid - cystic pancreatic mass .
smears showed epithelioid cell granulomas , multinucleated giant cells , mixed inflammatory cells and histiocytes against a necrotic background .
the common anatomic locations were the head , peripancreatic , tail and body of the pancreas.conclusions:ultrasound-/endoscopic-guided fnac is a safe , reliable and cost - effective method for preoperative diagnosis of pancreatic and peripancreatic tuberculosis .
clinical symptoms and accurate diagnostic approach by ultrasound-/endoscopic - guided fnac of pancreatic and peripancreatic tuberculosis is needed to avoid performing redundant laparotomy . despite its rarity ,
pancreatic and peripancreatic tuberculosis should be considered for differential diagnosis of pancreatic and peripancreatic cystic mass in endemic developing countries . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
chronic obstructive pulmonary disease ( copd ) refers to an irreversible progressive disease
that occurs due to damage in the alveolar duct wall and inflammation in the respiratory
tract1 . consequently ,
the disease can affect normal daily life and functional conditions , thereby imposing an
adverse effect on daily activities . patients with copd experience degradation of basic daily
activities as a result of respiration symptoms ( e.g. , shortness of breath , cough , and
sputum ) , general symptoms ( e.g. , fatigue , sleep disorders , and memory loss ) , as well as
psychological problems ( e.g. , depression due to deterioration of functional status)3,4,5 . thus , it is necessary for patients with
copd to have a treatment plan that maintains independence of physical and social functional
performance while alleviating symptoms such as shortness of breath ( one of the main symptoms
of copd ) , and increases participation in daily activities to prevent degradation of
independence5 . medication and
non - pharmacologic therapy including respiration rehabilitation interventions , have been used
to treat patients with copd6 . a respiration rehabilitation program is a client - oriented custom - made program for patients
and guardians . it is executed in accordance with client conditions and administered using an
interdisciplinary approach in order to enhance quality of life , reduce depression , increase
participation in daily activities through respiration function recovery , increase
respiration muscle strength , and mitigate shortness of breath6,7,8,9 . previous studies have shown
that most respiration rehabilitation programs for patients with copd improved the quality of
life and strength of respiration muscles6,7,8 , but
few studies15 , 19 have been conducted to determine the impact of the disease on sleep
quality ( which is one of the main symptoms associated with shortness of breath and/or
coughing ) , instrumental activities of daily living , or satisfaction with leisure , which are
important indices for rehabilitation . thus , this study aimed to determine the effect of a
respiration rehabilitation program on quality of sleeping , instrumental activities of daily
living , and satisfaction of leisure among patients with copd . this study was approved by the institutional review board of kaya university ( kaya
irb-117 ) . subjects participated in this study after receiving an explanation of the purpose
of the study and provided their written consent , in accordance with the ethical principles
of the declaration of helsinki , good clinical practices , and applicable laws and
regulations . the subjects recruited for this study were 20 outpatients ( 16 males and 4
females ) aged between 50 and 70 years , who visited two general hospitals in seoul and were
diagnosed as having copd by respiration specialists at the hospitals . the mean age , height ,
and weight of the subjects were 60.2 4.7 years , 166.0 7.7 cm , and 60.2 4.7 kg ,
respectively . their measured body mass index ( bmi ) was 22.0 2.7 , forced expiratory volume
in the first second ( fev1 ) was 61.4 6.0 l , and forced expiratory volume in 1 s as a
percentage of predicted ( % fev1 ) was 55.6 6.3 . their scores on the medical research council
( mrc ) scale ( for measuring breathing difficulty ) was 2.4 0.7 , and their metabolic
equivalents ( mets ) were estimated as 3.6 0.9 ( table
1table 1.the general characteristics of the subjects ( n=20)categoriesitemsmean sdgendermale16 ( 80.0)female4 ( 20.0)ages ( yrs)61.0 5.1height ( cm)166.0 7.7weight ( kg)60.2 4.7bmi ( kg / m)22.0 2.7%fev1.0 ( % ) 61.4 6.0%fev1.0/fvc ( % ) 55.6 6.3mrc scale2.4 number of subjects , % of subjects subjects were given one or more medications to treat copd , resulting in stabilization of
their condition without severe problems . the respiration rehabilitation program was
conducted for 50 minutes per session , three times a week , for 12 weeks , according to the
respiration rehabilitation instructions of korea9 . based on the patients conditions , the respiration rehabilitation
program included breathing training , expectoration , aerobic exercise ( 20 mins ) , muscle
strengthening of upper and lower extremities ( 10 mins ) , strengthening of the respiration
muscles ( 10 mins ) , daily life training , and energy preservation . subjects were required to
provide voluntary written consent in order to participate in this study . to determine the
effect of the therapeutic intervention , instrumental activities of daily living were
assessed using the frenchay activity index ( fai)10 . satisfaction with leisure was determined through the leisure
satisfaction scale , which was originally developed by beard and raghed11 and later developed and validated as the korean leisure
satisfaction scale by kim12 . determination of the quality of sleep was based on the korean version of the pittsburgh
sleep quality index ( psqi - k)13 , which was
is a korean version of based on the pittsburgh sleep quality index ( psqi)14 . the psqi was originally developed by
buysse et al.14 , and later translated and
validated by sohn et al.13 as a reliable
measure of the quality of sleep . all the measurements , including the general questions and
answers provided by the subjects , were scored and statistically analyzed using the spss / win
statistical program 21.0 . the paired sample t - test was conducted to determine whether the
respiration rehabilitation program was effective at improving satisfaction with leisure , and
instrumental activities of daily living after the program intervention . with respect to differences in instrumental activities of daily living ( iadl ) , subjects
showed overall statistically significant improvements in all activities after the
intervention ( p<0.05 ) . specifically , completion of domestic chores increased from 8.3
0.8 to 9.1 0.9 after the intervention ; leisure increased from 6.5 0.5 to 9.6 1.8 after
the intervention , and outdoor activity increased from 6.4 0.5 to 8.4 2.7 . the total
score increased from 21.2 1.5 to 27.0 4.1 , which was statistically significant ( table 2table 2.comparison of the pre- and post - test values of iadl , satisfaction with leisure ,
and sleep qualitycategoriespre - testpost - test iadldomestic chores8.3 0.89.1 0.9*leisure / work6.5 0.59.6 1.8**outdoor activities6.4 0.58.4 2.7*total21.2 1.527.0 4.1**leisure satisfaction psychological2.1 0.72.7 0.7*relaxation2.1 0.72.5 0.6*aesthetic2.3 0.92.6 0.7social2.4 0.82.5 0.8educational2.5 1.02.8 0.9*physiological2.7 1.13.0 0.9*total14.1 4.215.9 3.3*sleep qualitytotal8.5 0.66.7 1.1***p<0.05 , * * p<0.001 mean sd . iadl : instrumental activities of
daily living the score for satisfaction with leisure increased in the aesthetic and social areas after
the intervention , but the differences were not statistically significant . on the other hand ,
the total score for quality of sleep decreased from 8.5 0.6 before the intervention , to
6.7 1.1 after the intervention , indicating that the quality of sleep was improved the
intervention ( table 2 ) . this study was a pre- and post - intervention evaluation of the benefits of a respiration
rehabilitation program , which was conducted three times a week for 12 weeks . the purpose of
this study was to determine the effect of the program on instrumental activities of daily
living , satisfaction with leisure , and quality of sleep of patients with copd . the goal was
to generate basic data that can be utilized in clinics to improve the benefits of
respiration rehabilitation programs for patients with respiration diseases in the
future . patients with copd experience adverse impacts on daily activities such as social
participation , mainly due to respiration insufficiency . measurements of instrumental
activities of daily living showed that subjects had higher scores of instrumental activities
such as household duties , leisure , and outdoor activities after the intervention than before
the intervention . these results are consistent with a study by xiang et al.15 , who reported that patients with copd who
participated a respiration rehabilitation program ( including medical and psychological
interventions ) improved their instrumental activities of daily living in areas such as
telephone use , shopping , public facility use , and financial management . our results are also
consistent with those of a previous study by merida et al.16 , who reported that 25 patients with copd who participated in a
respiration rehabilitation program involving daily living exercise for 4 weeks , to improve
respiration functions , showed improvements in their scores for instrumental activities of
daily living after the intervention . a recent study found that an experimental group of 12 patients with copd ( aged
66 years or older ) , who participated in a 12-week multidisciplinary rehabilitation program
involving exercise , nutrition , and self - management and training , showed a greater
improvement in their satisfaction with leisure ( using functional satisfaction ) than an
age - matched control group who did not participate in the program ( from 4.6 ( 2.2 ) to 6.0 (
2.1 ) scores , p<0.001)17 . in a study by
walker et al.18 , an experimental group of
23 patients with copd and an age - matched control group of 18 patients participated in a
respiration rehabilitation program involving lower extremity movements for 3 days , and the
authors found that there was a weak correlation between lower extremity movements and
satisfaction with leisure , and that satisfaction with leisure ( evaluated using the
nottingham extended activities of daily living questionnaire ) significantly improved after
the intervention from 16.4 to 18.2 scores , p<0.001 . this result suggests that
satisfaction with leisure is not significantly correlated with lower extremity movements
such as walking although the improvement with lower extremity function had a significant
effect with satisfaction with leisure , consistent with our finding that an exercise program
involving upper and lower extremities positively affected satisfaction with leisure . furthermore , the conducting a respiration rehabilitation program for patients with copd can
improve their quality of sleep that is otherwise adversely affected by difficulty with
breathing . mcdonnell et al.19 reported
that after patients with copd had participated in a respiration rehabilitation program for 8
weeks , their score for quality of sleep declined reduced to below the baseline , but the psqi
index did not decrease to 5 points or less , implying that the program did not positively
influence the quality of sleep . soler et al.20 reported that for 46 patients with copd who participated in a
respiration rehabilitation program , the total score for quality of sleep declined but not to
5 points or less , which would have indicated a good quality of sleep . nonetheless , the
results of the soler et al . study20 are
consistent with those of the present study , in which the score for quality of sleep had
declined after the respiration rehabilitation program had been conducted , although the
reduction in the score did not translate into an improvement in quality of sleep . it is
worth noting , however , that while the present study had a 1.8-point reduction in the quality
of sleep score , mcdonnell et al.19
reported a 0.79-point reduction in the experimental group , whereas soler et al.20 reported a 1.1-point reduction in the
score for quality of sleep . interestingly , the studies both mcdonnell et al.19 and soler et al.20 had intervention periods of 8 weeks ( in contrast to 12
weeks in the present study ) , which might explain the smaller reduction in the score . thus ,
it may be necessary to conduct a long - term intervention in order to achieve a more positive
effect of the respiration rehabilitation program on quality of sleep . the results of the present study show that a respiration rehabilitation intervention was
effective for improving instrumental activities of daily living , satisfaction with leisure ,
and quality of sleep . therefore , based on our findings , it is our opinion that future
research should be dedicated to the creation of facilities where the psychological and
social health of patients with respiration diseases are promoted , and where respiration
rehabilitation programs can be continuously performed tailored to of individual demands and
activity levels within families and society as a whole . | [ purpose ] this study was designed to determine the effect of a respiration rehabilitation
program on daily activities , satisfaction with leisure , and quality of sleep of patients
with chronic obstructive pulmonary disease .
[ subjects and methods ] the program was
conducted three times a week for 12 weeks ( a total of 36 times ) with 20 patients aged
between 50 and 70 years old .
the frenchay activity index was used to determine the
instrumental activities of daily living before and after the intervention .
the korean
scale of satisfaction with leisure was employed to determine the satisfaction with
leisure , and the korean version of the pittsburgh sleep quality index was used to measure
the quality of sleep . [ results ] the total score of all three instruments ( instrumental
activities of daily living ( iadl ) , satisfaction with leisure , and quality of sleep )
improved significantly after the intervention .
[ conclusion ] in conclusion , the scores of
all three instruments ( iadl , satisfaction with leisure , and quality of sleep ) improved
significantly after the intervention , indicating that the respiration rehabilitation
program was effective at improving the overall quality of life for patients with chronic
obstructive pulmonary disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
central venous catheterization is a simple , relatively inexpensive method of assessing a patient 's circulating blood volume , cardiac status , and vasomotor tone and is an essential component of modern - day critical care . although it is relatively safe , numerous complications are described both during placement and in the maintenance of the catheter . however , the possibility of entering smaller tributaries of the central veins is often forgotten and only rarely reported . there is only one incidence of misdirected catheter in the smaller tributary of 2104 central venous catheterizations according to muhm et al . this report of two cases illustrates a rare malposition of a central venous catheter tip in a small tributary of left brachiocephalic vein . a 38-year - old female was admitted to our critical care unit with a diagnosis of leptospirosis and complicated malaria . the possibility of fluid overload was considered , and it was decided to place a central venous catheter for monitoring of central venous pressure after intubation . a 7-french triple lumen central venous catheter was placed through the left internal jugular vein ( ijv ) due to failed right ijv cannulation with all aseptic precautions by using the seldinger technique . the catheter was fixed at the 13-cm mark at the skin level after free aspiration of venous blood . after flushing the catheter with heparinized saline , opening central venous pressure ( cvp ) was noted as 3 mmhg . on connecting the transducer to the monitor , it was observed that a characteristic waveform was absent . the central venous waveform could not be obtained despite the change of the transducer , the cable , flushing the unit , and repeated zeroing . an anteroposterior chest radiograph , obtained to confirm the position of the catheter , revealed the left paramedian location of the catheter following the aortic knuckle and pointing medially [ figure 1 ] . the catheter was removed , as it was considered to be in one of the small tributaries of left brachiocephalic vein and an alternate venous access was obtained subsequently via the right subclavian vein . note the left paramedian location of the central venous catheter beside the aortic knuckle a 45-year - old male patient was brought to the emergency room with unconsciousness and hemodynamic instability with a background history of distal renal tubular acidosis . in view of the clinical condition of the patient and the need to know intravascular volume status , a 7-french triple lumen central venous catheter was inserted in the left ijv due to failed right ijv cannulation in the emergency room by using the seldinger technique . all the three ports were checked for free flow of blood and the catheter was fixed at the 13-cm mark at the skin level . opening cvp was 5 cm , but the central venous waveform could not be obtained despite the change of the transducer , the cable , flushing the unit , and repeated zeroing . an anteroposterior chest radiograph , obtained subsequently to confirm the position of the catheter , revealed the left paramedian location of the catheter following the aortic knuckle and pointing laterally [ figure 2 ] . the catheter was removed and an alternate venous access was obtained subsequently via the right subclavian vein . a 38-year - old female was admitted to our critical care unit with a diagnosis of leptospirosis and complicated malaria . the possibility of fluid overload was considered , and it was decided to place a central venous catheter for monitoring of central venous pressure after intubation . a 7-french triple lumen central venous catheter was placed through the left internal jugular vein ( ijv ) due to failed right ijv cannulation with all aseptic precautions by using the seldinger technique . the catheter was fixed at the 13-cm mark at the skin level after free aspiration of venous blood . after flushing the catheter with heparinized saline , opening central venous pressure ( cvp ) was noted as 3 mmhg . on connecting the transducer to the monitor , it was observed that a characteristic waveform was absent . the central venous waveform could not be obtained despite the change of the transducer , the cable , flushing the unit , and repeated zeroing . an anteroposterior chest radiograph , obtained to confirm the position of the catheter , revealed the left paramedian location of the catheter following the aortic knuckle and pointing medially [ figure 1 ] . the catheter was removed , as it was considered to be in one of the small tributaries of left brachiocephalic vein and an alternate venous access was obtained subsequently via the right subclavian vein . a 45-year - old male patient was brought to the emergency room with unconsciousness and hemodynamic instability with a background history of distal renal tubular acidosis . in view of the clinical condition of the patient and the need to know intravascular volume status , a 7-french triple lumen central venous catheter was inserted in the left ijv due to failed right ijv cannulation in the emergency room by using the seldinger technique . all the three ports were checked for free flow of blood and the catheter was fixed at the 13-cm mark at the skin level . opening cvp was 5 cm , but the central venous waveform could not be obtained despite the change of the transducer , the cable , flushing the unit , and repeated zeroing . an anteroposterior chest radiograph , obtained subsequently to confirm the position of the catheter , revealed the left paramedian location of the catheter following the aortic knuckle and pointing laterally [ figure 2 ] . the catheter was removed and an alternate venous access was obtained subsequently via the right subclavian vein . the correct placement of the central venous catheter tip is an important factor in obtaining accurate cvp measurements . inaccurate cvp measurements or inability to obtain an ideal wave from tracing are suggestive of an undesirable location of the catheter tip . unusual tachycardia during infusion or flushing through central port may also suggest thoracic pain syndromes described by webb et al . due to inexperience , malposition of the catheter tip may occur at the time of insertion or later as a result of spontaneous migration due to anatomic positioning or pressure changes within the thoracic cavity . because of the longer course and more transverse lie of the left brachiocephalic and more frequent smaller tributaries , malposition of the venous catheter is commoner when cannulation attempt is made via the left brachiocephalic vein rather than its right - sided counterpart . in this report both the cannulations were done through left internal jugular vein because there is failed right ijv cannulation . on lateral chest films , the internal mammary vein will lie in the anterior mediastinum and the pericardiophrenic vein in the middle mediastinum , while the superior intercostal vein will occupy the posterior mediastinal position . the most common locations for the malposition of venous catheters while attempting to cannulate the internal jugular vein include the internal mammary vein and the pericardiophrenic vein . on posterior -- anterior or anterior -- posterior views , the internal mammary vein will be located more laterally , catheter in the superior intercostal vein will follow the aortic knob , and pericardiophrenic vein catheter will follow the left cardiac border . so in our case 1 , the catheter tip may be in pericardiophrenic vein , and in case 2 the small tributary may be the superior intercostal vein . a lateral film would have been helpful in distinguishing these possibilities but was inconclusive in case 1 and could not be done in the second case as the patient was unstable . a venogram could have established the exact location of the catheter beyond any doubt . but both the patients were renally compromised , and so the use of dye was contraindicated . so the take - home message is that when the central venous waveform could not be obtained despite the change of the transducer , the cable , flushing the unit , and repeated zeroing , a strong suspicion of misplacement of central venous catheter tip into a smaller tributary to be kept in mind . the ability to aspirate blood freely from the catheter lumen after the placement of the catheter does not necessarily confirm a proper placement of the catheter tip . the use of chest radiographs to establish the correct placement of central neck lines is to be routinely practiced . it would be a good practice to have a lateral view to confirm the central neck line placement when the anteroposterior view is not reassuring . we recommend a computed tomography scan of the thorax or venography to assess the position of the catheter in case of radiological dilemma . | erroneous positioning of central venous catheters in small tributaries of large central veins is a rare occurrence .
we describe two such unusual incidents involving cannulation of the small tributaries of left brachiocephalic vein .
malposition was suspected when the central venous waveform could not be obtained despite all attempts .
unusual central venous waveforms may indicate central venous catheter malposition , and these waveforms have not previously been described . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
before the introduction of diffusion tensor imaging ( dti ) , accurate evaluation of the ascending reticular activating system ( aras ) in the live human brain was limited . recently , diffusion tensor tractography ( dtt ) , which is derived from dti , has enabled 3-dimensional reconstruction and estimation of the aras in the human brain . as a result , a few recent studies using dtt have reported on injury of the aras in patients with severe traumatic brain injury ( tbi ) . however , no study on injury of the aras in patients with mild tbi has been reported . the pathogenetic mechanism of post - traumatic fatigue and hypersomnia has not been clearly elucidated , although several studies have suggested an injury of the brainstem or aras . in the present study , using dtt , we report on patients with post - traumatic fatigue and hypersomnia who showed injury of the dorsal ( between the pontine reticular formation [ rf ] and the intralaminar thalamic nucleus [ iln ] ) and ventral ( between the pontine rf and the hypothalamus ) lower portion of the aras following mild tbi . two patients were enrolled according to the following inclusion criteria : ( 1 ) loss of consciousness ( loc ) for 30 min or less , post - traumatic amnesia ( pta ) for < 24 h and glasgow coma scale ( gcs ) score of 13 to 15 recorded 30 min postinjury or later upon presentation for health care , ( 2 ) notify hypersomnia and fatigue since the onset of tbi , ( 3 ) no visible lesion on t1-weighted , t2-weighted , fluid attenuated inversion recovery , and t2-weighted gradient recall echo images , and ( 4 ) no history of previous head trauma . all patients provided signed , informed consent , and yeungnam university hospital institutional review board approved the study protocol . patient 1 was a 51-year - old woman who had suffered head trauma resulting from a car accident . while driving her sedan , the driver side of her car collided with a mini - bus ; consequently , her head hit the car seat . the patient showed loc ( 5 min ) or pta ( 10 min ) at the time of head trauma , and her gcs was 15 when she arrived at the hospital . at the time of dti scanning ( 11 months after onset ) , she showed abnormalities as 6.9 ( cut off : 3.7 points ) and 18 ( cut off : 10 ) , respectively , on the fatigue severity scale and the epworth sleepiness scale . patient 2 was a 64-year - old woman who had suffered head trauma resulting from a car accident . while driving in a passenger seat of a sedan , her car was hit from front by a sedan . as a result , her gcs score was 15 when she arrived at the hospital . at the time of dti scanning ( 3 months after onset ) , she showed abnormalities on the fatigue severity scale and the epworth sleepiness scale with 6.8 ( cut off : 3.7 points ) and 19 ( cut off : 10 ) , respectively . diffusion tensor imaging data were acquired at 11 months ( patient 1 ) and 3 months ( patient 2 ) after onset of head trauma using a 1.5 t with 32 noncollinear diffusion sensitizing gradients by single - shot echo - planar imaging . imaging parameters were as follows : acquisition matrix = 96 96 ; reconstructed to matrix = 192 192 ; field of view = 240 240 mm ; tr = 10,398 ms ; te = 72 ms ; parallel imaging reduction factor = 2 ; echo - planar imaging factor = 59 ; b = 1000 s / mm ; and a slice thickness of 2.5 mm . the oxford centre for functional magnetic resonance imaging of the brain ( fmrib ) software library was used for analysis of dti data . fmrib diffusion software with routines option ( 0.5 mm step lengths , 5000 streamline samples , curvature thresholds = 0.2 ) was used for fiber tracking . three portions of the aras were reconstructed by selection of fibers passing through region of interest ( roi ) as follows : the dorsal lower aras , between the pontine rf ( roi 1 ) and the iln ( roi 2 ) , the ventral lower aras , between the pontine rf ( roi 1 ) and the hypothalamus ( roi 2 ) , and the upper aras , in which the neural connectivity of the iln ( roi 1 ) to the cerebral cortex was analyzed . the tract volume and the narrowest area of dorsal and ventral lower aras were measured by counting voxels . in both patients , the upper aras in which the neural connectivity of the iln to the cerebral cortex did not show significant abnormalities . however , we observed the narrowing of the left dorsal lower aras between the pontine rf and the iln in both patients and the tearing ( patient 1 ) and narrowing ( patient 2 ) of the left ventral lower aras between the pontine rf and the hypothalamus . the tract volume of the dorsal and ventral lower aras were 280/322 ( right ) and 149/172 ( left ) voxels in the patient 1 , and 320/201 ( right ) and 185/49 ( left ) voxels in the patient 2 . in addition , compared with the right hemisphere ( 100% ) , the narrowest area of left hemisphere in the dorsal and ventral lower aras on an axial slice were as follows the patient 1 : 7 voxels ( 29.2% , right : 24 voxels ) and 11 voxels ( 26.8% , right : 41 voxels ) , and the patient 2 : 15 voxels ( 33.3% ) , right : 45 voxels ) and 3 voxels ( 15% , right:20 voxels ) ( figure 1 ) . ( a ) t2-weighted brain mr images at 11 months ( patient 1 ) and 3 months ( patient 2 ) after onset show no abnormal lesion . the narrowing ( red arrows ) of the left dorsal lower ascending reticular activating system ( aras ) between the pontine reticular formation and intralaminar thalamic nucleus in both patients , and the tearing ( patient 1 , green arrow ) and narrowing ( patient 2 , green arrows ) of the left ventral lower aras between the pontine reticular formation and the hypothalamus are observed compared with the right side of each patient and both sides of a normal subject ( 45 year - old woman ) . aras = ascending reticular activating system , dtt = diffusion tensor tractography , iln = intralaminar thalamic nucleus , mr = magnetic resonance , prf = pontine reticular formation . two patients were enrolled according to the following inclusion criteria : ( 1 ) loss of consciousness ( loc ) for 30 min or less , post - traumatic amnesia ( pta ) for < 24 h and glasgow coma scale ( gcs ) score of 13 to 15 recorded 30 min postinjury or later upon presentation for health care , ( 2 ) notify hypersomnia and fatigue since the onset of tbi , ( 3 ) no visible lesion on t1-weighted , t2-weighted , fluid attenuated inversion recovery , and t2-weighted gradient recall echo images , and ( 4 ) no history of previous head trauma . all patients provided signed , informed consent , and yeungnam university hospital institutional review board approved the study protocol . patient 1 was a 51-year - old woman who had suffered head trauma resulting from a car accident . while driving her sedan , the driver side of her car collided with a mini - bus ; consequently , her head hit the car seat . the patient showed loc ( 5 min ) or pta ( 10 min ) at the time of head trauma , and her gcs was 15 when she arrived at the hospital . at the time of dti scanning ( 11 months after onset ) , she showed abnormalities as 6.9 ( cut off : 3.7 points ) and 18 ( cut off : 10 ) , respectively , on the fatigue severity scale and the epworth sleepiness scale . patient 2 was a 64-year - old woman who had suffered head trauma resulting from a car accident . while driving in a passenger seat of a sedan , her car was hit from front by a sedan . as a result , her gcs score was 15 when she arrived at the hospital . at the time of dti scanning ( 3 months after onset ) , she showed abnormalities on the fatigue severity scale and the epworth sleepiness scale with 6.8 ( cut off : 3.7 points ) and 19 ( cut off : 10 ) , respectively . diffusion tensor imaging data were acquired at 11 months ( patient 1 ) and 3 months ( patient 2 ) after onset of head trauma using a 1.5 t with 32 noncollinear diffusion sensitizing gradients by single - shot echo - planar imaging . imaging parameters were as follows : acquisition matrix = 96 96 ; reconstructed to matrix = 192 192 ; field of view = 240 240 mm ; tr = 10,398 ms ; te = 72 ms ; parallel imaging reduction factor = 2 ; echo - planar imaging factor = 59 ; b = 1000 s / mm ; and a slice thickness of 2.5 mm . the oxford centre for functional magnetic resonance imaging of the brain ( fmrib ) software library was used for analysis of dti data . fmrib diffusion software with routines option ( 0.5 mm step lengths , 5000 streamline samples , curvature thresholds = 0.2 ) was used for fiber tracking . three portions of the aras were reconstructed by selection of fibers passing through region of interest ( roi ) as follows : the dorsal lower aras , between the pontine rf ( roi 1 ) and the iln ( roi 2 ) , the ventral lower aras , between the pontine rf ( roi 1 ) and the hypothalamus ( roi 2 ) , and the upper aras , in which the neural connectivity of the iln ( roi 1 ) to the cerebral cortex was analyzed . the tract volume and the narrowest area of dorsal and ventral lower aras were measured by counting voxels . in both patients , the upper aras in which the neural connectivity of the iln to the cerebral cortex did not show significant abnormalities . however , we observed the narrowing of the left dorsal lower aras between the pontine rf and the iln in both patients and the tearing ( patient 1 ) and narrowing ( patient 2 ) of the left ventral lower aras between the pontine rf and the hypothalamus . the tract volume of the dorsal and ventral lower aras were 280/322 ( right ) and 149/172 ( left ) voxels in the patient 1 , and 320/201 ( right ) and 185/49 ( left ) voxels in the patient 2 . in addition , compared with the right hemisphere ( 100% ) , the narrowest area of left hemisphere in the dorsal and ventral lower aras on an axial slice were as follows the patient 1 : 7 voxels ( 29.2% , right : 24 voxels ) and 11 voxels ( 26.8% , right : 41 voxels ) , and the patient 2 : 15 voxels ( 33.3% ) , right : 45 voxels ) and 3 voxels ( 15% , right:20 voxels ) ( figure 1 ) . ( a ) t2-weighted brain mr images at 11 months ( patient 1 ) and 3 months ( patient 2 ) after onset show no abnormal lesion . ( b ) the narrowing ( red arrows ) of the left dorsal lower ascending reticular activating system ( aras ) between the pontine reticular formation and intralaminar thalamic nucleus in both patients , and the tearing ( patient 1 , green arrow ) and narrowing ( patient 2 , green arrows ) of the left ventral lower aras between the pontine reticular formation and the hypothalamus are observed compared with the right side of each patient and both sides of a normal subject ( 45 year - old woman ) . aras = ascending reticular activating system , dtt = diffusion tensor tractography , iln = intralaminar thalamic nucleus , mr = magnetic resonance , prf = pontine reticular formation . in the present study , using dtt , we evaluated the 3 portions of the aras : the upper aras in which the neural connectivity of the intralaminar thalamic nucleus to the cerebral cortex , the dorsal lower aras , between the pontine rf and the iln , and the ventral lower aras , between the pontine rf and the hypothalamus . we found that the dorsal and ventral lower aras was torn or narrowed in both patients . the post - traumatic fatigue and hypersomnia in these patients might be mainly attributed to the injury of the left dorsal and ventral lower aras . since introduction of dti , a few studies have reported on injury of the aras in patients with tbi . in 2013 , edlow et al ( 2013 ) reported on a patient with coma following severe tbi who showed complete disruption of white matter pathways connecting brainstem arousal nuclei to the basal forebrain and thalamic nuclei , and partial disruption of the pathways connecting the thalamus and basal forebrain to the cerebral cortex . jang et al ( 2015 ) recently demonstrated recovery of the injured lower portion of the aras between the pontine rf and the iln in a patient with severe tbi . on the other hand , descending reticular activating system , which is involved in the generation of movement using mediating the spinal motoneurons , could also be related to the state of consciousness . in 2013 , tapia et al suggested that arousal state was related to muscular activation which was mediated by the descending reticular activating system . therefore , to the best of our knowledge , this is the first study to demonstrate injury of the lower portion of the aras between the pontine rf and the iln in patients with mild tbi . first , because it is a case report , this study is limited ; therefore , conduct of further studies comprising a large number of patients would be necessary . second , despite being a powerful anatomic imaging tool , because regions of fiber complexity and crossing can prevent full reflection of the underlying fiber architecture , dti may underestimate or overestimate the fiber tracts . in conclusion , this study demonstrated injuries of the dorsal and ventral lower portions of the aras in patients with fatigue and hypersomnia following mild tbi . we believe that these injuries of the aras might be a pathogenetic mechanism of fatigue and hypersomnia in patients with tbi . | abstractwe report on patients with post - traumatic fatigue and hypersomnia who showed injury of the lower portion of the ascending reticular activating system ( aras ) between the pontine reticular formation ( rf ) and the intralaminar thalamic nucleus ( iln ) following mild traumatic brain injury ( tbi ) , using diffusion tensor tractography ( dtt).two patients with mild tbi resulting from a car accident were enrolled in this study .
patient 1 was a 51-year - old woman showed abnormalities as 6.9 ( cut off : 3.7 points ) and 18 ( cut off : 10 ) on the fatigue severity scale and the epworth sleepiness scale at 11 months after onset .
patient 2 was a 64-year - old woman who revealed abnormalities on the fatigue severity scale and the epworth sleepiness scale with 6.8 and 19 at 3 months after onset.in both patients , the upper aras in which the neural connectivity of the iln to the cerebral cortex did not show significant abnormalities .
however , we observed the narrowing of the left dorsal lower aras between the pontine rf and the iln in both patients and the tearing ( patient 1 ) and narrowing ( patient 2 ) of the left ventral lower aras between the pontine rf and the hypothalamus.injuries of the dorsal and ventral lower aras were demonstrated in patients with fatigue and hypersomnia following mild tbi .
we believe that these injuries of the aras might be a pathogenetic mechanism of fatigue and hypersomnia in patients with tbi . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the patient was a known case of seizure disorder , with an onset at an age of 2 years . the child received antiepileptic medications after which seizures were well - controlled , but the medications were discontinued by the parents . the patient had associated developmental delay and had frequent recurrences of seizures . during this episode , before presenting to our hospital , the child received treatment at two institutions . a loading dose of injectable phenytoin ( 20 mg / kg followed by 10 mg / kg ) was given at both hospitals without checking the previous records . cerebrospinal fluid examination report presented was normal ( phenytoin levels were not done ) . on examination , the patient was treated with injectable valproate , and seizures were controlled . a magnetic resonance imaging ( mri ) of the brain was performed which revealed a lobulated mass likely to be hamartoma ( old lesion ) . serum phenytoin levels were very high ( 56 g / ml ) , and a diagnosis of phenytoin - induced encephalopathy was established . causality analysis was done using the world health organization - uppsala monitoring center causality categories showed probable / likely association . according to the hartwig severity assessment scale , the event was level 4 . further , as per the naranjo algorithm , the event has a score of 6 which is probable adverse drug reaction . the patient regained consciousness on the next day and was active and playful without any neurodeficit . a repeat mri was advised to know about fate of intracranial mass ( hamartoma ) but was refused by the parents . any drug has potential for toxicity which may occur due to errors in prescribing , dispensing , or administration and/or increase in doses and/or change in brands / formulations of the drug . phenytoin toxicity can be precipitated by an acute overdose , altered physiological state in disease conditions , interindividual variability , drug interactions , and genetic mutations in the cytochrome p450 enzyme . the well - known manifestations of phenytoin overdose are nausea , vomiting , dizziness , vertigo , and lethargy . altered mental status , confusion , slurring of speech , nystagmus , diplopia , ataxia , and dystonia are neurotoxic features that have been reported . rapid intravenous dosing may lead to cardiac toxicities such as hypotension and arrhythmias which may be fatal . phenytoin is primarily metabolized in the liver by parahydroxylation , followed by glucuronic acid conjugation . the metabolism of phenytoin is complex and follows the first - order kinetics at low doses ; however , after saturation of the enzyme , it changes to zero - order kinetics . the therapeutic dose of phenytoin is a loading dose of 20 mg / kg , followed by 58 mg / kg / day as a maintenance dose . the therapeutic level is very narrow ( 1020 g / ml ) and the toxicity manifests above the levels > 20 g / ml . levels > 50 g / ml are associated with a high risk of mortality . our patient received the injectable dose twice with a cumulative dose of 60 mg / kg over a short span of 12 h , resulting in acute toxicity . this case highlights the importance of scrutiny of medical records prior to initiating treatment in sick children . as the patient had received treatment at multiple institutions , the further course of action should have been initiated after a thorough check of previous records . uncommon adverse reactions and drug toxicity should also be considered , in cases where common etiologies are unable to explain the clinical condition . it should be remembered that every drug has a potential of toxicity and uncommon adverse effects are also encountered in clinical practice . | phenytoin is a commonly used antiepileptic medication in the pediatric age group , but it has a narrow therapeutic range .
various adverse effects have been reported commonly .
we report a relatively rare case of encephalopathy in a child from overdose of injectable phenytoin due to ignorance of the previous treatment .
scrutiny of medical records and history is of utmost importance while administering such medications . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a 52-year - old woman sought treatment for decreased visual acuity of 1 month in the right eye . the patient was previously treated with radial mastectomy and chemotherapy 5 years ago for an invasive ductal carcinoma of the right breast . lung , liver , bone and brain metastases were found 1 year previously . on initial examination , visual acuity with correction was 0.63/0.8 ( od / os ) and intraocular pressure ( iop ) was 15/16 mmhg . right fundoscopy revealed an elevated mass - like lesion at temporal to the macule with serous retinal detachment . no choroidal lesions were observed in the left fundus.a right fluorescein angiogram revealed hypofluorescence during the prearterial and arteriovenous phase and hyperfluorescence during the venous phase . the venous phase showed nearly complete masking of background choroidal fluorescence at the elevated lesion due to leakage and neovascularization ( fig . treatment was started with diode lasers while the patient was undergoing chemotherapy in hematology ( gemzar - navelvin 4th , taxotere - cis 3rd ) . the typical settings were as follows : intensity , 300 - 400 milliwatts ; duration , 0.2 seconds ; size , 200 - 500 microns ; 250 - 300 shot per serial . the patient underwent treatment with a diode laser once a week for a total of 4 weeks . after 50 days , right funduscopy revealed mass regression in size and height and resolved retinal detachment . right fluorescein angiogram revealed a flat devascularized choroid , the venous phase showed some leakages from the old lesion that affected the fovea ( fig . the various methods for treatment of choroidal metastasis areas follows : observation , radiotherapy , laser photocoagulation , transpupillary thermotherapy , chemotherapy , and enucleation.3 radiotherapy is the preferred modality for local treatment of an ocular tumor . although shown to be very effective , 3 to 4 weeks of daily radiation treatment is necessary , which many patients with metastasis find daunting , considering the serious condition of their health.4 radiotherapy presents a risk for local complications such as cataracts , dry eye syndrome , and radiation retinopathy.3,5 according to halpern and colleagues,6 chemotherapy alone is effective in approximately one third of the cases . however , systemic therapy has side effects such as gastrointestinal manifestation , fatigue , generalized weakness , neutropenia , or cardiotoxic effects.7 laser photocoagulation yields a rapid response , is easy to perform on an outpatient basis , and is an effective therapy . levinger and colleagues,5 treated 10 eyes of 7 patients with krypton red or argon green laser applications for small choroidal breast carcinoma metastasis with serous detachment of the retina . in all eyes , the tumor decreased , the subretinal serous detachment was absorbed , the retina flattened , and the visual acuity improved without complications . the method by which the laser is effective in eradicating choroidal metastases is not clear . according to levinger and colleagues,5 the effectiveness of the laser treatment was not a result of occlusion of the retinal or choroidal blood circulation . a possible explanation for the mode of laser action is the destruction of the vasculature of the tumor . in other words , the laser closes all the blood vessels of the tumor , causing the tumor cells to die . glaser and colleagues8,9 suggested that laser treatment may effect the retina and choroid through the release of extracellular modulating factors by laser - induced chorioretinal scars including neovascularization inhibiting factors . if this theory is correct , the laser may induce destruction of the metastatic tumor by inhibition of the tumor angiogenesis , and formation of ischemia.5 in this study , diode laser photocoagulation was selected because the patient 's physical condition was poor and the laser procedure was short . consequently , the mass regressed , subretinal serous detachment was absorbed , and the visual acuity improved . laser photocoagulation does not appear to cause complications for the patient and may be an effective treatment for patients with choroidal metastasis of breast carcinoma . | to report a single case of improvement on choroidal metastasis of breast cancer after laser photocoagulation . a 52-year - old female patient who complained of visual disturbance of the right eye with multiple states of metastasis of breast carcinoma . on initial examination ,
the right best - corrected visual acuity was 0.63 .
right fundoscopy revealed an elevated mass - like lesion temporal to the macule with serous retinal detachment .
the mass had a 3.5-disc diameter . a right fluorescein angiogram revealed hypofluorescence during the prearterial and arteriovenous phase and hyperfluorescence during the venous phase .
the venous phase showed almost total masking of background choroidal fluorescence at the elevated lesion because of leakage and neovascularization .
the patient was treated 4 times by diode laser photocoagulation in addition to chemotherapy .
fifty days after the diode laser treatments , the funduscopy examination and fluorescein angiogram revealed that the serous retinal detachment had been absorbed , the choroid had become flat , the lesion had been reduced in size and hyperfluorescence .
the right best - corrected visual acuity was improved to 0.8 .
laser photocoagulation appears not to cause any problems for the patient and may be an efficient treatment for patients with choroidal breast carcinoma . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
bombesin ( bb ) is a linear tetradecapeptide with the sequence glu - gln - arg - leu - gly - asn - gln - trp - ala - val - gly - his - leu - met - nh 2 first isolated from the skin of the european frog bombina bombina . bombesin and the corresponding mammalian peptides gastrin - releasing peptide ( grp ) and neuromedin b ( nmb ) exert a variety of physiological actions in the nervous system and the gut . these actions are elicited after binding to g - protein coupled receptors which are situated at the outer membrane of target cells and comprise three members in mammals , the grp - receptor ( grp - r ) with high affinity for the grp , the nmb - receptor ( nmb - r ) with high affinity for nmb and the orphan bb 3-receptor ( bb 3-r ) , for which an endogenous ligand has not yet been identified . the role of bombesin - like peptides , and especially of grp and its interaction with the grp - r , in promoting tumour growth in human cancer cells both in culture and in nude mice xenografts has been established by numerous studies . most interestingly , the expression of grp - rs has been documented in several frequently occurring human cancers , such as in prostate and breast carcinomas . as a result , bombesin antagonists and anti - grp / grp - r antibodies have been used for treatment of grp - r - expressing malignancies . in an alternative strategy , bombesin - like peptides have been employed as molecular carriers of cytotoxic drugs or diagnostic / therapeutic radionuclides to grp - r - expressing tumours for diagnosis and therapy . for this purpose , agonists are usually preferred , due to their tendency to rapidly internalise after binding to their receptor resulting in increased target accumulation . a brief discussion will follow on the attempts so far undertaken to obtain clinically useful grp - r - targeting radiopeptides , comprising radiohalogenated , technetium , bi- and trivalent radiometal carrying groups of compounds . the prime aim of any radiopharmaceutical development programme is to produce a metabolically robust radiotracer having a well - defined structure that shows the maximal uptake in target tissues ( i.e. tumour in this instance ) and minimal uptake in normal , non - target tissues including those involved in metabolism and excretion of the tracer . in addition to selection of a receptor binding sequence and a suitable radionuclide , a labelling strategy must be developed which results in a hydrophilic conjugate that is excreted through the renal system and not the hepatobiliary / gastrointestinal tract . first attempts to radioiodinate bombesin for clinical oncology spect ( single photon emission computed tomography ) imaging applications were reported more than a decade ago . the first in vivo study in an ovarian carcinoma nude mouse model emphasised the need for using prosthetic groups for obtaining in vivo stable radioiodinated bombesins . for pet ( positron emission tomography ) studies , f with its half - life of 109.7 min and low -energy ( 0.64 mev ) represents the ideal radionuclide . the first f - bombesins were recently evaluated in mice bearing human grp - r - expressing xenografts . in view of the expanding use of pet cameras in combination with new elegant radiofluorination techniques , it is to be expected that new , improved f - based bombesins for oncological pet applications will soon appear . in view of the availability of iodinated analogues a special category of bombesin - based radiopeptides are those labelled with tc due to the preeminence of tc in diagnostic nuclear medicine . recent advances in spect technology , such as dynamic spect and/or fused spect / ct imaging , are expected to rapidly boost the evolution of tc - based bombesin radiotracers toward clinically useful compounds . by attaching the strong n 2s 2 ( dadt ) tc - binding centre to [ lys ] bb a tco -chelated analogue was obtained but this showed high radioactivity accumulation in the abdomen . by coupling dadt to [ dtpa , lys , tyr ] bb a much more hydrophilic radiotracer was obtained due to the presence of four pendant dtpa -carboxylate groups . this analogue showed good grp - r - targeting in mice and excretion via the renal pathway . neutral tc o -complexes are also obtained by coupling tripeptide n 3s - donors to bb or bb(7 - 14 ) , either directly or via a spacer . for example , tc - rp527 , a bb(7 - 14 ) analogue linked at the n - terminus via a glycine-5-aminovaleric acid spacer to the tri - peptide chelator , dimethylglycyl - l - ser - l - cys , reached a 2%id / g at 1 h pi in pc-3 xenografts in scid ( severe combined immunodeficiency ) mice . thus , coupling of air - stable hydrophilic phosphine containing p 2s 2-chelators to bb(7 - 14 ) yielded radiotracers of high receptor affinity and good grp - r - targeting in mice . alternatively , acyclic tetraamines have been coupled to both bb and bb(7 - 14 ) to afford high specific activity radiotracers which localised in high percentage in human pc-3 xenografts in nude mice ( up to 11%id / g at 1 h pi ) . in view of the toxicity risks inherent in the intravenous injection of pharmacologically active peptides in humans , an acyclic tetraamine was also coupled to the potent antagonist [ ( d)phe , leu - nhet , des - met ] bb(6 - 14 ) . the resulting radiopeptide exhibited impressively high uptake in pc-3 xenografts ( 16%id / g at 1 h pi ) in nude mice . a versatile route for labelling bombesin via the [ tc -fac-(co ) 3(h 2o ) 2 ] -synthon involved coupling of n -histidinyl - acetic or 2-picolylamine - n , n - diacetic acid to bb(7 - 14 ) . but the resulting radiopeptides failed to accumulate effectively in pc-3 xenografts in nude mice ( < 0.6%id / g at 1.5 h pi ) . however , convincingly high uptake in pc-3 xenografts ( up to 3.7%id / g at 1 h pi ) was exhibited by [ tc -fac-(co ) 3(x)-dpr-(ser ) 3]bb(7 - 14 ) analogues ( x = h 2o or p(ch 2oh ) 3 ) . these studies have resulted in the availability of clinically useful tc - labelled grp - r - specific radiotracers as described below . furthermore , owing to the similarities of technetium and rhenium chemistries these studies also assist the development of matched - pair re/ re - bombesin radiotherapeutic agents . another often used diagnostic radionuclide is the cyclotron produced in . in targeted radionuclide therapy , peptide analogues labelled with in are often used as surrogates to determine the biodistribution and dosimetry of therapeutic radiopharmaceuticals radiolabelled with bi- and trivalent metals . for this purpose , dtpa ( dtpa = diethylenetriaminepenteacetic acid ) or macrocyclic derivatives like the universal chelator dota ( dota = 1,4,7,10-tetraazacyclododecane - n , n , n , n -tetraacetic acid ) are coupled at the n - terminus of peptides . such dtpa- and dota - derivative bombesins afford very hydrophilic in - radiotracers with good in vivo grp - r - targeting in animal models . dota - derivative bombesins have been used for stable binding of therapeutic radiometals , such as y and the radiolanthanides lu , pm and sm , to achieve grp - r - targeted radiotherapy of tumours . bi- and trivalent radiometals , like cu and ga detailed published accounts of clinical imaging studies of labelled grp analogues describe the use of two such tracers . the first of these was tc - rp527 , developed by the canadian biotech company resolution pharmaceuticals inc . two papers by van de wiele have been published describing small - scale studies with this agent . a study in six normal volunteers reported the biodistribution by planar gamma camera imaging up to 48 h pi of 555 mbq of hplc purified material . the tracer showed rapid blood clearance and a mixed route of hepatobiliary and renal excretion with diffuse uptake and retention only in the normal breast in women and the testes in man . no side effects were observed and a low effective radiation dose of 0.01 msv /mbq was calculated . a second study was performed in 10 patients , four with prostate cancer and six with breast cancer . planar and spect images were acquired one and 56 h pi of 555 mbq of hplc purified material . tc - rp527 showed selective uptake in one of the four prostate cancer patients all of which had androgen - resistant disease with bone metastases . in this patient four of the six patients with breast cancer showed tumour uptake all involving lymph nodes and bone metastases . tumour identification was clearer on the later images due to a decrease in background activity over this time . normal uptake was seen in the organs of hepatobiliary and renal excretion as well as in the pancreas and normal breast tissue in some subjects . the conclusions drawn from these studies were that the agent was safe for administration and showed promise for imaging of grp - expressing tumours but that a more extensive study was required to assess the clinical potential of the tracer and to correlate the in vivo uptake of the tracer with the presence of the receptor as measured on resected tissue samples after imaging . shortly after these studies were completed , resolution pharmaceuticals and the rights to rp527 were acquired by bracco diagnostics inc . bracco have recently begun a phase i study of an lu-177 labelled bombesin analogue based on rp527 ( lu - dota-[4-aminobenzoyl]bb(6 - 14 ) ) ( k. linder pers . the second analogue to be studied in some detail was developed as a result of an academic collaboration between ncsr the peptide which has the sequence cys-(6-amino - n - hexanoic acid)bb(2 - 14 ) can be efficiently radiolabelled with tc although the nature of the chemical complex so formed has not been characterised . this group have studied the use of their compound in breast , prostate and colorectal cancer . dynamic and static planar imaging was performed in five patients with primary breast cancer up to 3 h pi of the radiopeptide labelled with 185300 mbq of tc . diffuse uptake was observed in the ducts of normal breasts . using a prototypic miniaturised gamma camera , the authors were able to use their tracer to guide biopsy of imaged lesions and showed a good correlation between tracer uptake and malignancy . ten patients with primary prostate tumours , two with benign adenoma and eight with cancer , were studied by dynamic , planar and spect imaging . neither patient with adenoma showed uptake of the tracer but all eight patients with cancer showed uptake in the prostate fossa even two in which trus ( transrectal ultrasound ) was negative . thirteen patients , seven with known rectal cancer and six scheduled for endoscopic removal of polyps were also studied by dynamic , and early planar and spect imaging up to 1 h pi . cancers were detected in 11 patients with malignant disease including one with a polyp showing severe dysplasia . five patients showed nodal uptake of the tracer indicative of metastases which was confirmed at surgery . scans were falsely positive in two patients with benign disease but true negative in four . in several instances scopinaro and colleagues report a very rapid uptake of lesions by their tracer which is detected by their dynamic acquisitions within the first minutes after administration . in a recent publication they summarise the kinetics of uptake in 26 patients of various pathologies showing that the time to 80% of maximal uptake was , in most cases , only a few minutes . little information is supplied , however , on the pharmacokinetics and pattern of biodistribution and excretion in non - tumour tissues , but it appears that again a mixed pattern of excretion is present with clearance via both hepatobiliary and renal routes . although not described in any great detail , a number of pet imaging studies have also been performed using ga - dota bombesin analogues . for example maecke et al . studied 11 patients with prostate cancer and imaged the primary tumour in all patients within 30 min of injection . in three lymph node metastases clearance of the tracer was entirely via the kidneys . in some patients a mild reversible systolic blood pressure reduction was observed in the first 2 min after administration and , in some , a significant uptake in pancreatic region was observed . brief reports of imaging with ga - dota bombesin analogues have also appeared in abstract form . | the fact that a number of common human tumours , including those of breast and prostate , express increased levels of the gastrin - releasing peptide receptor ( grp - r ) means that this receptor is a potential target for peptide receptor mediated scintigraphy and targeted radionuclide therapy . although clinical application is yet in its infancy , there is a considerable literature on preclinical studies aimed at developing suitable radioligands for potential clinical application .
this brief review provides an overview of this research and also describes some of the limited clinical studies that have been published . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
epithelioid hemangioma ( eh ) was described originally in 1969 as angiolymphoid hyperplasia with eosinophilia ( alhe ) . lesions usually present as single or multiple red - brown papules or subcutaneous nodules with a predilection for the head and neck region . involvement of the trunk is extremely rare and only nine cases of eh ( alhe ) outside the head and neck region has been reported in the literature as of 2001 . we report an unusual case of eh ( alhe ) that arose on the lower back in a zosteriform array . a 38-year - old male presented in september 2009 with asymptomatic brown papules and nodules on the lower back . he had initially noticed these lesions 3 years earlier and they had gradually extend around the primary lesions on the back . physical examination revealed brown papules and nodules on the left side of the lower back , distributed in a zosteriform array [ figure 1 ] . the patient denied past history of herpes zoster , injury , topical application of any sort , or insect bite at this site . brown papules and nodules on the lower back laboratory findings revealed no evident eosinophilia or elevation of immunoglobulin e levels . skin biopsy revealed elongation of rete ridges , basal hyperpigmentation , a lymphocytic infiltrate with occasional eosinophils [ figure 2 ] , and the presence of thick - walled vessels adjacent to venules in the lower portion of the dermis [ figure 3 ] . the vascular channels were lined by enlarged plump endothelial cells with an epithelioid appearance and cytoplasmic vacuolation [ figure 4 ] . immunohistochemical staining revealed that the enlarged endothelial cells were positive for cd31 , cd34 , and factor viii . the existence of the underlying arteriovenous shunt or hemangioma had not been identified on the follow - up mri done after his surgery for herniated intervertebral disk . 200 ) thick - walled vessels adjacent to venules in the lower portion of the dermis ( hematoxylin and eosin ; 40 ) vascular channels lined by plump endothelial cells with vacuolation and hobnail - like protrusions ( hematoxylin and eosin ; 100 ) alhe is believed to be the most appropriate denotation because it is not confusing , is well established in the literature , and is a histopathologically adequate description . in this case , since the eosinophilic infiltration was too mild to diagnose definite alhe , we prefer to use the term eh based on the histological findings especially the protrusion of endothelial cells . furthermore , eh better describes the possible neoplastic nature of the entity . the differential diagnosis of eh ( alhe ) includes other vascular tumors and tumor - like conditions of blood vessels , such as angiosarcoma , cutaneous epithelioid angiomatous nodule , bacillary angiomatosis , and epithelioid hemangioendothelioma . in our case , angiosarcoma was ruled out by the absence of conspicuous cytologic atypia , frequent mitotic figures , or piling up of cells . unlike cutaneous epithelioid angiomatous nodule , the absence of bacilli , acute neutrophilic inflammation , and capillary proliferation typical of pyogenic granuloma ruled out bacillary angiomatosis . distinction from epithelioid hemangioendothelioma was made by the lesion 's architecture and the presence of prominent inflammation and numerous well - formed blood vessels , with a lack of extravascular proliferation of epithelioid neoplastic cells . there is no consistently effective treatment for this disease and several therapeutic modalities , including intralesional and systemic corticosteroid , has been used with limited success . the lesion can be managed by surgery but recurrences are common unless the arteriovenous shunt is also excised . we did not perform any active treatment ( i.e. , either systemic corticosteroid administration or excision ) because the patient lacked any disabling symptoms and he did not prefer such treatment . although the pathogenesis of alhe is not fully understood , previous reports have suggested the involvement of arteriovenous shunts ; these shunts are made up of clustered , thick - walled vessels adjacent to or communicating with venules or capillaries . in the present case , the existence of the arteriovenous shunt was identified histologically . although an obvious arteriovenous shunt was not identified beneath the lesion in the imaging study , the distribution of the lesion in this case was consistent with the area served by the histological aberrant vessels , the possible pathogenesis of eh ( alhe ) . | epithelioid hemangioma ( eh ) or angiolymphoid hyperplasia with eosinophilia ( alhe ) is an uncommon benign disease .
we report an unusual case of eh ( alhe ) that arose on the lower back in a zosteriform array .
the presence of the characteristic histological appearance of plump endothelial cells with hobnail - like protrusions led to the diagnosis of eh ( alhe ) .
histological examination of the lesion also revealed the existence of arteriovenous shunts , the possible factor contributing to the pathogenesis of eh ( alhe ) . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
this retrospective cohort study identified 8,029 individuals aged 065 years registered on the u.k . cystic fibrosis registry from 1996 to 2005 . cystic fibrosis trust , records information about the health and treatment of patients from birth ( 7 ) . data are collected from 50 british cystic fibrosis care centers in a standardized anonymous fashion after patient consent . data gathering is an ongoing effort , and the registry is updated annually . of 8,029 patients with cystic fibrosis , 6,678 had baseline data comprising registration followed by at least one clinic visit and an annual review within the same calendar year . we excluded 786 individuals without further follow - up , leaving 5,892 patients for analyses of mortality rates . of these , we included 4,234 individuals with complete data in analyses of risk factors for mortality . individuals with complete data were older because of the difficulties in testing pulmonary function in young children and were more likely to be white . information on whether a patient had died and the date of death were taken from the cystic fibrosis registry . the registry did not contain information about individuals ' identities , and we could not obtain death certificates . potential risk factors for death measured at baseline included age , sex , ethnicity , bmi , pulmonary function , diabetes , respiratory infections , class of cystic fibrosis transmembrane conductance regulator ( cftr ) alleles , diagnosis of cystic fibrosis by neonatal screening , prior organ transplantation , and other medical interventions as described below . bmi was calculated as weight in kilograms divided by the square of height in meters , and we computed bmi z scores using a u.k . we coded cftr alleles into five classes reflecting , for cftr protein , defective production , processing , regulation , conductance , and quantity ( 9 ) and further categorized as high ( classes i iii ) and low ( classes iv v ) risk for mortality ( 5,10 ) . pulmonary function was measured as forced expiratory volume at 1 s ( fev1 ) and forced vital capacity , both expressed as percentage of predicted ( 11 ) . we considered diabetes present if a patient had at least one of the following : 1 ) diagnosed diabetes , 2 ) treatment with insulin or oral hypoglycemic drugs , or 3 ) values consistent with diabetes on oral glucose tolerance testing per world health organization criteria . we considered an individual infected if bacteria or fungi were cultured at baseline from sputum or a throat swab or if a physician had diagnosed chronic infection . organisms included pseudomonas aeruginosa , staphylococcus aureus , burkholderia cepacia complex , haemophilus influenzae , methicillin - resistant s. aureus , and aspergillus fumigatus . we defined liver disease as one of the following : 1 ) abnormal liver function tests , 2 ) cirrhosis with portal hypertension , or 3 ) use of supplementary bile acids . we defined corticosteroid use as any oral or inhaled use in the year before baseline and nutritional supplementation as feedings of any kind , ranging from oral supplements to parenteral feedings . we calculated mortality rates expressed per 100 persons / year in 5,892 individuals as the number of deaths divided by total survival time , i.e. , from registration to death or the last clinic visit . using poisson regression , we age - adjusted mortality rates separately for male and female subjects and for those with and without diabetes . we calculated directly standardized mortality rates and standardized mortality ratios ( smrs ) using as a standard the 2005 population of england and wales ( 12 ) . we tested for differences in baseline characteristics between those who died and those who survived using a test for categorical variables and t tests or kruskal - wallis tests for normally distributed or nonnormally distributed continuous variables . we identified risk factors for mortality among the 4,234 patients with complete data using cox proportional regression ; the hazard ratio ( hr ) was used to estimate the relative risk . we evaluated proportional hazards assumptions examining kaplan - meier survival curves for categorical variables ; none violated the assumptions . we chose variables for multivariate modeling if associated with mortality in univariate cox regression analyses ( p < 0.05 ) or if a factor had been previously reported to be associated with the risk of death in cystic fibrosis , e.g. , sex and s. aureus . we tested for two - way interactions between diabetes and each risk factor in the final multivariate model . we calculated paf as ( 13 )
where pd is the proportion of deaths of those exposed to a risk factor ( e.g. , diabetes ) and rr is the adjusted hr from multivariate proportional hazards modeling . we coded percent predicted fev1 , bmi z score , and age as continuous variables in proportional hazards models and as binary variables around the approximate medians ( < 70% for fev1 , < 0.23 for bmi z score , and > 16 years for age ) to calculate pafs . analyses were performed using access ( microsoft ) , r ( r development core team , 2007 ) , and stata ( statacorp ) . information on whether a patient had died and the date of death were taken from the cystic fibrosis registry . the registry did not contain information about individuals ' identities , and we could not obtain death certificates . potential risk factors for death measured at baseline included age , sex , ethnicity , bmi , pulmonary function , diabetes , respiratory infections , class of cystic fibrosis transmembrane conductance regulator ( cftr ) alleles , diagnosis of cystic fibrosis by neonatal screening , prior organ transplantation , and other medical interventions as described below . bmi was calculated as weight in kilograms divided by the square of height in meters , and we computed bmi z scores using a u.k . reference population ( 8) . we coded cftr alleles into five classes reflecting , for cftr protein , defective production , processing , regulation , conductance , and quantity ( 9 ) and further categorized as high ( classes i iii ) and low ( classes iv v ) risk for mortality ( 5,10 ) . pulmonary function was measured as forced expiratory volume at 1 s ( fev1 ) and forced vital capacity , both expressed as percentage of predicted ( 11 ) . we considered diabetes present if a patient had at least one of the following : 1 ) diagnosed diabetes , 2 ) treatment with insulin or oral hypoglycemic drugs , or 3 ) values consistent with diabetes on oral glucose tolerance testing per world health organization criteria . we considered an individual infected if bacteria or fungi were cultured at baseline from sputum or a throat swab or if a physician had diagnosed chronic infection . organisms included pseudomonas aeruginosa , staphylococcus aureus , burkholderia cepacia complex , haemophilus influenzae , methicillin - resistant s. aureus , and aspergillus fumigatus . we defined liver disease as one of the following : 1 ) abnormal liver function tests , 2 ) cirrhosis with portal hypertension , or 3 ) use of supplementary bile acids . we defined corticosteroid use as any oral or inhaled use in the year before baseline and nutritional supplementation as feedings of any kind , ranging from oral supplements to parenteral feedings . we calculated mortality rates expressed per 100 persons / year in 5,892 individuals as the number of deaths divided by total survival time , i.e. , from registration to death or the last clinic visit . using poisson regression , we age - adjusted mortality rates separately for male and female subjects and for those with and without diabetes . we calculated directly standardized mortality rates and standardized mortality ratios ( smrs ) using as a standard the 2005 population of england and wales ( 12 ) . we tested for differences in baseline characteristics between those who died and those who survived using a test for categorical variables and t tests or kruskal - wallis tests for normally distributed or nonnormally distributed continuous variables . we identified risk factors for mortality among the 4,234 patients with complete data using cox proportional regression ; the hazard ratio ( hr ) was used to estimate the relative risk . we evaluated proportional hazards assumptions examining kaplan - meier survival curves for categorical variables ; none violated the assumptions . we chose variables for multivariate modeling if associated with mortality in univariate cox regression analyses ( p < 0.05 ) or if a factor had been previously reported to be associated with the risk of death in cystic fibrosis , e.g. , sex and s. aureus . we tested for two - way interactions between diabetes and each risk factor in the final multivariate model . we calculated paf as ( 13 )
where pd is the proportion of deaths of those exposed to a risk factor ( e.g. , diabetes ) and rr is the adjusted hr from multivariate proportional hazards modeling . we coded percent predicted fev1 , bmi z score , and age as continuous variables in proportional hazards models and as binary variables around the approximate medians ( < 70% for fev1 , < 0.23 for bmi z score , and > 16 years for age ) to calculate pafs . analyses were performed using access ( microsoft ) , r ( r development core team , 2007 ) , and stata ( statacorp ) . the median follow - up time was 2.9 years ( interquartile range 1.94.0 ) . in 17,672 person - years the crude annual mortality rate was 2.2 ( 95% ci 2.02.5 ) per 100 person - years . the age - adjusted mortality rate for the cohort was 1.8 per 100 person - years ( 1.62.0 ) . female subjects had a higher age - adjusted mortality rate at 2.0 ( 1.82.4 ) per 100 person - years than did male subjects at 1.6 ( 1.41.9 ) per 100 person - years . < 0.05 , difference between sexes . individuals with diabetes had considerably higher age - adjusted mortality rates at 4.2 ( 95% ci 3.45.1 ) per 100 person - years than those without diabetes at 1.5 ( 1.31.7 ) per 100 person - years . patients with diabetes had higher absolute mortality rates at all ages , with the greatest relative difference in children < 10 years old at baseline ( p = 0.09 ) ( fig . mortality rates with 95% ci by age and diabetes in patients with cystic fibrosis . , patients without diabetes ; , patients with diabetes . * crude and directly standardized mortality rates expressed per 1,000 person - years and smrs are presented in table 1 . the smrs , which measure the risk of death relative to that of the general population of the same age , were 55.5 , 39.8 , and 84.1 for the total cohort , men , and women , respectively . female patients with diabetes were > 200 times more likely to die relative to their counterparts in the general population . crude , directly standardized mortality rates ( per 1,000 person - years ) and smrs by sex and diabetes in patients with cystic fibrosis * using the 2005 population of england and wales as a standard population . the characteristics and results of univariate analyses of the individuals who died or survived are shown in supplementary table 1 ( available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-1215/dc1 ) . in univariate cox regression analyses evaluating 325 deaths in 12,930 person - years , increasing age , diabetes , decreasing pulmonary function , and a high - risk cftr class were all associated with an increased risk of death . diabetes was associated with a fourfold increase in risk of death relative to that in those without diabetes ( hr 4.04 [ 95% ci 3.235.07 ] , p < 0.001 ) . in univariate analyses , infection with p. aeruginosa , b. cepacia complex , h. influenzae , or a. fumigatus ; use of corticosteroids ; the presence of abpa ; use of nutritional supplements ; and decreased bmi z score were all associated with an increased risk of death . other characteristics that differed between subjects who died and those who survived were a history of liver disease , pancreatic insufficiency , and a history of organ transplantation . patients with cystic fibrosis whose disease had been detected by neonatal screening had a lower risk of death compared with those not detected through screening , as did individuals infected with s. aureus relative to uninfected individuals . not significantly associated with death in univariate analyses were sex ( p = 0.057 ) and infection with methicillin - resistant s. aureus . given the relationship between complications , we evaluated the independent role of each risk factor in multivariate modeling . the final age - adjusted model showed an increased risk of death associated with each of the following : diabetes , decreasing pulmonary function , female sex , decreasing bmi z score , infection with b. cepacia complex , diagnosis of abpa , history of liver disease , prior organ transplantation , and the use of corticosteroids ( fig . 3 ) . infection with s. aureus was independently associated with a decreased risk of death . diabetes was associated with a 31% ( 95% ci 367 ) increase in risk of death independent of other complications of cystic fibrosis . female patients were 71% more likely to die than male patients , with all other factors being equal . n = 4,234 . including high- and low - risk genotype classes and pancreatic insufficiency in the multivariate model described above did not render insignificant any factor or change the hr for death associated with diabetes . the estimated pafs for mortality are shown in supplementary table 2 . with continuous variables coded as binary variables , nutritional supplementation was associated with an increased risk of death . of modifiable factors contributing to mortality , poor pulmonary function defined as a predicted fev1 < 70% accounted for the greatest proportion of risk at 78% . the median follow - up time was 2.9 years ( interquartile range 1.94.0 ) . in 17,672 person - years the crude annual mortality rate was 2.2 ( 95% ci 2.02.5 ) per 100 person - years . the age - adjusted mortality rate for the cohort was 1.8 per 100 person - years ( 1.62.0 ) . female subjects had a higher age - adjusted mortality rate at 2.0 ( 1.82.4 ) per 100 person - years than did male subjects at 1.6 ( 1.41.9 ) per 100 person - years . , male patients ; , female patients . * p < 0.05 , difference between sexes . individuals with diabetes had considerably higher age - adjusted mortality rates at 4.2 ( 95% ci 3.45.1 ) per 100 person - years than those without diabetes at 1.5 ( 1.31.7 ) per 100 person - years . patients with diabetes had higher absolute mortality rates at all ages , with the greatest relative difference in children < 10 years old at baseline ( p = 0.09 ) ( fig . * p < 0.05 , difference between individuals with and without diabetes . crude and directly standardized mortality rates expressed per 1,000 person - years and smrs are presented in table 1 . the smrs , which measure the risk of death relative to that of the general population of the same age , were 55.5 , 39.8 , and 84.1 for the total cohort , men , and women , respectively . female patients with diabetes were > 200 times more likely to die relative to their counterparts in the general population . crude , directly standardized mortality rates ( per 1,000 person - years ) and smrs by sex and diabetes in patients with cystic fibrosis * using the 2005 population of england and wales as a standard population . the characteristics and results of univariate analyses of the individuals who died or survived are shown in supplementary table 1 ( available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-1215/dc1 ) . in univariate cox regression analyses evaluating 325 deaths in 12,930 person - years , increasing age , diabetes , decreasing pulmonary function , and a high - risk cftr class were all associated with an increased risk of death . diabetes was associated with a fourfold increase in risk of death relative to that in those without diabetes ( hr 4.04 [ 95% ci 3.235.07 ] , p < 0.001 ) . in univariate analyses , infection with p. aeruginosa , b. cepacia complex , h. influenzae , or a. fumigatus ; use of corticosteroids ; the presence of abpa ; use of nutritional supplements ; and decreased bmi z score were all associated with an increased risk of death . other characteristics that differed between subjects who died and those who survived were a history of liver disease , pancreatic insufficiency , and a history of organ transplantation . patients with cystic fibrosis whose disease had been detected by neonatal screening had a lower risk of death compared with those not detected through screening , as did individuals infected with s. aureus relative to uninfected individuals . not significantly associated with death in univariate analyses were sex ( p = 0.057 ) and infection with methicillin - resistant s. aureus . given the relationship between complications , we evaluated the independent role of each risk factor in multivariate modeling . the final age - adjusted model showed an increased risk of death associated with each of the following : diabetes , decreasing pulmonary function , female sex , decreasing bmi z score , infection with b. cepacia complex , diagnosis of abpa , history of liver disease , prior organ transplantation , and the use of corticosteroids ( fig . 3 ) . infection with s. aureus was independently associated with a decreased risk of death . diabetes was associated with a 31% ( 95% ci 367 ) increase in risk of death independent of other complications of cystic fibrosis . female patients were 71% more likely to die than male patients , with all other factors being equal . including high- and low - risk genotype classes and pancreatic insufficiency in the multivariate model described above did not render insignificant any factor or change the hr for death associated with diabetes . the estimated pafs for mortality are shown in supplementary table 2 . with continuous variables coded as binary variables , nutritional supplementation was associated with an increased risk of death . of modifiable factors contributing to mortality , poor pulmonary function defined as a predicted fev1 < 70% accounted for the greatest proportion of risk at 78% . this report highlights the specific contribution of diabetes to mortality in britain 's population with cystic fibrosis . using nationally representative and systematically collected data , in this report we estimate the absolute , relative , and attributable risk of death associated with diabetes . because some of the factors are potentially modifiable , then , if they are also causal , this provides hope and identifies research targets to further extend the lives of individuals with cystic fibrosis . in britain , where the incidence of diabetes in cystic fibrosis approximates 27% per year ( 5 ) , we estimate that diabetes accounts for some 14% of deaths . that the components from paf modeling add up to > 100% , although not an intuitive finding , assumes that risk factors interrelate and that each risk factor is the first to be eliminated ( 14 ) . this increased risk associated with diabetes is not explained by previously identified risk factors for death including poor pulmonary function ( 15 ) , other complications ( 6 ) , sex ( 16,17 ) , or genotype ( 18 ) , all of which are also associated with an increased risk of diabetes ( 5 ) . it is likely that the metabolic derangements associated with diabetes nonetheless predispose individuals to infection , worsen pulmonary function , and make maintenance of body weight difficult . the present study showed a disproportionately increased , albeit insignificant , relative risk of death associated with diabetes in children aged < 10 years relative to individuals aged > 10 years . research in france has shown that individuals with cystic fibrosis who develop abnormal glucose metabolism as children have higher mortality rates than those who developed dysglycemia as adults ( 19 ) . in our study , of the children < 10 years , only a very small proportion would be expected to have autoimmune - mediated diabetes ( type 1 ) , given the low prevalence in the u.k . general population ( 20 ) . because screening for diabetes in cystic fibrosis in the u.k . is encouraged for adults during periods of clinical stability but not for children aged < 12 years , diabetic children at presentation may have more severe hyperglycemia . we could not address degree of hyperglycemia , duration of diabetes , or age of its onset in these analyses . show that diabetes , controlling for other factors , is associated with a 55% increase in mortality risk in cystic fibrosis ( 6 ) ; we estimate a more modest 30% increase in risk . if we acknowledge imprecision in estimates and the potential misclassification of diabetes , a real difference may exist . , earlier detection of diabetes , less detection bias ( diagnosing diabetes in sicker patients with more frequent medical attention ) , or better glycemic control ( for which evidence linking better control to mortality in cystic fibrosis is sparse ) model does not include organ transplantation or use of corticosteroids , both risk factors for diabetes ( 5 ) and , in this study , for death . these findings imply that delaying the onset of diabetes , possibly through avoidance of corticosteroids , or assuring earlier and better treatment for diabetes in those with cystic fibrosis may lengthen survival . yet no evidence for prevention of diabetes in cystic fibrosis exists , and trials of treatment are few ( 21 ) . a randomized trial of lowering blood glucose has shown improvements in bmi , but not in pulmonary function ( 22 ) . in the general population , weight loss and exercise can prevent or delay onset of type 2 diabetes ( 23 ) , but these factors have minimal relevance to cystic fibrosis related diabetes , in which -cell dysfunction and decreased insulin production predominate . in type 1 diabetes , trials of early treatment to prevent diabetes have failed ( 24,25 ) . for other risk factors for death , the present study shows , consistent with others ( 16 ) , that female patients die earlier than male patients . the increased risk of death in women does not appear to be due to a higher prevalence of complications ; rather it indicates that female patients with a given set of comorbidities fared worse than same - aged male patients with the same problems . we confirm that lower bmi , pulmonary complications , and infection with b. cepacia complex are associated with an increased risk of death in cystic fibrosis and that infection with s. aureus is associated with a decreased risk of death ( 6 ) . increasing age was not by itself associated with death in cystic fibrosis , reflecting , perhaps , the fact that death rates stabilized after age 20 years ( figs . 1 and 2 ) . our models incorporated age - dependent variables ( percent predicted fev1 and bmi z score ) ; when modeling was done instead with absolute values for fev1 and bmi , increasing age was associated with an increased death rate . < 16 vs. 16 years ) showed that in multivariate modeling , pulmonary function was associated with mortality in both groups , whereas bmi was associated with mortality only in adults . we do not know of another study showing that corticosteroids are associated with an increase in the risk of death independent of other complications . for oral corticosteroids , there is evidence of a short - term benefit in pulmonary function , but the balance of risk in the long term is not clear . physicians may simply offer corticosteroids to patients with the greatest risk of dying . the high smrs we report reconfirm that mortality in the cystic fibrosis population in britain far exceeds that of the general population ( 4 ) . for individuals with diabetes , our findings from directly standardized mortality rates show that the cystic fibrosis population in the u.k . , with a median age of 13 years , has a mortality rate similar to that of those aged 7074 years in the general population of england and wales ( 12 ) . potential limitations include ascertainment of death from the registry rather than from death records and possible misclassification of individuals with diabetes . underdetection of diabetes is probably lessened by universal and free access to health care in britain . if unwell individuals with stress hyperglycemia were labeled as diabetic , this would suggest that the value for risk associated with diabetes we report underestimates the truth . likewise , if factors associated with the risk of death were more apt to be detected in the sickest patients , the relative risks we report would overestimate the true associations but would not bias the overall mortality rates . in summary , this report documents recent mortality statistics for adults and children with cystic fibrosis in britain . in this study , we identify complications including diabetes that , if delayed or better treated , might reasonably extend the lives of individuals with cystic fibrosis in the u.k . advances in life expectancy to date support this opportunity , whereas the paf quantifies potential gains . | objectivediabetes is increasingly common in cystic fibrosis , but little information describing its influence on mortality exists . using national u.k .
data , in this study we document diabetes - specific mortality rates , estimate the impact of diabetes on survival , and estimate population - attributable fractions.research design and methodsthis retrospective cohort study identified 8,029 individuals aged 065 years from the u.k . cystic fibrosis registry ( 19962005 ) . a total of 5,892 patients
were included in analyses of mortality rates , and 4,234 were included in analyses of risk factors .
we calculated age - adjusted mortality rates using poisson regression , standardized mortality ratios using the population of england and wales , and relative risks using proportional hazards modeling.resultsduring 17,672 person - years of follow - up , 393 subjects died .
the age - adjusted mortality rate was 1.8 per 100 person - years ( 95% ci 1.62.0 ) .
the age - adjusted mortality rates per 100 person - years were 2.0 ( 1.82.4 ) in female subjects and 1.6 ( 1.41.9 ) in male subjects , and 4.2 ( 3.45.1 ) in individuals with diabetes vs. 1.5 ( 1.31.7 ) in those without diabetes .
independent risk factors for death included diabetes ( hazard ratio 1.31 [ 95% ci 1.031.67 ] , female sex ( 1.71 [ 1.362.14 ] ) plus poorer pulmonary function , lower bmi , burkholderia cepacia infection , absence of staphylococcus aureus infection , allergic bronchopulmonary aspergillosis , liver disease , prior organ transplantation , and corticosteroid use.conclusionsindividuals with cystic fibrosis die earlier if they have diabetes , which , if delayed or better treated , might reasonably extend survival ; this hypothesis merits testing . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prostate cancer ( pca ) , the most frequently diagnosed malignancy , has become the second leading cause of cancer - related deaths among men in western countries [ 1 , 2 ] . endocrine therapies which aimed at inhibiting the androgen receptor ( ar ) function was the mainstay of treatment for advanced prostate cancer based on that the androgen signaling will promote the proliferation of prostate cancer cell . unfortunately , most of treated patients progressed toward castration - resistant prostate cancer ( crpc ) from castration - dependent prostate cancer . and crpc characterized by aggressive growth and ability to colonize distal organs , which made crpc still incurable and the median survival time for patients with crpc was only 12 months . the status of ar was highly predictive of prostate cancer patients that will benefit from endocrine therapy but was not correlated with a better clinical outcome [ 4 , 5 ] . prostate - specific antigen ( psa ) is a protein produced by the prostate gland cells . although many published studies have assessed the performance of candidate biomarkers in predicting time to relapse of prostate cancer following radical prostatectomy [ 6 , 7 ] , no molecular markers suitable for routine clinical practice that can identify those prostate cancer patients with a high risk of early clinical progression or prostate cancer - specific mortality have been found . g - proteins are composed of , , and subunits and subunit are classified into 4 families : gs , gi / o , gq/11 , and g12/13 . each of them has multiple members with different expression specificity [ 8 , 9 ] . although gs is the most extensively characterized and clinically relevant , literature is not unanimous on the role of gs in different types of cancers . in lung cancer , choi et al . found that gs could augment cisplatin - induced apoptosis of lung cancer cells through upregulating bak expression by increasing transcription and by decreasing the rate of protein degradation and the efficacy of radiotherapy of lung cancer may be improved by modulating gs signaling pathway . but in cervical cancer or intrahepatic cholangiocarcinoma ( icc ) , the situation was just opposite . cho et al . found gs inhibited cisplatin - induced apoptosis by increasing transcription of x - linked inhibitor of apoptosis protein ( xiap ) and by decreasing degradation of xiap protein in hela cervical cancer cells . in icc , schmitz et al . also found a significant association of both unfavorable disease - specific overall survival and recurrence - free survival with the homozygous tt genotype of the gnas1 gene which encoded gs protein [ 13 , 14 ] however , they also reported that t393c polymorphism in the gene gnas1 was significantly associated with favorable clinical outcome of patients suffering from bladder cancer , chronic lymphocytic leukemia , and renal cell carcinoma . there were studies reported no association was found between gnas t393 t genotype and prostate cancer [ 17 , 18 ] . but liu et al . identified that membrane caveolae - associated gas was involved in androgen receptor ( ar ) transactivation by modulating the activities of different pi3k isoforms . more importantly , it had been reported that the expression of gs and gi decreased 30% to 40% after neoplastic transformation . and the levels of gs and gi subunits correlated inversely with serum prostate specific antigen in patients with prostate cancer , which indicated an important regulatory role of gs and gi for cell proliferation and neoplastic transformation in human prostate cancer and they may have prognostic value . therefore , more in - depth investigations are necessary to address this controversy and identify the role of gs in prostate cancer . thus , we assessed the potential of gs as a prognostic marker by determining the level of gs protein expression in a series of 347 postradical prostatectomy prostate cancer tissue microarrays ( tma ) which include 56 metastatic pcas and 291 localized pcas and 67 benign prostatic hyperplasia ( bph ) as controls using immunohistochemistry ( ihc ) . in the present study , we found that expression of gs protein was decreased in high grade and metastatic pcas . and low gs protein levels were strongly associated with adverse clinicopathologic features and poor clinical outcomes in metastatic and localized pca patients . multivariate cox regression analysis showed that low expression of gs was an independent predictor of prostate cancer recurrence and cancer - specific death in metastatic and localized pca . to the best of our knowledge , this is the first study to identify the independent predictive role of gs in patient with prostate cancer . in order to study gs expression in prostate cancer by immunohistochemistry , a total of 347 formalin - fixed , paraffin - embedded prostate tissues between 1994 and 1997 were retrieved from the archives of the first affiliated hospital , college of medicine , and xi'an jiao tong university , and a tissue microarray ( tma ) was constructed . in addition , 67 benign prostatic hyperplasia ( bph ) samples were collected as control . this research project was approved by the ethical committee of the xi'an jiao tong university , and all the patients had been given their fully written informed consent . data were collected on patients with disease baseline and clinicopathologic characteristics as well as 2 treatment outcomes : time to progression and prostate cancer - specific mortality ( pcsm ) . prostate cancers were graded based on the gleason system by 2 independent pathologists at the first affiliated hospital , college of medicine , and xi'an jiao tong university in a blind and consecutive manner to ensure adequate diagnosis and grade . the tnm staging system was used to describe the extent of prostate cancer in patients ( based on the ajcc cancer staging manual , seventh edition , 2010 , springer , new york , inc . ) . briefly , slides were deparaffinized in xylene and rehydrated in a graded alcohol series before endogenous peroxidase activity was blocked with 3% h2o2 in methanol . after nonspecific protein binding was blocked , the primary antibody diluted into recommended concentration for gs , which was purchased from abcam ( ab58810 ) , was applied overnight in a humidity chamber at 4c . biotinylated secondary antibody was applied for 30 min at room temperature after washing with pbs for 3 times . negative control was conducted by replacing the primary antibody with preimmune rabbit serum . to evaluate gs expression , we used the immunoreactive score ( irs ) as previously implemented by tischler et al . the intensity of staining was arbitrarily graded as absent ( 0 ) , weak ( 1 + ) , moderate ( 2 + ) , and strong ( 3 + ) . the percentage of stained cells was use d to quantify the react ion as negative ( 0% of positive cells ) , 1 + ( < 10% positive cells ) ; 2 + ( 1050% of positive cells ) ; 3 + ( 5180% of positive cells ) ; 4 + ( > 80% of positive cells ) . the final value of the analysis of each tissue sample was then expressed as an absolute value through the obtained score by multiplying the two individual scores ( i.e. , intensity of staining score times the percentage of stained cells score ) then generates a final score ranging from ( no expression ) to + ( weak expression ) , + + ( moderate expression ) , or + + + ( strong expression ) . and we identified and + as negative for gs expression and + + and + + + as positive gs expression . examples of scoring according to staining intensity and the percentage of stained cells are shown in figure 1 . spss version 13.0 ( spss , chicago , il , usa ) was used for statistical analyses . psa progression - free and overall survival curves were constructed by the kaplan - meier method and compared using the log - rank test . to evaluate the role of prognostic variables , a series of cox proportional hazards models since psa was a continuous estimate , with the median psa level for the entire cohort of patients ( n = 347 ) as 34.9 ng / ml , we divided the cohort into those with psa levels 35 ng / ml and > 35 ng / ml . the following parameters were included : psa levels ( 35 ng / ml , > 35 ng / ml ) ; extraprostatic extension ( yes , no ) ; involvement of surgical margins ( no , yes ) ; involvement of seminal vesicles ( no , yes ) ; involvement of pelvic nodes ( n0 , n+ ) ; gleason scores ( 26 , 7 , 810 ) . 145 patients ( 41.8% ) presented gleason score of 26 , 127 ( 36.6% ) patients presented gleason score of 7 , and the remaining 75 cases ( 21.6% ) presented gleason score between 8 and 10 . 49 patients ( 11.5% ) presented tnm stage i ; 125 ( 36.0% ) patients presented stage ii ; 117 ( 33.7% ) presented stage iii ; and 56 ( 16.1% ) patients presented tnm stage iv . psa progression was observed in 229 ( 66.0% ) patients at a median interval of 123.5 month ( range 7167 ) . other clinicopathological features are summarized in table 2 . moreover , prostate cancer patients who had higher gleason scores ( p < 0.001 and p < 0.001 , resp . ) , higher tnm stages ( p < 0.001 and p < 0.001 , resp . ) , higher preoperative psa level ( p < 0.001 and p < 0.001 , resp . ) , positive surgical margin ( p = 0.009 and p < 0.001 , resp . ) , angiolymphatic invasion ( p = 0.004 and p = 0.032 , resp . ) , extraprostatic extension ( p = 0.031 and p < 0.001 , resp . ) , and seminal vesicle invasion ( p = 0.046 and p = 0.007 , resp . ) present shorter overall survival and psa progression - free survival ( tables 5 and 6 ) . psa progression and overall survival time correlated with tnm stage , gleason score , extraprostatic extension , positive surgical margins , and seminal vesicle invasion demonstrate the representability of study group . the number of patients with positive lymph node involvement ( n = 34 ) was too small to find any significant correlation with psa progression - free survival and overall survival . to determine the prevalence and clinical significance of gs in prostate cancer tissues , we determined the expression of gs protein by immunohistochemistry in a retrospective cohort of 347 tumor tissue samples from prostate cancer patients and 67 samples from patients who were diagnosed with benign prostatic hyperplasia ( bph ) after tumor resection . among the 347 patients , 114 patients had not expression of gs ( ) ; 73 patients were weak expression ( + ) ; 86 patients were moderate expression ( + + ) , and 74 patients were strong expression ( + + + ) ( as shown in figure 1 ) . thus , as we described in the methods section , there were 160 ( 46.1% ) samples positive for gs expression and 187 ( 53.9% ) samples negative for gs expression in our pca cohort . we also found that positive ratio of gs expression was downregulated in metastatic pca compared to localized pca and bph ( p = 0.012 and p < 0.001 , respectively , as shown in table 1 ) . in patients with bph , there were 42 ( 62.7% ) samples positive for gs expression and 25 ( 37.3% ) samples negative for gs expression . in the patients with localized pca , there were 151 ( 51.2% ) samples positive for gs expression and 140 ( 48.1% ) samples negative for gs expression . whereas in the patients with metastatic pca , there were 9 ( 16.1% ) samples positive for gs expression and 47 ( 83.9% ) samples negative for gs expression . ihc staining for gs was sharp and reliable , no background or nonspecific staining was observed . then , we further evaluated the relationship between gs expression and clinical features of prostate cancer patients by pearson chi - square test or fisher 's exact test . we found that the positive ratio of gs expression was decreased as the level of gleason score or preoperative psa increased . these result showed that there was inverse correlations between gs expression and preoperative psa and gleason score and tnm stage at diagnosis ( p = 0.030 , p < 0.001 , and p < 0.001 , respectively , table 2 ) . but we found no specific correlation between gs expression and the rest of pathological parameters ( age ; angiolymphatic invasion ; extraprostatic extension ; positive margin ; seminal vesicle invasion ; positive lymph node ) that we evaluate in the present analysis . in the localized pca specimens , the expression of gs was correlated with preoperative psa level , gleason score , and tnm stage ( p = 0.028 , p = 0.016 , and p = 0.011 , respectively , table 3 ) . however , in metastatic pca specimens , the expression of gs was only associated with preoperative psa level and gleason score much more significantly ( p < 0.001 , and p < 0.001 , resp . , table 4 ) . in our retrospective cohort with 347 patients , we got the detailed follow - up information of 15 years . at the time of our analysis , 121 patients died and 256 patients progressed . median time to psa progression for the whole cohort was 123.5 months ( range 7167 months ) , while the median time to death was 123.5 months ( range 3179 months ) . we found that patients with negative expression of gs had a higher ratio of psa progression than those with positive gs expression ( table 2 ) . more importantly , negative gs expression was associated with psa progression - free survival and overall survival . the group of patients with negative expression of gs showed significantly shorter overall survival than patients with positive expression of gs ( p = 0.001 , figure 2(a ) ) . these patients also showed a trend for shorter psa - free survival time ( p < 0.001 , figure 2(d ) ) . in localized pca specimens , negative gs expression was also associated with better psa progression - free and overall survival rate ( p < 0.001 , figure 2(c ) ; p < 0.001 , figure 2(f ) ) . in metastatic pca specimens , a similar trend was found between negative gs expression and psa progression - free / overall survival time ( p = 0.0003 , figure 2(e ) ; p = 0.0146 , figure 2(b ) ) . as expected , at the univariate level , gleason scores , tnm stages , preoperative psa , positive margin , angiolymphatic invasion , extraprostatic extension , and seminal vesicle invasion were associated with psa progression - free and overall survival . negative expression of gs protein was a prognostic predictor of psa progression - free and overall survival in pca patients at univariate level ( tables 5 and 6 ) . we further conducted a multivariate cox regression analysis to assess whether gs was a prognostic predictor of survival independent of age , gleason scores , tnm stages , preoperative psa , positive margin , angiolymphatic invasion , extraprostatic extension , seminal vesicle invasion , and positive lymph node . multivariate analysis showed that negative gs expression was a strong independent predictor of outcome providing survival information ( both psa progression - free or overall survival ) above other independent prognostic features ( tnm stage , gleason score ) , with a hazard ratio of 4.328 and 3.904 and a 95% confidence interval of 1.8768.432 , p < 0.001 ( negative gs group versus positive gs group ) and 1.2785.873 , p < 0.001 ( negative gs group versus positive gs group ) . in our cohorts , psa , positive margin , angiolymphatic invasion , extraprostatic extension , and seminal vesicle invasion it has been reported that the expression of gs correlated inversely with serum prostate specific antigen in patients with prostate cancer and the expression of gs decreased 30% to 40% after neoplastic transformation . but there was no study concerning the role of gs protein in the prognosis of prostate cancer patients . in the present study , we characterized the expression pattern of gs protein in a large number of tissues derived from prostate cancer patients , consisting of localized and metastatic pca , and assessed the utility of gs as a prognostic marker in these patients . in agreement with previous reports , we confirmed that gs expression was localized in nuclear and cytoplasm in neoplastic cells . moreover , we found that expression of gs was downregulated in metastatic pca compared to localized pca and bph . and gs was inversely associated with psa level and gleason scores both in localized and metastatic pca . at the univariate level , gs , gleason scores , tnm stages , preoperative psa level , positive margin , angiolymphatic invasion , extraprostatic extension , and seminal vesicle invasion but in multivariable cox regression analysis , only high gs expression and gleason scores were independent predictors of both psa progression - free and overall survival . these findings support the potential clinical utility of incorporating gs into clinical nomograms to help determine the risk of psa progression and death . the prognostic significance of gs as biomarker for prostate cancer is likely to its biological functions . gs is a member of gtp - binding protein superfamiliy and could independently regulate a variety of effectors including adenylate cyclases , phospholipase c , and ion channels [ 22 , 23 ] . however , gs and t393c polymorphism in the gene gnas1 which is encoded by gs plays distinct roles in different cancers . gs could augment cisplatin - induced apoptosis of lung cancer cells , but it inhibited cisplatin - induced apoptosis in cervical cancer or intrahepatic cholangiocarcinoma ( icc ) . t393c polymorphism in the gene gnas1 was significantly associated with favorable clinical outcome of patients suffering from bladder cancer , chronic lymphocytic leukemia , and renal cell carcinoma , and significantly associated with unfavorable clinical outcome of patients suffering from icc and breast cancer [ 13 , 14 ] . in prostate cancer , previous study reported that low expression level of gs was found in t2 stage pca compared to high levels in normal controls . more importantly , the expression of gs was found downregulated in hormone refractory c4 - 2b and pc3 cell lines compared to hormone sensitive lncap and rwpe-1 cell lines . all these studies indicating the functionality and expression of gs are selectively modified in human prostate adenocarcinoma and downregulated gs levels may play an important regulatory role for cell proliferation and neoplastic transformation in prostate cancer . thus , we did our efforts to investigate and validate whether gs functioned as an efficient prognostic biomarker to predict the outcome of pca patients . consistent with previous studies , we found that the expression of gs was much lower in metastatic pca than it is in localized pca . furthermore , the patients who had the low expression of gs tend to have shorter progression - free survival and overall survival time , nonetheless , metastatic or localized pca . more importantly , multivariable cox regression analysis proved that gs was an independent predictor of prognosis in prostate cancer . though the answer to the discrepancy of gs function in different cancers was still unclear , and the role of gs in prostate cancer was also in dispute , our results were relatively easy to understand for gs had a close relationship with egfr . egfr belongs to erbb oncogene family which also includes erbb-2 , 3 , and 4 and is comprehensively expressed in epithelial cells including prostate cancer cells . egfr are known to regulate cell proliferation , differentiation , angiogenesis , and survival . in prostate cancer , it has been reported that egfr was highly expressed in du145 and pc3 cell lines which were hormone - independent human prostate cancer cell lines and responsive to egf stimulation [ 2527 ] . it was also found that prostate cancer bone metastases express significantly higher level of egfr . more importantly , egfr expression increased as prostate cancer progressed from an androgen - dependent to an androgen - independent stage . di lorenzo et al . , found 41% , 76% , and 100% egfr expression in radical prostate ectomy hormone - sensitive and hormone - refractory metastatic patients in a cohort consisting of 76 patients with androgen - dependent and androgen - independent prostate cancer , respectively . many studies confirmed that overexpression of egfr contributes significantly to the progression of prostate cancer [ 3134 ] . zheng et al . reported that overexpression of the stimulatory gs promotes ligand - dependent degradation of epidermal growth factor ( egf ) receptors and texas red egf , and knock - down of gs expression by rna interference ( rnai ) delays receptor degradation . recently , they demonstrated that egf - induced , proliferative signaling occurs from eea1 endosomes and was regulated by the gs through interaction with the signal transducing protein giv ( also known as girdin ) . when gs or giv was depleted , activated egfr and its adaptors accumulate in eea1 endosomes . then egfr signaling was prolonged and egfr downregulation was delayed , which made cell proliferation greatly enhanced . basing on our finding that gs was downregulated in advanced pca and the previous studies concerning the function of egfr in pca , we hypothesise that downexpression of gs inhibit the degradation of egfr , then androgen receptors which are activated by egfr were prolonged and cell proliferation increased , eventually causing tumor progression and hormone - resistant in prostate cancer . that maybe the underlying mechanism account for our results in which the expression of gs was downregulated in metastatic pca and inversely associated with psa level and gleason scores . but experiments would be desirable to further clarify the relationship between gs and egfr and identify their function in the progression of prostate cancer . however , such functional studies were beyond the scope of this study . in summary , we discovered that gs is a promising biomarker of prostate cancer patients . to our knowledge , this is the first study to describe the predictive role of gs in prostate cancer . we found that the expression of gs was downregulated in metastatic prostate cancer compared to localized prostate cancer . and although our results are promising , gs expression needs to be validated in relationship to outcome in the context carefully controlled clinical trials . all in all , targeting gs could be a promising therapeutic strategy for enhancing the therapy effect of patients . | background .
t393c polymorphism in the gene gnas1 , which encodes the g - protein alpha s subunit ( gs ) of heterotrimeric g protein , is significantly associated with the clinical outcome of patients suffering from several cancers .
however , studies on the role and protein expression of gs subunit in prostate cancer were still unavailable . methods .
the immunohistochemical staining was used to assess gs expression through tissue microarray procedure of 56 metastatic pcas , 291 localized pcas , and 67 benign hyperplasia ( bph ) .
gs expression was semiquantitatively scored and evaluated the correlation with pathologic parameters and biochemical recurrence of prostate - specific antigen ( psa ) . results .
gs expression was localized in nuclear and cytoplasm in prostate cancer cells and downregulated in metastatic pca compared to localized pca and bph ( p < 0.001 ) .
gs was inversely associated with psa level and gleason scores ; patients with low expression of gs had adverse clincopathological features .
in multivariable cox regression analysis , high gs expression and gleason scores were independent predictors of both psa progression - free and overall survival . conclusions .
gs down - expression is associated with adverse pathologic features and clinical psa biochemical recurrence of prostate cancer .
gs is an independent predictor to help determine the risk of psa progression and death . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
dopamine ( da ) receptors are classified into two broad families , namely , the d1-like ( d1 and d5 ) and d2-like ( d2 , d3 , and d4 ) receptors . the d3 receptor was first cloned and characterized by sokoloff et al . in 1990 . the d3 receptor is mostly distributed in projection areas of the mesocorticolimbic dopaminergic system , for example , the nucleus accumbens , olfactory tubercle , islands of calleja , and prefrontal cortex [ 36 ] . although the role of the d3 receptor in the brain function has not been completely established , it has been related to behavioral aspects such as locomotion , emotion , and cognition [ 611 ] . the d3 receptor has also been implicated in disorders , such as schizophrenia and drug abuse , because its pharmacology and pattern of location in the brain is consistent with defective neural circuits seen in such disorders [ 12 , 13 ] . for example , postmortem studies suggest a d3 receptor dysfunctionality in some cortical regions of brains obtained from schizophrenic patients [ 14 , 15 ] . the locomotor responses to novelty and psychostimulants seem to be regulated by d3 receptors [ 6 , 10 , 16 , 17 ] . 7-hydroxy-2-(n , n - di - n - propylamino ) tetralin ( 7-oh - dpat ) has been described as a d3-preferring agonist [ 4 , 18 ] . in rats , administration of low doses of 7-oh - dpat decreases locomotion , with such reduction in locomotion attributed to a d3 autoreceptor stimulation , but some findings suggest that the inhibitory action of the d3 receptors on locomotion can also occur via postsynaptic mechanisms [ 8 , 19 ] . to date , the main theory of the origin of schizophrenia points to the neurodevelopmental model , in which developmental abnormalities early in life lead to the activation of pathologic neural circuits during adolescence or young adulthood leading to the appearance of the schizophrenic symptoms . the most thoroughly characterized neurodevelopmental model of schizophrenia is the neonatal ventral hippocampal lesion ( nvhl ) model . rats with a bilateral neonatal ventral hippocampus lesion show a delayed onset of motor , social , and cognitive behaviors comparable to many symptoms of schizophrenia [ 3 , 2228 ] . for example , animals with an nvhl show increased locomotor responses to stress and psychostimulants after puberty [ 3 , 22 , 29 , 30 ] . changes in the d3 expression in the limbic areas have also been observed in this model . although sprague - dawley ( sd ) and wistar ( w ) rats are two of the most used strains of rats in research , the vast majority of studies of the nvhl model have been made in sd rats , though , there are some reports using w rats [ 31 , 32 ] . however , although w and sd rats show differences in some neurobiological functions [ 3339 ] , to the best of our knowledge , a comparative study of the nvhl model between w and sd rats has not yet been reported . therefore , to assess possible strain differences between adult wistar and sprague - dawley rats in the behavior related to the dopaminergic dysregulation caused by the nvhl , we investigated the effect of the dopamine d3-preferring agonist 7-oh - dpat on open - field activity in w and sd rats after an nvhl . pregnant sprague - dawley and wistar rats were obtained at gestational day 14 to 17 from our facilities ( harlan mxico was the original source ) . the animals were individually housed in a plexiglas cage with a stainless steel cover in a light-(0700 to 1900 lights on ) and temperature-(2022c ) controlled room . all surgical and behavioral procedures described in this study were in accordance with the guide for the care and use of laboratory animals of the mexican council for animal care ( nom-062-zoo-1999 ) . every effort was made to alleviate any pain or distress that might be experienced by the animals during this experiment . behavioral testing was done between 1000 and 1400 and was recorded on videotape using a vhs video camera ( nv - n3000pn , panasonic ) for later examination . the day following birth , eight litters of 8 male pups each were culled to maintain same litter size across dams . on postnatal day 7 ( pd7 ) , pups within each litter ( weighing 15 to 17 g ) were randomly assigned to either the sham or the lesion group [ 40 , 41 ] . the pups were anesthetized by hypothermia ( placed on wet ice for 1215 min , with a latex cover placed on the ice to protect the pups ' skin ) , until they were immobile . they were then placed on a modified platform that was positioned in the ear bars of the stereotaxic device ( david kopf instruments , tujunga , ca , usa ) . to achieve a flat - skull position , the platform was adjusted until the heights of lambda and bregma skull points were equal . then , 0.3 l of 10 g/l ibotenic acid ( sigma - aldrich , mxico ) or an equal volume of 0.1 m phosphate - buffered saline ( pbs ) , ph 7.4 , was injected into the ventral hippocampus over 90 s through a 31-gauge stainless steel cannula aimed at the following coordinates : ap 3.0 mm , ml 3.5 mm to bregma , and dv 5.0 mm from dura . the cannula was left inserted 60 s more to avoid backflow of the drug up the cannula tract . the injection cannula was connected to a 1-l syringe ( hamilton co. , reno , nv , usa ) with tygon microbore tubing ( i d : 0.25 mm ; od : 0.76 mm ) filled with sterile water . after the procedure , the pups were placed on a heat pad for recovery and then returned to their dams . on pd21 , animals were weaned and segregated into the sham or lesion group ( 3 or 4 animals per cage ) [ 40 , 43 ] . after behavioral testing , all animals were overdosed with sodium pentobarbital ( pfizer , mxico ; 150 mg / kg , i.p . ) and perfused intracardially with 0.9% saline solution followed by 4% formalin . the brains were removed manually and stored for at least 48 h in 10% formalin . coronal sections 100-m thick were obtained using a vibroslicer ( 752 m , cambden instrument , lafayette , in , usa ) , the sections stained with 0.5% cresyl violet , mounted with resinous medium and examined under a microscope ( smz-10a , nikon instruments inc . , the lesion sites were located with reference to the stereotaxic atlas of paxinos and watson . the animal was placed on the middle of the open field ( black - painted wooden box 60 cm 60 cm 30 cm ; w the light conditions were comparable to the light intensity in the housing room ; two 32-w overhead fluorescent bulbs were suspended 208 cm above the center of the field and provided 195 lx at the floor of the box . the spontaneous motor activity in an unfamiliar environment was measured using a video image analyzer ( videomex - v , columbus instruments , columbus , oh , usa ) , which keeps track of the distance the animal travels ( dt ) , the amount of time spent travelling ( ta ) , the amount of time spent in a nonambulatory activity ( tna ) , and the amount of time resting ( tr ) . the floor of the open field was wiped with a detergent solution between each rat . to test the effect of the 7-oh - dpat in male rats with a bilateral , neonatal excitotoxic lesion of the ventral hippocampus , four groups of animals were formed ; ( 1 ) wistar rats with a sham neonatal excitotoxic lesion of the ventral hippocampus ( w - sham ; n = 14 ) , ( 2 ) wistar rats with a neonatal excitotoxic lesion of the ventral hippocampus ( w - lesion ; n = 14 ) , ( 3 ) sprague - dawley rats with a sham neonatal excitotoxic lesion of the ventral hippocampus ( sd - sham ; n = 15 ) , and ( 4 ) sprague - dawley rats with a neonatal excitotoxic lesion of the ventral hippocampus ( sd - lesion ; n = 12 ) . at pd60 , rats were brought , in individual polysulfone cages , to the testing area , which was in the same building and floor as the colony room . the animals from each group were randomly assigned to receive either a sc injection of ( )-7-hydroxy-2-(n , n - di - n - propylamino ) tetralin hydrobromide ( 7-oh - dpat ; 0.25 mg / kg ; sigma - aldrich , mxico ) or vehicle ( saline solution ; 0.9% nacl ) , in a volume of 1 ml / kg body weight . approximately in each group half of the rats received the 7-oh - dpat and half saline . thirty minutes after injection , rats were individually placed in the testing box and 3 min of motor activity was recorded . it was previously reported , under these experimental conditions , that the motor activity of the animals declined during the initial 9 min , with the highest levels of activity in the first 3 min of the test [ 35 , 45 ] . the 30-min postinjection time for the motor activity recording was chosen because it allows observation of changes in rat behavior produced by low doses of 7-oh - dpat ( motor activity [ 8 , 46 ] , amphetamine - induced stereotypy , and latent inhibition ) . the behavioral data were compared by a three - way analysis of variance ( anova ) with strain , lesion , and drug treatment as independent factors . a p < .05 was considered statistically significant . for multiple comparisons , in absence of a significant interaction between factors , independent analyses ( separated from the anova ) of student - newman - keuls ( s - n - k ) bilateral reduction in the size of the ventral hippocampus ( vh ) was seen in both adult w and sd rats after making the neonatal ventral hippocampus lesions . cresyl violet - stained sections obtained from brains of adult animals with nvhl showed important bilateral damage of the vh , with neural loss , atrophy , cavities , and apparent retraction of the vh ( figure 1 ) , as previously reported . only animals that showed evidence of bilateral ventral hippocampus damage were included in the study . figure 2 shows the locomotor activity as the distance traveled ( dt ) by wistar and sprague - dawley rats . the three - way anova showed significant differences for strain ( f1,47 = 10.26 , p < .01 ) and drug treatment ( f1,47 = 22.06 , p < .01 ) factors , though there were no significant differences of the main effect of the lesion ( f1,47 = 0.22 , p > .05 ) or strain by lesion by treatment interaction ( f1,47 = 0.42 , p > .05 ) . in w rats , the student - newman - keuls ( s - n - k ) tests , independent of the anova , show that 7-oh - dpat reduced the distance traveled of sham rats , as well as of rats with a lesion . in sd rats , the s - n - k tests , independent of the anova , show that the 7-oh - dpat reduced the distance traveled in sd rats but only in the sham group . in addition the sham w rats were more active than the sham sd rats ( figure 2 ) . similar results were observed for the time spent in ambulatory movements ( ta ) ( figure 3 ) . the three - way anova showed for the time in locomotor activity significant effects of strain ( f1,47 = 6.90 , p < .05 ) and drug treatment ( f1,47 = 13.76 , p < .01 ) . nevertheless , for the main effect of the lesion and interaction of strain by treatment by lesion factors ( f1,47 = 0.42 , p > .05 and f1,47 = 0.13 , p > when the independent s - n - k test was used in w rats , it is showed that the 7-oh - dpat causes a reduction in the time spent in ambulation in both sham and the rats with lesions . as was seen for the distance traveled , in sd rats , the independent s - n - k test showed a different effect of the 7-oh - dpat on the time spent in locomotion . the neonatal ventral hippocampus lesions prevented the decrease in locomotion caused by the 7-oh - dpat , though such reduction was measured in sham animals . the sham w rats also spent more time in ambulation compared to the sham sd rats ( figure 3 ) . in figure 4 , the amount of time spent by rats in nonambulatory activity ( tna ) is shown . the tna includes postural adjustments and stereotypical behavior ( grooming , rearing , sniffing , etc . ) . the three - way anova did not show significant differences caused by the strain ( f1,47 = 1.04 , p > .05 ) . both the w and sd rats showed a nonsignificant effect in the tna caused by the 7-oh - dpat ( f1,47 = 0.14 , p > .05 ) . in addition , there were no statistical differences in the tna caused by the neonatal hv lesion in both w and sd rats ( f1,47 = 2.35 , p > .05 ) . the anova also did not show a statistically significant interaction for strain by treatment by lesion factors ( f1,47 = 0.12 , p > .05 ) . figure 5 shows the time spent in resting ( tr ) of w and sd rats . the three - way anova did not show a significant difference for strain ( f1,47 = 3.14 , p > .05 ) . the 7-oh - dpat produced a nonsignificant effect in the tr in both the sham and rats with lesions ( f1,47 = 3.12 , p > .05 ) . furthermore , there was no statistical differences in the lesion factor ( f1,47 = 1.74 , p > .05 ) or strain by lesion by treatment interaction ( f1,47 = 0.15 , p > .05 ) . finally , there were no pattern differences in the tracings of the path of rats in the open field during the tests therefore these data are not shown . our results confirm that the administration of 7-oh - dpat ( at a d3-preferring agonist dose ) reduces the locomotion in the open - field test of both adult w and sd rats . in addition , we found a different effect of the 7-oh - dpat between adult w and sd rats with neurodevelopmental excitotoxic hippocampal damage . after administering the 7-oh - dpat , the w rats with an nvhl had a decrease in locomotion similar to the w sham rats . in contrast , the nvhl prevented the reduction in locomotion caused by the 7-oh - dpat in sd rats . these results may have implications for modeling interactions of genetic and environmental factors involved in schizophrenia . the mesolimbic and nigrostriatal dopamine pathways in the mammalian brain play a role in mediating motor behaviors , including locomotion and stereotypical behavior . accumulating evidence suggests that stimulation of the d3 receptors inhibits spontaneous and psychostimulant - caused locomotion , different than the synergistic d1 and d2 receptors mediating behavioral sensitivity [ 7 , 17 , 19 , 4852 ] . in agreement with previous work [ 8 , 46 , 53 ] , the d3-preferring receptor agonist 7-oh - dpat administered peripherally in our work reduced the spontaneous locomotion in the sham animals . the 7-oh - dpat has been reported as a d3-preferring agonist [ 4 , 18 ] . the 7-oh - dpat produces a biphasic effect on behavioral activity in which locomotion is inhibited at lower doses and stimulated at higher doses [ 7 , 54 ] , suggesting a d3-receptor activation at low doses and increasing d2-receptor occupancy at higher doses . in our study , a low dose ( 0.25 mg / kg ) of 7-oh - dpat was used to cause hypolocomotion , suggesting primarily a d3-receptor stimulation . the estimates of the d2-receptor occupancy in vivo suggest that 7-oh - dpat doses below 0.3 mg / kg are devoid of significant d2-receptor occupancy . the decrease in locomotion has been attributed to a d3-autoreceptor stimulation [ 7 , 56 ] , which in turn inhibits dopamine release . studies in d3-receptor knockout mice support the idea of a d3-receptor regulation of dopamine levels . in a novel environment , the d3 mutant mice are transiently more active than wild - type mice , and microdialysis studies in vivo have shown that basal extracellular dopamine levels are increased in the nucleus accumbens and dorsal striatum of the d3-receptor knockout mice . however , some findings suggest that the inhibitory action of the d3 receptors on locomotion can also occur via postsynaptic mechanisms [ 8 , 19 ] . the predominate expression of the d3 receptors in the limbic areas , for example , nucleus accumbens , has led the field to consider this receptor as a potential target for the treatment of schizophrenia , which is associated with a dysregulation of dopamine neurotransmission . after puberty , rats with lesions develop hypersensitivity to stress and dopamine agonists [ 3 , 22 , 43 ] . in postpubertal sd rats , a decrease in d3 receptors was measured in the limbic areas of the rats with lesions compared to sham controls , particularly in the nucleus accumbens . this decrease in the d3 receptors could explain the hyperdopaminergic behaviors observed in sd rats after an nvhl . this explanation could also explain our results with sd rats with lesions treated with the d3-preferring agonist 7-oh - dpat . here , sd sham rats ( with normal d3 receptor levels in the limbic areas ) showed a reduction in locomotion after 7-oh - dpat administration . in contrast , sd rats with an nvhl ( with low d3 receptor levels in the limbic areas ) were not susceptible to the 7-oh - dpat administration . a reduction in d3 receptor levels has also been suggested in brains of schizophrenic patients [ 14 , 15 ] , in these postmortem studies , the expression of d3 mrna was found selectively lost in the motor , parietal , and anterior cingulate cortices of brains obtained from patients with chronic schizophrenia . in contrast , a truncated d3-like mrna ( named d3nf ) was abundantly expressed in the same brain areas , this d3nf mrna could encode a dysfunctional d3 protein receptor [ 14 , 61 ] . thus , another possible explanation about the lack effect of 7-oh - dpat on locomotion in sd rats with nvhl arises from the above described works , where the nvhl in these rats could produce a dysfunctional expression of d3 receptors in some brain areas . future studies will show if truncated d3-like mrnas are also abundantly expressed in brains of rats with nvhl . the wistar rats have also been used in the nhvl model [ 31 , 32 , 62 ] , but to the best of our knowledge , a direct comparative study of the effect of an nvhl between sd and w rats has not been reported . we found that w rats with an nvhl were susceptible to the 7-oh - dpat administration . there was a comparable reduction in the locomotor activity , after 7-oh - dpat treatment , between the sham w rats and those with lesions . we hypothesized that there is a different effect of an nvhl on the expression of the d3 receptors in the limbic areas between the w and the sd animals . in the w rats , the reduction in the d3 receptors seen in the sd rats with lesions data from studies with lewis and fisher 344 rats are consistent with the above hypothesis . lipska and weinberger found that fisher 344 rats with an nvhl have an increase in spontaneous and amphetamine - caused locomotion . in contrast , lewis rats with an nvhl were not affected by having a lesion . interestingly in the lewis rats without a lesion , the d3 receptors in the nucleus accumbens and olfactory tubercle are lower than levels found in fisher 344 rats . this suggests that because lewis rats already have a reduced amount of d3 receptors , a further decrease in d3 receptors caused by an nvhl may not occur . further investigations of dopamine receptor levels in the brain in the nvhl model with different strains will be of interest to extend these findings . another interpretation of our results arises from the use of a single dose of 7-oh - dpat . the sd rats exhibited less locomotor activity than w rats and therefore strain differences in the sensitivity for detecting 7-oh - dpat - caused decreases in locomotion could explain our results . certainly , the lower locomotor activity in sd rats could account for the preventive effect of the nvhl on 7-oh - dpat - caused decreases in locomotion in sd rats . however , it seems less likely because the single dose of 7-oh - dpat used here was able to reduce the locomotor activity in sham sd rats in a percentage similar to the observed in sham w rats ( the 7-oh - dpat - caused dt reduction was 59% for sham sd and 44% for sham w rats ) . both rat strains showed similar sensitivity for the drug in sham animals , thus , it seems likely that , in rats with a lesion , the differences observed in the 7-oh - dpat - caused decreases in locomotion between strains can be attributed to the nvhl . because the d3 receptor may be an important target for antipsychotic drugs , our results with the nvhl model suggest a strain - dependent different effect on the expression and/or functionality of d3 receptors in the limbic areas . it could help explain individual differences in the response to antipsychotic drugs in schizophrenic patients . | the neonatal ventral hippocampal lesion ( nvhl ) has been widely used as an animal model for schizophrenia .
rats with an nvhl show several delayed behavioral alterations that mimic some symptoms of schizophrenia .
sprague - dawley ( sd ) rats with an nvhl have a decrease in d3 receptors in limbic areas , but the expression of d3 receptors in wistar ( w ) rats with an nvhl is unknown .
the 7-hydroxy-2-(n , n - di - n - propylamino ) tetralin ( 7-oh - dpat ) has been reported as a d3-preferring agonist .
thus , we investigated the effect of ( )-7-oh - dpat ( 0.25 mg / kg ) on the motor activity in male adult w and sd rats after an nvhl .
the 7-oh - dpat caused a decrease in locomotion of w rats with an nvhl , but it did not change the locomotion of sd rats with this lesion .
our results suggest that the differential effect of 7-oh - dpat between w and sd rats with an nvhl could be caused by a different expression of the d3 receptors .
these results may have implications for modeling interactions of genetic and environmental factors involved in schizophrenia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mesenchymal stem cells ( mscs ) are multipotent progenitor cells that mediate immune tolerance in recipient hosts . these cells are commonly isolated from bone , blood , and adipose tissues , as well as from umbilical cord wharton s jelly . they home to damaged tissues and contribute to their repair by secretion of cytokines , chemokines , and extracellular matrix proteins.1 bone marrow - derived ( bm)-mscs , the most commonly studied mscs , are also highly immunosuppressive both in vitro and in vivo in animal models.2,3 bm - mscs modulate immune responses by dendritic cells , lymphocytes , neutrophils , and monocytes , in part through the release of cytokines and lipid mediators.4 these cells also inhibit apoptosis and reduce the formyl - methionyl - leucyl - phenylalanine - induced respiratory burst in neutrophils by constitutive release of interleukin ( il)-6.5 some evidence suggests that immunosuppression by bm - mscs is dependent on their expression of the adhesion molecules , ie , intercellular adhesion molecule-1 ( icam-1 ) and vascular cell adhesion molecule-1 , indicating that cell - to - cell contact is required.3 however , the mechanisms of immunosuppression by mscs are not known . mscs may have therapeutic utility in neonates , who are susceptible to inflammatory diseases , such as bronchopulmonary dysplasia . however , the invasiveness of bone marrow aspiration and the age - dependent degradation in quantity and quality of bm - mscs limit their clinical potential . human umbilical cord wharton s jelly ( wj ) provides an alternative source of mscs that exhibit high proliferative capacity and multidifferentiation potential.6 these cells are abundant and accessible , and when compared with mscs from adult bone marrow or adipose tissue , wj - mscs are more robustly proliferative and immunosuppressive.7 of note , these cells can be expanded from the umbilical cord at the time of birth , raising the possibility of autologous treatment of newborns . neutrophils are nonproliferative circulating phagocytes that produce reactive oxygen intermediates and inflammatory cytokines , and also promote vascular remodeling by secretion of angiogenic growth factors.8 however , prolonged activation of these cells following hypoxic or infectious insults has been implicated in chronic inflammatory diseases associated with alterations in tissue architecture , such as bronchopulmonary dysplasia.9 current therapies to ameliorate neutrophil cytotoxicity have not been completely effective in treating or preventing these conditions . wj - mscs have been proposed as cell - based prophylaxis or treatment for neonatal inflammatory diseases.10 however , the effects of wj - mscs on neonatal neutrophil activity are not known . in the current studies , we compared the dose - dependent effects of wj - mscs on apoptosis and inflammatory function in neonatal and adult neutrophils . we hypothesized that wj - mscs would downregulate expression of oxidant and inflammatory mediators , and increase antioxidant expression in neutrophils . experiments were performed in the presence or absence of il-6 or icam-1 ( cd54 ) blocking antibodies to investigate the possibility that these effects are mediated by soluble mediators or cell contact , respectively.3,11 dulbecco s modified eagle s medium , phosphate- buffered saline , and bacterial lipopolysaccharide ( serotype 0128:b12 ) were purchased from sigma chemical company ( st louis , mo , usa ) . ficoll - paque was from ge healthcare ( piscataway , nj , usa ) , and heat inactivated fetal bovine serum was from biosera us ( kansas city , mo , usa ) . annexin v - apc , 7-actinomycin d ( 7-aad ) and cytometric bead array flex sets were from bd biosciences ( san jose , ca , usa ) . rneasy rna purification kits were purchased from qiagen ( chatsworth , ca , usa ) . primers for real time polymerase chain reaction were obtained from integrated dna technologies , inc . ( coralville , ia , usa ) and power sybr green master mix from applied biosystems ( foster city , ca , usa ) . anti - human il-6 and anti - human cd54 ( icam-1 ) were from ebioscience ( san diego , ca , usa ) . these studies were approved by the institutional review board of robert wood johnson medical school . umbilical cord blood samples were collected at the time of delivery of healthy term newborns ( 37 weeks gestation ) by elective cesarean section prior to labor , with tissue - specific informed consent . subjects with clinical evidence of chorioamnionitis , funisitis , or other perinatal infections were excluded . for comparison , neutrophils were isolated from peripheral venous blood of healthy adult volunteers . wj - mscs from nine infants were isolated by peeling the outer membrane of the umbilical cord and dissecting out the arteries and vein , as previously described.12 wj was cut into 13 mm pieces and placed in 10 cm tissue culture dishes . after drying ( 15 minutes ) half of the medium was changed on day 5 , and all media were changed every 3 days subsequently . cells from each subject were treated as a new cell line and tested for purity and expression of characteristic msc markers by flow cytometry . similar to previous reports,13 all nine lines expressed cd105 , cd73 , and cd90 , but not cd45 , cd34 , or cd31 . polymorphonuclear neutrophils ( pmn ) were isolated by dextran sedimentation , ficoll gradient centrifugation , and hypotonic lysis . cells were resuspended in dulbecco s modified eagle s medium containing 10% fetal bovine serum ( 110 cells / ml ) . neutrophil suspensions were incubated with adherent wj - mscs in 24-well plates at 37c , at wj - msc to neutrophil ratios of 1:201:640 for apoptosis studies and 1:20 for analysis of gene and protein expression . cell viability ( defined by absence of uptake of 7-aad fluorescence dye ) was > 97% in all experiments . after 24 hours in co - culture with wj - mscs , neutrophils were washed out of the wells , pelleted , and resuspended in phosphate - buffered saline at 110 cells / ml . triplicate aliquots of cells ( 100 ml ) were then incubated with annexin v - apc ( 1:20 ) and 7-aad ( 1:10 ; 15 minutes , room temperature ) . neutrophils were identified based on forward scatter and side scatter characteristics , and all analyses were performed on this population . necrotic cells were defined as those taking up only 7-aad , and apoptotic cells as those binding annexin v. quadrant boundaries were determined using unstained , as well as positive control cells stained with either 7-aad or annexin v - apc , and statistics were performed based on the relative cell numbers in these quadrants . pmn were incubated with wj - mscs ( wj - msc + pmn , 1:20 ) or medium control ( pmn ) for 24 hours , in the presence or absence of lipopolysaccharide ( 1 g / ml ) and antibodies to icam-1 or il-6 ( 1 g / ml ) nonadherent neutrophils were harvested from the co - culture supernatant , and their purity was confirmed by morphology . viable wj - mscs were identified as adherent to the culture plate after two washes with phosphate - buffered saline . total rna was extracted from neutrophils or wj - mscs , complementary dna generated , and gene expression quantified by real - time polymerase chain reaction using rt2 qpcr master mix ( qiagen ) and amplified using a stratagene mx300p instrument , with -actin as standard . full - length coding sequences were obtained from genbank. primers were designed using primer express software . forward and reverse primers used were : nox-1 , 5-ccttgcaccggtcattcttt-3 and 5-cggtaaaaccggaggatcct-3 ; cox-2 , 5-gcctgatgattgcccgact-3 and 5-gctggccctcgcttatgatct-3 ; ho-1 , 5-gctcaaaaagattgcccaga-3 and 5-gcggtagagctgcttgaact-3 ; catalase , 5-cggagattcaacactgccaa-3 and 5-gaatgcccgcacctgagtaa-3 ; vegf , 5-ggcgtcgcactgaaactttt-3 and 5-tccgaagcgagaacagcc-3 ; tlr4 , 5-ccagagccgctggtgtatct-3 and 5-aactgccaggtctgagcaatct-3 ; -actin , 5-aaagacctgtacgccaacac-3 and 5-gtcatactcctgcttgctgat-3. supernatants from 24-hour cultures of neutrophils and/or wj - mscs were incubated with premixed flex set beads coated with antibodies to il-8 , macrophage inflammatory protein ( mip)-1 , and icam-1 for 1 hour in 96-well filtration plates . premixed phycoerythrin - labeled detection reagent was then added to the wells , and the plates incubated at room temperature in the dark for 2 hours . bead / protein complexes were then washed and analyzed for fluorescence intensity using a bd facsarray bioanalyzer . data were analyzed using bd fcap software ( version 2.0 ) with five parameter curve fitting . measurements from co - cultures ( observed ) were compared with the sum of the measurements from cultures of neutrophils and wj - mscs alone ( expected ) and data are presented as the mean 95% confidence interval . dulbecco s modified eagle s medium , phosphate- buffered saline , and bacterial lipopolysaccharide ( serotype 0128:b12 ) were purchased from sigma chemical company ( st louis , mo , usa ) . ficoll - paque was from ge healthcare ( piscataway , nj , usa ) , and heat inactivated fetal bovine serum was from biosera us ( kansas city , mo , usa ) . annexin v - apc , 7-actinomycin d ( 7-aad ) and cytometric bead array flex sets were from bd biosciences ( san jose , ca , usa ) . rneasy rna purification kits were purchased from qiagen ( chatsworth , ca , usa ) . primers for real time polymerase chain reaction were obtained from integrated dna technologies , inc . ( coralville , ia , usa ) and power sybr green master mix from applied biosystems ( foster city , ca , usa ) . anti - human il-6 and anti - human cd54 ( icam-1 ) were from ebioscience ( san diego , ca , usa ) . these studies were approved by the institutional review board of robert wood johnson medical school . umbilical cord blood samples were collected at the time of delivery of healthy term newborns ( 37 weeks gestation ) by elective cesarean section prior to labor , with tissue - specific informed consent . subjects with clinical evidence of chorioamnionitis , funisitis , or other perinatal infections were excluded . for comparison , neutrophils were isolated from peripheral venous blood of healthy adult volunteers . wj - mscs from nine infants were isolated by peeling the outer membrane of the umbilical cord and dissecting out the arteries and vein , as previously described.12 wj was cut into 13 mm pieces and placed in 10 cm tissue culture dishes . after drying ( 15 minutes ) half of the medium was changed on day 5 , and all media were changed every 3 days subsequently . cells from each subject were treated as a new cell line and tested for purity and expression of characteristic msc markers by flow cytometry . similar to previous reports,13 all nine lines expressed cd105 , cd73 , and cd90 , but not cd45 , cd34 , or cd31 . polymorphonuclear neutrophils ( pmn ) were isolated by dextran sedimentation , ficoll gradient centrifugation , and hypotonic lysis . cells were resuspended in dulbecco s modified eagle s medium containing 10% fetal bovine serum ( 110 cells / ml ) . neutrophil suspensions were incubated with adherent wj - mscs in 24-well plates at 37c , at wj - msc to neutrophil ratios of 1:201:640 for apoptosis studies and 1:20 for analysis of gene and protein expression . cell viability ( defined by absence of uptake of 7-aad fluorescence dye ) was > 97% in all experiments . after 24 hours in co - culture with wj - mscs , neutrophils were washed out of the wells , pelleted , and resuspended in phosphate - buffered saline at 110 cells / ml . triplicate aliquots of cells ( 100 ml ) were then incubated with annexin v - apc ( 1:20 ) and 7-aad ( 1:10 ; 15 minutes , room temperature ) . neutrophils were identified based on forward scatter and side scatter characteristics , and all analyses were performed on this population . necrotic cells were defined as those taking up only 7-aad , and apoptotic cells as those binding annexin v. quadrant boundaries were determined using unstained , as well as positive control cells stained with either 7-aad or annexin v - apc , and statistics were performed based on the relative cell numbers in these quadrants . pmn were incubated with wj - mscs ( wj - msc + pmn , 1:20 ) or medium control ( pmn ) for 24 hours , in the presence or absence of lipopolysaccharide ( 1 g / ml ) and antibodies to icam-1 or il-6 ( 1 g / ml ) nonadherent neutrophils were harvested from the co - culture supernatant , and their purity was confirmed by morphology . viable wj - mscs were identified as adherent to the culture plate after two washes with phosphate - buffered saline . total rna was extracted from neutrophils or wj - mscs , complementary dna generated , and gene expression quantified by real - time polymerase chain reaction using rt2 qpcr master mix ( qiagen ) and amplified using a stratagene mx300p instrument , with -actin as standard . full - length coding sequences were obtained from genbank. primers were designed using primer express software . forward and reverse primers used were : nox-1 , 5-ccttgcaccggtcattcttt-3 and 5-cggtaaaaccggaggatcct-3 ; cox-2 , 5-gcctgatgattgcccgact-3 and 5-gctggccctcgcttatgatct-3 ; ho-1 , 5-gctcaaaaagattgcccaga-3 and 5-gcggtagagctgcttgaact-3 ; catalase , 5-cggagattcaacactgccaa-3 and 5-gaatgcccgcacctgagtaa-3 ; vegf , 5-ggcgtcgcactgaaactttt-3 and 5-tccgaagcgagaacagcc-3 ; tlr4 , 5-ccagagccgctggtgtatct-3 and 5-aactgccaggtctgagcaatct-3 ; -actin , 5-aaagacctgtacgccaacac-3 and 5-gtcatactcctgcttgctgat-3. supernatants from 24-hour cultures of neutrophils and/or wj - mscs were incubated with premixed flex set beads coated with antibodies to il-8 , macrophage inflammatory protein ( mip)-1 , and icam-1 for 1 hour in 96-well filtration plates . premixed phycoerythrin - labeled detection reagent was then added to the wells , and the plates incubated at room temperature in the dark for 2 hours . bead / protein complexes were then washed and analyzed for fluorescence intensity using a bd facsarray bioanalyzer . data were analyzed using bd fcap software ( version 2.0 ) with five parameter curve fitting . measurements from co - cultures ( observed ) were compared with the sum of the measurements from cultures of neutrophils and wj - mscs alone ( expected ) and data are presented as the mean 95% confidence interval . data were analyzed using statistica version 5.5 ( statsoft , inc . , tulsa , ok , usa ) . wj - mscs suppressed neutrophil apoptosis in a dose - dependent manner ( figure 1 ) . wj - msc to neutrophil ratios greater than 1:80 resulted in significant decreases in neutrophil apoptosis over 24 hours , in both adult and neonatal cells , with optimal efficacy at a wj - msc to neutrophil ratio greater than 1:40 . in order to have enough cells for gene expression and protein assays , a ratio of 1:20 was chosen for all experiments . as previously reported,13 apoptosis was significantly reduced in neonatal neutrophils when compared with adult cells , but this difference was not sustained in the presence of wj - mscs . incubation with il-6 or icam-1 blocking antibodies did not affect apoptosis ( not shown ) . nadph oxidase-1 ( nox-1 ) is a membrane - bound enzyme that is important in generating the superoxide anion that drives respiratory burst activity in neutrophils . we found that wj - mscs suppressed nox-1 expression in both adult and neonatal neutrophils ( figure 2 ) . wj - mscs also markedly induced expression of the antioxidant enzyme catalase and suppressed expression of heme oxygenase-1 ( ho-1 ) and vascular endothelial growth factor ( vegf ) , but these changes were significant only in adult cells . effects of wj - mscs on neutrophil expression of the nox-1 gene were decreased by antibodies to il-6 or icam-1 , catalase gene by anti - icam-1 only , vegf by anti - il-6 only , and ho-1 by neither antibody . lipopolysaccharide induced toll - like receptor-4 ( tlr4 ) expression in adult but not neonatal neutrophils ( figure 3a ) . some previous reports have suggested that wj - mscs may be distinguished from other mscs by their hyporesponsiveness to lipopolysaccharide associated with low expression of tlr4.14 consistent with this , we found that lipopolysaccharide did not induce tlr4 in wj - mscs ( figure 3b ) . in contrast , co - culture with adult neutrophils markedly increased tlr4 expression in wj - mscs . cyclooxygenase-2 ( cox-2 ) , which catalyzes the production of inflammatory eicosanoids in neutrophils , is regulated in part by tlr4.15 we found that lipopolysaccharide markedly induced cox-2 expression ( 20-fold ) in adult neutrophils ( figure 3a ) . cox-2 expression in adult neutrophils further increased ( 60-fold ) in the presence of both lipopolysaccharide and wj - mscs . as for tlr4 , neonatal neutrophils were not affected by lipopolysaccharide and/or wj - mscs . while wj - mscs did not express cox-2 in response to lipopolysaccharide or to co - culture with neutrophils , the combination of lipopolysaccharide and adult neutrophils markedly induced generation of cox-2 ( 40-fold ; figure 3b ) . both neutrophils and wj - mscs constitutively produced il-8 ( table 1 ) . consistent with previous reports , production of il-8 was markedly decreased in neonatal neutrophils when compared with adult neutrophils . the combined generation of il-8 by neutrophils and wj - mscs in co - culture was significantly decreased in adult but not neonatal cells . in contrast , expression of mip-1 , another chemokine associated with neutrophil recruitment , by neutrophils and wj - mscs was not affected by co - culture of these cells . expression of icam-1 by neutrophils and wj - mscs was also not significantly affected by co - culture . our finding that wj - mscs suppress neutrophil apoptosis in a dose - dependent manner indicates that the physiologic effects of wj - mscs are similar in some respects to those demonstrated by bm - mscs . previous reports have shown that bm - mscs protect adult neutrophils from apoptosis by triggering stat-3 signaling5 or by decreasing expression of bax , a proapoptotic member of the bcl-2 family.16 bm - mscs secrete mediators ( vegf , transforming growth factor- ) that promote fibroblast activation , angiogenesis , and alteration of tissue architecture , ie , processes that may be facilitated by neutrophils.17 thus , prolonged viability of neutrophils in the presence of mscs may facilitate msc - mediated tissue repair . our findings also suggest that the immunomodulatory effects of wj - mscs do not occur by facilitating neutrophil clearance , but most likely by decreasing their activity . to investigate this , we next quantified the effects of wj - mscs on the expression of pro - oxidant and antioxidant enzymes in neutrophils . neutrophils exert their bactericidal and inflammatory activity , in part , by the release of reactive oxygen intermediates , but prolonged neutrophil activity can cause cytotoxicity.18 nox-1 is expressed in these cells , mediating the transfer of electrons to molecular oxygen to produce the superoxide anion . we found that wj - mscs suppressed nox-1 activity in both adult and neonatal neutrophils , which may serve to modulate oxidative activity and ameliorate potential tissue injury . wj - mscs also induced expression of the antioxidant catalase , but only in adult neutrophils . catalase protects cells from reactive oxygen intermediates by catalyzing the decomposition of hydrogen peroxide to water and oxygen , and its basal expression is decreased in neonatal neutrophils . our observation that catalase is further upregulated in adult cells is consistent with previous reports that mscs ameliorate hepatic injury by upregulating catalase expression in the liver.19 upregulation of catalase may protect adults from neutrophil - mediated cytotoxicity in the presence of wj - mscs , but neonates appear to be resistant to this antioxidant effect . wj - mscs also significantly decreased expression of the anti - inflammatory enzyme ho-1 in adult neutrophils but not in neonatal cells . ho-1 exerts anti - inflammatory effects by upregulating il-10 and il-1r antagonist expression.20 this results in decreased neutrophil rolling and adhesion , as well as transmigration of these cells to inflammatory sites . thus , the relative preservation of ho-1 activity in neonatal neutrophils exposed to wj - mscs may be a marker of preserved immune responses . similarly , wj - mscs suppressed vegf gene expression in adult , but not neonatal cells . vegf is important in physiologic angiogenesis that drives tissue differentiation and growth.8 taken together , the hyporesponsiveness of neonatal neutrophils suggests that interactions between wj - mscs and neutrophils in neonates may be characterized by sustained immune activity and ongoing tissue modeling and repair , whereas those in adult cells are predominantly characterized by suppression of oxidant activity and immunosuppression . in contrast with earlier reports indicating that icam-1 is important in mediating the immunosuppressive effects of bm - mscs,3 antibodies to icam-1 did not alter the effects of wj - mscs on apoptosis or expression of antioxidant or inflammatory mediators in neonatal neutrophils . thus , icam - mediated cell contact is not likely an obligatory pathway for these effects . it is possible that this represents a mechanistic distinction between bm - mscs and wj - mscs . alternatively , our findings are consistent with previous studies reporting that the biologic effects of mscs are mediated by soluble mediators , rather than direct contact.21,22 however , blocking antibodies to il-6 also had no effect on wj - msc - mediated changes in neonatal neutrophil apoptosis or secretory activity . it is possible that mscs exert paracrine effects via membrane - bound exosomes containing multiple soluble mediators affecting inflammatory and oxidative activity.23 tlr4 expression in neutrophils was upregulated by lipopolysaccharide in adult neutrophils , and this was not affected by wj - mscs . previous studies have suggested that wj - mscs are distinct from bm - mscs in that they do not express tlr4 and are nonresponsive to lipopolysaccharide.24 however , co - culture with adult neutrophils markedly upregulated expression of tlr4 in wj - mscs . this may represent a biologically relevant trigger for inflammation in adults , since tlr4-primed mscs can differentiate into a phenotype ( msc1 ) characterized by secretion of proinflammatory mediators.25 this pathway appears to be developmentally impaired in neonatal neutrophils , which do not upregulate tlr4 expression and do not induce it in wj - mscs . cox-2 expression is regulated in part by tlr4.15 bm - mscs bind lipopolysaccharide via surface tlr4 receptors , initiating a signaling cascade involving sequential activation of nf-b and upregulation of cox-2 production.26 we found that gene expression of cox-2 by wj - mscs is markedly upregulated in the presence of adult neutrophils and lipopolysaccharide , but not of either of those alone . similarly , cox-2 is induced in adult neutrophils by lipopolysaccharide , and significantly further increased by wj - mscs . our findings suggest that wj - mscs and neutrophils generate prostaglandins or other eicosanoids under inflammatory conditions , but that these signaling pathways are developmentally impaired in neonates . we also found that wj - mscs and adult neutrophils in co - culture generate significantly less il-8 than they do alone . il-8 is a chemokine that activates neutrophil calcium mobilization and chemotaxis,27,28 so this may represent a mechanism for immunomodulation by wj - mscs . in contrast , wj - mscs did not affect the generation of icam-1 or the chemokine mip-1 in either adult or neonatal neutrophils . icam-1 mediates transendothelial migration of neutrophils , and mip-1 is secreted in large quantities by lipopolysaccharide - activated neutrophils.29 our finding that wj - mscs do not affect expression of il-8 , icam-1 , or mip-1 in neonatal neutrophils suggests that wj - mscs may not suppress neutrophilic inflammation in this population as anticipated . hospitalized premature neonates are susceptible to diseases characterized by excessive inflammation , including bronchopulmonary dysplasia , and msc - based therapies are thought to have potential in preventing or ameliorating these conditions . animal studies of such therapies have shown efficacy in conditions including sepsis30 and acute lung injury,31 and initial trials in human neonates32 and adults33 have indicated feasibility and possible efficacy in bronchopulmonary dysplasia and chronic lung disease , respectively . in the current studies , wj - mscs suppressed apoptosis and dampened oxidative , vascular , and inflammatory activity by adult neutrophils , but neonatal neutrophils were less responsive . conversely , tlr4 and cox-2 were upregulated in wj - mscs only when they were co - cultured with adult neutrophils , suggesting an inflammatory msc phenotype that is not induced by neonatal neutrophils . moreover , wj - mscs suppressed apoptosis of both adult and neonatal cells . in summary , wj - mscs may alter neutrophilic inflammation in adults and neonates via pathways that are distinct . these effects should be carefully considered and tested in clinical trials before wj - msc - based - therapy is promoted for prophylaxis or treatment in infants . | backgroundmesenchymal stem cells ( mscs ) have been proposed as autologous therapy for inflammatory diseases in neonates .
mscs from umbilical cord wharton s jelly ( wj - mscs ) are accessible , with high proliferative capacity .
the effects of wj - mscs on neutrophil activity in neonates are not known .
we compared the effects of wj - mscs on apoptosis and the expression of inflammatory , oxidant , and antioxidant mediators in adult and neonatal neutrophils.methodswj-mscs were isolated , and their purity and function were confirmed by flow cytometry .
neutrophils were isolated from cord and adult blood by density centrifugation .
the effects of neutrophil / wj - msc co - culture on apoptosis and gene and protein expression were measured.resultswj-mscs suppressed neutrophil apoptosis in a dose - dependent manner .
wj - mscs decreased gene expression of nadph oxidase-1 in both adult and neonatal neutrophils , but decreased heme oxygenase-1 and vascular endothelial growth factor and increased catalase and cyclooxygenase-2 in the presence of lipopolysaccharide only in adult cells .
similarly , generation of interleukin-8 was suppressed in adult but not neonatal neutrophils .
thus , wj - mscs dampened oxidative , vascular , and inflammatory activity by adult neutrophils , but neonatal neutrophils were less responsive .
conversely , toll - like receptor-4 , and cyclooxygenase-2 were upregulated in wj - mscs only in the presence of adult neutrophils , suggesting an inflammatory msc phenotype that is not induced by neonatal neutrophils.conclusionwhereas wj - mscs altered gene expression in adult neutrophils in ways suggesting anti - inflammatory and antioxidant effects , these responses were attenuated in neonatal cells .
in contrast , inflammatory gene expression in wj - mscs was increased in the presence of adult but not neonatal neutrophils .
these effects should be considered in clinical trial design before wj - msc - based therapy is used in infants . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tear film ( tf ) constantly protects the exposed surface of the eye , the cornea , and the conjunctiva from environmental stresses including desiccation , temperature change , physical injury , and infections . by providing optimal concentrations of electrolytes , proteins , mucin , and lipids , dry eye disease ( ded ) is a multifactorial dysfunction of the tf , resulting in symptoms of discomfort , visual disturbance , and even loss of vision due to damage to the ocular surface . ded is generally acknowledged to be , in large part , due to reduced secretion or increased evaporation of the tear fluid , resulting in subsequent increase in osmolarity and inflammation at the ocular surface . since ded represents a diverse group of conditions that manifest as inadequate ocular surface lubrication , restoration of a sufficient tear volume remains the mainstay of current dry eye ( de ) treatment . although lacrimal gland ( lg ) is considered the main source of tears , increasing evidence suggests that under certain conditions conjunctival epithelium has the capacity to be the primary source of tf . removal of the main lg of squirrel monkeys does not lead to keratoconjunctivitis sicca ( kcs ) . in humans , up to 86% of patients with epiphora who underwent palpebral dacryoadenectomy ( pda ) did not develop de , and in up to 50% of such patients the epiphora persisted [ 5 , 6 ] . although accessory lgs were believed to be mostly responsible in these cases , the conjunctiva certainly plays a role as a compensatory tissue . the human conjunctiva occupying 17 times more surface area than the cornea has the potential to be the primary modulator of tear volume and component . we are interested in understanding the physiology of conjunctival epithelium so as to maximize its fluid secretion capacity as an alternative to ded treatment . a rabbit model with intact conjunctiva and equal de phenotype bilaterally is ideal in such research . we created a de model in rabbits by surgical excision of the nictitating membrane ( nm ) , harderian gland ( hg ) , and main lg . although de associated ocular surface phenotype and inflammatory biomarkers elevated in the immediate postoperative period , they gradually decreased over 4-month duration to near preoperative level without therapeutic intervention . these findings suggest that the rabbit ocular surface can potentially compensate for the loss of these seemingly vital ocular surface structures , including the main lg . the results also indicate that , in acute de condition ( as created in our experiment ) , ocular surface injury and inflammation can be mostly reverted . to gain further insight into the exact mechanisms of conjunctiva mediated tear compensation , the present study further explored methods of conjunctival characterization in this mixed mechanism rabbit de model . male new zealand white rabbits ( n = 8 , 16 eyes , harlan sprague dawley , indianapolis , in , usa ) weighing 2.02.5 kg were used for this study . the rabbits were reared under standard laboratory conditions ( 22 2c , 40% 5% relative humidity , and a 12-hour light - dark cycle ) with free access to food and water throughout the experiment . the study was conducted in compliance with the tenets of the declaration of helsinki and arvo statement for the use of animals in ophthalmic and visual research . the protocol was approved by the university of arizona ( tucson , az , usa ) institutional animal care and use committee ( protocol # 14 - 511 ) . the surgical protocol for resection of main lg , hg , and nm was published previously which was modified from established procedures [ 9 , 10 ] . the rabbits were assessed before excision ( be ) and after excision ( ae ) . to minimize slit lamp finding artifact from other tests , the evaluations were carried out in two days in the following sequence of each eye . the first day begins with corneal fluorescein test , followed immediately by rose bengal staining and cic . on the second day , schirmer tests , without ( schirmer i test , sit ) and with anesthesia ( schirmer ii test , siit ) , were performed separately in the morning and afternoon . the eyes of all rabbits were examined under a slit lamp microscope ( gr-54 , gilras llc , miami , fl ) by the same ophthalmologist ( yn ) following protocol described previously . both sit and siit were carried out in our study . one drop of 0.5% proparacaine hydrochloride ( bausch and lomb , tampa , fl , usa ) was placed and the excess fluid was blotted away with soft paper tissue , prior to the insertion of the filter paper strips ( alcon laboratories , inc . , fort worth , tx , usa ) in the lower lateral one - third of conjunctival fornix and eyelids closed by gentle force for 5 mins . the filter paper discs were peeled off and immediately placed in either 500 l trizol solution ( invitrogen , ca , usa ) for rna isolation or 100 l of radio immunoprecipitation assay ( ripa ) buffer ( teknova , ca , usa ) for protein isolation . total rna was isolated from the cic specimens in trizol solution according to manufacturer 's instructions ( invitrogen , ca , usa ) . rna concentrations were estimated by nanodrop nd-1000 spectrophotometer ( nanodrop technologies , wilmington de , usa ) in 1 l volume . purity of the rna was assessed by the ratio of absorbance at 260/280 nm . a ratio of 1.9 to 2 was considered to be good quality rna specimen and used for further experiments . the first strand of cdna was synthesized with quantitect reverse transcription kit ( qiagen , valencia , ca , usa ) using 500 ng total rna according to the manufacturer 's instructions . the rt - qpcr reactions were set using sybr green pcr master mix ( applied biosystems , foster city , ca , usa ) according to manufacturer 's instructions . the primer sequences for muc5ac were as follows : muc5ac - f : ccccaacgtcaagaacaact and muc5ac - r : tcaaacaggcagttcgagtg . the rt - qpcr was performed on steponeplus real - time pcr system ( applied biosystems ) with the following cycling conditions : 15 min 95c , 40 cycles of 15 sec 95c , and 30 sec 60c . a melting curve analysis was performed at the end of each pcr by gradually increasing the temperature from 60 to 95c while recording the fluorescence . a single peak at the melting temperature of the pcr product confirmed primer specificity . to compare between different runs , a fixed fluorescence threshold for derivation of ct value for all runs relative quantification of muc5ac expression in rabbit cic specimens was performed be and 1 month ae . the fold change in muc5ac expression was relative to the internal housekeeping gene , -actin ( endogenous control ) . mean fold change in muc5ac expression was calculated using 2 method , where ct = ( ctgene ctactin)after excision ( ctgene ctactin)before excision . difference between ct for muc5ac and -actin mrna in each specimen was used to calculate level of target mrna relative to that of -actin mrna in the same specimen . total cell lysate proteins were isolated from cic in radio immunoprecipitation assay ( ripa ) buffer with 1x halt protease and phosphatase inhibitor single use inhibitor cocktail ( thermoscientific , rockford , il , usa ) by incubating on ice for 30 min . protein concentration was determined by pierce bca protein assay kit ( thermo fisher scientific , ny ) . hercules , ca , usa ) containing -mercaptoethanol and heated at 95c for 10 min . the primary rabbit monoclonal antibodies to il-1 , tnf- , and muc5ac ( abcam , cambridge , ma , usa ) were used at a dilution of 1 : 200 . to test the effects of epithelial sodium channel ( enac ) blockers on tear secretion , amiloride and benzamil were administered topically to the right eyes ( n = 8) of the operated rabbits 2 months ae . a 0.1% of amiloride and benzamil ( both from sigma - aldrich , inc . louis , mo , usa ) were prepared in sterile buffered saline solution ( bss ) and tested in separate experiments . the right eyes were allocated to enac blockers and left eyes to bss as control . a 50 l of enac blocker eye drops or bss was instilled into the lower conjunctival sac by a micropipette at the beginning of the experiments . siit was performed before and at 5 min , 15 min , 30 min , 60 , and 90 min after application of amiloride or benzamil . potential difference ( pd ) is generated by electrogenic cl secretion and na reabsorption across superficial cell apical membrane of the corneal and conjunctival epithelia . pd measurement is a sensitive modality in detecting transepithelial electrolyte conductance at the ocular surface . therefore , to help delineate the underlying physiological change which contributes to the increased output of tears by the rabbit conjunctiva ae , open - circuit pd was measured with a method modified from a previously established protocol in mice . briefly , the rabbits were anesthetized with 100 mg / kg ketamine and 10 mg / kg xylazine ( sigma - aldrich , mo , usa ) and placed on a heating pad in a stereotaxic device with conjunctival and corneal tissues exposed and faced upwards . two different solutions were perfused in series over the ocular surface at a rate of 10 ml / min using a pinch valve perfusion system ( ps-8h ; bioscience tools , san diego , ca , usa ) and peristaltic pump ( 13 - 876 - 1 ; fisher scientific , pittsburgh , pa , usa ) with 1/16 inner - diameter plastic tubing . first , phosphate - buffered saline ( 1x pbs ) was perfused for 5 min to establish a stable baseline , and then 100 m amiloride ( sigma - aldrich ) prepared in 1x pbs was perfused . a low powered wall vacuum attached to 1/16 i d tubing was placed next to the fluid bolus covering the ocular surface to keep the volume constant and avoid fluid runoff . the pds were measured with a high - impedance digital voltmeter , isomilivolt meter ( world precision instruments , sarasota , fl , usa ) with two ag / agcl electrodes connected through a 1 m kcl agar bridge . one probe was placed in contact with the ocular fluid , and the other was placed subcutaneously in the rabbit 's mid - back . the pds were measured on operated rabbit eyes ( n = 4 ) 5 months ae and compared with normal rabbit eyes ( n = 4 ) as controls . data in figures are presented as mean standard error method , the bars representing standard errors . statistical significance between two groups ( be and ae ) was evaluated using unpaired 2-tailed t - test . a probability of p equal to 0.05 was considered significant ( where applicable , p < 0.05 , p < 0.01 , and p < 0.001 ) . the spearman correlation analysis was employed to determine the correlation between every pair of the tests performed , be and ae . in addition , massive hemorrhage tends to occur while excising the hg from between the medial rectus muscle and the anterior orbital wall . less hemorrhage and improved visibility of the surgical field ensured complete ablation of the hg ( figure 1 ) . however , a 5 mm palpebral conjunctival incision was made in their study to extract lobes of the main lg . in our experience , such a small incision would not permit adequate access to all lobes of the lg , especially the intraorbital lobe , which is deeply embedded beneath the lateral orbital rim and separated by a dense membranous connective tissue from the superficial temporal lobe . no additional conjunctival incision was necessary in our procedure and hence the entire conjunctival surface is preserved . the skin incision only needed to cover the lateral two - thirds of the orbital rim in order to have a good exposure to adequately remove the infraorbital , temporal , and intraorbital lobes of the lg . a rabbit model with intact conjunctiva and equal de phenotype bilaterally is ideal for our research to comparatively assess modalities that potentially stimulate conjunctival fluid secretions . as compared to be , both fluorescein and rose bengal staining increased on the cornea and conjunctiva ( figure 2 ) 1 month ae . < 0.0001 in both ) demonstrated the presence of de phenotype at the ocular surface . for all tests conducted , there were no significant differences found as a function of left versus right eye . in our study , large variations were noted in both schirmer tests among eyes tested either be or ae . with both sit ( p = 0.104 ) and siit ( p = 0.478 ) , no significant reduction in tear production was seen 1 month ae ( figure 3 ) . there was , however , significant difference between the sit and siit ( p < 0.0001 ) either be or ae , with tear secretion being lower under topical anesthesia . the protein levels of ded associated inflammatory cytokines ( tnf- and il-1 ) increased 1 month ae ( figure 4 ) which corroborated with the mrna levels of the inflammatory cytokines as reported previously . increase of conjunctival epithelium encoded goblet cell - specific muc5ac at mrna and protein levels were observed 1 month ae ( figure 4 ) . the two enac blockers did not increase tear secretion in our rabbit de model as measured by siit ( figure 5 ) . the pd measurements for the 10 seconds before the perfusion system was switched from pbs to amiloride channel were 272 6 mv for rabbit eyes in the operated group ( n = 4 ) and 159 3 mv for the control group ( n = 4 ) . after the ocular surface was perfused with amiloride , the 10-second average pd reached 133 4 mv in the operated eyes and 90 4 mv in the control eyes . the magnitude of depolarization was statistically larger ( p < 0.05 ) in the operated eyes than in the control eyes ( figure 6 ) . using spearman correlation analysis , higher siit scores are closely associated with lower rose bengal test scores ( negatively correlated , correlation coefficient = 0.57 , p = 0.02 ) . additionally , rt - qpcr of il-1 and tnf- were significantly correlated ( correlation coefficient = 0.72 , p = 0.02 ) . the changes of inflammatory biomarkers did not correlate with that of the clinical tests ( fluorescein staining , rose bengal staining , and schirmer tests ) . in our study , as expected , the rabbits showed increased fluorescein and rose bengal staining of the ocular surface 1 month ae , characteristic of de phenotype . interestingly , no significant reduction was found in tear secretion by schirmer tests as compared to be . possible explanations as to why no significant reduction in tear secretion was seen after resection of the lg , hg , and nm have been extensively discussed in a separate publication . it has been assumed that accessory lgs are responsible for the remaining tear secretion capacity in the absence of the main lg [ 6 , 15 ] . however , increasing evidence supports the notion that the conjunctiva can be an important contributor [ 5 , 8 , 16 , 17 ] . the accessory lgs are embedded in the conjunctiva , and hence the surface area of conjunctiva is substantially larger than the sum of secreting acinar cell surface area of the accessory lgs . it is not unreasonable to assume that conjunctiva contributes substantial amount to the tear volume in the absence of main lg . significant difference between sit and siit scores in our rabbit model suggests that sensory regulation of the ocular surface plays an important role . since accessory lgs have similar functions and innervations as the main lg , they are assumed to be under identical reflex control . although a local transcellular osmotic mechanism is believed to govern the fluid and electrolyte transport fluid secretion by the conjunctiva can also be stimulated . the presence of parasympathetic nerves in rat conjunctiva and increased conjunctiva cl and fluid secretion by sympathomimetic agonists [ 22 , 23 ] suggests that neural influence of conjunctiva secretion can not be ruled out . and if so , local anesthesia of the secretory nerve terminals could also suppress the secretion output of the conjunctival epithelium . differences between scores of sit and siit in our study could reflect , at least to a large extent , the basal level tear secretion from accessory lgs and the conjunctiva , whereas it is very difficult , if not impossible , to determine the proportion of contributions from accessory lgs or conjunctiva to the remaining tear secretion capacity . tear breakup time and corneal / conjunctiva staining are extremely difficult to evaluate objectively , especially in small animals . correlations between clinical symptoms , signs of de , and diagnostic test results have been disappointing as well [ 2529 ] . in our study , poor correlation among the clinical tests ( fluorescein staining , rose bengal staining , and schirmer tests ) is consistent with previous studies . molecular biomarker based diagnostics , on the other hand , can offer a standardized , objective , and precise measurement of the status of ocular diseases and should be used as adjuncts when possible . ded associated ocular surface inflammation is caused by increased level of inflammatory cytokines ( il-1 , il-6 , tnf- , and il-17 ) in tear fluid , corneal / conjunctival epithelia , and increased infiltration of dendritic and t - cells in conjunctiva . in our studies , removal of main lg , hg , and nm led to inflammatory responses at the ocular surface as depicted by increased mrna and protein levels of tnf- and il-1. rabbits with sham surgeries did not show significant increase in biomarker mrna and protein ( data not shown ) , suggesting that persistent elevation of these markers 1 month ae is not a direct result of surgical procedure itself . although there was no significant change in tear production at 1 month ae , biomarker evaluations confirmed the increased inflammation which corroborated with the presence of de phenotype at the ocular surface . our data is consistent with solomon et al . who demonstrated that de is associated with increased production of proinflammatory cytokines ( il-1 and tnf- ) in conjunctiva . to the best of our knowledge , overexpression of goblet cell - specific muc5ac in response to acute de condition created by surgery is a novel finding in our study . in association with the persistent normal level of tear secretion , muc5ac overproduction likely contributed to the spontaneous recovery of ocular de phenotype with time in our rabbit de model . noted reduced conjunctival goblet cell density in their rabbit de model after cauterizing the lg excretory duct and surgically removing the nm and hg , whereas with mucin - specific staining , we were not able to discern any changes in the number or morphology of goblet cells in cic specimens be and ae . the exact mechanisms of goblet cell mucin regulations in our rabbit de model await further investigation . we isolated both total rna and protein from cic specimens , a rapid , convenient , and minimally invasive technique to collect one to three layers of cells from bulbar conjunctival surface . the cic has been widely performed on subjects to confirm a variety of ocular surface diseases and monitor changes at conjunctival surface . total rna and protein isolated from cic specimen detected subtle changes in mrna and protein levels of the ded associated cytokines ( tnf- and il-1 ) and muc5ac . biomarkers provided objective and quantitative data that significantly enhanced the characterization of rabbit ocular surface pathology . one cic specimen per eye at a specific time point offered sufficient high quality total rna and protein for analyzing several genes without sacrificing the animals . shi and candia concluded that the electrogenic na reabsorption across rabbit conjunctiva was amiloride - insensitive , indicating the important roles played by na dependent cotransporters such as those carrying glucose and amino acids in series with the basolaterally located na - k pump . recently demonstrated increased tear secretion as measured by schirmer test after the application of amiloride at the rabbit ocular surface . even using more potent enac inhibitor , benzamil , no significant increase in tear production was seen in the present study . we concluded that schirmer test , given its large variation between measurements , may not be sensitive enough to detect subtle change in tear production . therefore , we further assessed the baseline ocular pd and its response to the application of amiloride in rabbit eyes with and without surgery . significantly higher ( more negative ) pd in the operated rabbit eyes was noted in comparison to eyes without surgery . since electrogenic cl secretion and na reabsorption across superficial cell apical membrane of the corneal and conjunctival epithelia contribute to the pd , the ocular surface tissues must have reached a new equilibrium of higher cl secretion and/or na reabsorption . higher magnitude of pd depolarization in the operated eyes in response to the application of amiloride indicates the presence of an elevated amiloride - sensitive na conductance ( reabsorption ) across the epithelia . although amiloride - insensitive higher na reabsorption mechanism could not be measured in the study , it presumably exists . likewise , a higher cl conductance ( secretion ) most probably is present as well . our pd measurements demonstrate electrophysiological support of higher tear output across the ocular surface in rabbit eyes without lg , hg , and nm . to summarize , in this rabbit ded model , although schirmer tests were unchanged be and ae , analysis of biomarkers corroborated with the clinical examination findings and confirmed the development of de condition . assessing ded pertinent biomarkers enhanced the results obtained from standard clinical tests and is a valuable addition to the tools of ocular surface evaluation . it was interesting to note the elevated muc5ac expression in the acute de condition created by surgery but its mechanism requires further investigation . no measurable increased tear secretion was detected with schirmer test with topical application of amiloride in rabbit eyes ae . however , the open - circuit pd measurement provided a sensitive modality to detect the underlying electrophysiological changes at the rabbit ocular surface ae . | purpose . to assess the conjunctival functionality in a rabbit dry eye ( de ) model . methods . nictitating membrane , lacrimal and harderian glands
were surgically excised from male new zealand white rabbits using minimally invasive surgery .
fluorescein / rose bengal staining of ocular surface ( os ) and schirmer test were done before ( be ) and after excision ( ae ) .
the expression of interleukin- ( il- ) 1 , tumor necrosis factor- ( tnf- ) , and muc5ac proteins were estimated by immunoblotting from conjunctival impression cytology specimens .
muc5ac mrna was quantified as well .
the effect of epithelial sodium channel ( enac ) blockers on tear production and potential differences ( pd ) of os were assessed under anesthesia in rabbits with and without surgery .
results .
increase in corneal and conjunctival staining was observed 1 month ae compared to be .
schirmer tests failed to show decrease in tear production .
elevated il-1 , and tnf- , 1 month ae indicated inflammation .
muc5ac expression was elevated 1 month ae .
enac blockers did not improve tear production in rabbit eyes ae but characteristic changes in pd were observed in rabbits with surgery
. conclusions .
de biomarkers are important tools for os assessment and muc5ac expression is elevated in rabbit de .
pd measurement revealed significant electrophysiological changes in rabbits with surgery . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
association of dyslipidemia with the development of cardiovascular disease ( cvd ) is well established and guidelines for management of the condition have already been issued [ 15 ] . serum total cholesterol other than its subtypes is usually used as a measure for monitoring at the population level , especially in developing countries . in the past few decades , data from several countries reported a high prevalence of dyslipidemia and unsatisfactory results of dyslipidemia management [ 612 ] . recently , a multicountry analysis of national health examination survey data from eight countries on various continents reported disappointing findings of low detection and inadequate management of high serum cholesterol , particularly among middle - income countries . among these countries , thailand in 2004 had the highest ( 78% ) percentage of unawareness of hypercholesterolemia , with markedly low percentages of treatment and control . in clinical practice , low - density lipoprotein cholesterol ( ldl - c ) is usually the primary target for lipid management . recent studies suggest that low hdl - c and high triglycerides also confer residual risk for cvd [ 13 , 14 ] . however , there is no thai data on the prevalence of other lipid parameters for example , high - density lipoprotein cholesterol ( hdl - c ) , non - hdl - c , ldl - c , and triglycerides in the general population , with and without cvd risk factors . previous studies on the percentage of attaining ldl - c goals recommended by the third adult treatment panel ( atp iii ) cholesterol guidelines in 2001 were based on hospital data [ 1517 ] . the fourth national health examination survey conducted in 2009 ( nhes , 2009 ) was the first national survey in thailand by which major lipid parameters including total cholesterol , hdl - c , and triglyceride were measured . the present study aimed to document the distribution of lipid parameters and prevalence of dyslipidemia among thai adults aged 20 years old according to age , sex , area of residence , and geographic region . this report could provide useful information for prevention and control of dyslipidemia as well as baseline data for monitoring and evaluation at the national level . the survey was approved by the ethical review committee for research in human subjects , ministry of public health . briefly , it was based on a multistage probability sampling technique where sampling units in each of the four stages were ( 1 ) five provinces in each of the four main regions ( north , northeast , central , and south ) and bangkok , ( 2 ) two to three districts in each selected province , ( 3 ) 13 - 14 enumeration units ( eu)/villages in each district , and ( 4 ) individuals among six age groups ( 1529 , 3044 , 4559 , 6069 , 7079 , and 80 years ) of each gender from each eu / village . the present analysis omitted adolescents ( age < 20 years ) , keeping 9,021 men and 10,000 women in the study . urban area was defined by the thai national statistical office as a municipal area in each province , including the entire bangkok metropolis and officially designated sanitary district which is a locality achieving a minimum population size and density and income , and the remainders of the country were rural areas . key variables included demographic data , behavioral risk factors , medical history of previously diagnosed diabetes , hypertension , and high blood cholesterol ; and whether on medication . blood pressure was measured using a standardized automatic blood pressure monitor ( model a100 ; microlife , taipei , taiwan ) . each participant was seated for at least 5 min before the first reading of three serial measurements of blood pressure taken 1 min apart while in a sitting position . venous blood samples were obtained from participants in the morning after fasting 12 h overnight . serum samples were frozen and transferred to a central laboratory in ramathibodi hospital , mahidol university , bangkok . serum total cholesterol and triglycerides were analyzed using enzymatic colorimetric methods ( chod - pap and gpo - pap , resp . ) . high - density lipoprotein cholesterol ( hdl - c ) was measured using homogeneous enzymatic colorimetric method . low - density lipoprotein cholesterol ( ldl - c ) was calculated based on the friedewald formula for subjects with triglycerides < 4.5 mmol / l ( 400 mg / dl ) and was directly measured by enzymatic method for those having triglycerides 4.5 mmol / l ( 400 mg / dl ) . all lipid measurements were carried out using a hitachi 917 biochemistry analyzer ( roche diagnostics , basel , switzerland ) . the laboratory was standardized according to the criteria of the lipid standardization program of the centers for disease control and prevention and the national heart , lung , and blood institute . recommended lipid levels were classified based on the guidelines of the adult treatment panel iii ( atp iii ) of the national cholesterol education program [ 1 , 2 ] . for estimation of coronary heart disease ( chd ) risk , we used the world health organization ( who ) risk prediction charts for southeast asian countries ( sear b ) including thailand to assign the 10-year chd risk . variables used to categorize chd risk included sex , age , diabetes status , systolic blood pressure , smoking status , and total cholesterol level . low hdl - c was defined as hdl - c < 1.03 mmol / l ( 40 mg / dl ) in men and < 1.30 mmol / l ( 50 mg / dl ) in women . the cutoff points for high ldl - c were defined as follows : high risk , ldl - c 100 mg / dl if having prior chd or chd equivalent or having 10-year chd risk > 20% ; moderate risk , ldl - c 130 mg / dl if having 2 risk factors ( rf ) and/or 10-year chd risk 10% to 20% ; and lower risk , ldl - c 160 mg / dl if having 0 - 1 rf . other major independent risk factors , according to atp iii , include smoking , hypertension ( systolic blood pressure 140 mmhg or diastolic blood pressure 90 mmhg or on antihypertensive medication ) , low hdl - c ( < 40 mg / dl ) , family history of premature chd , or chd in a first - degree relative ( men < 55 yrs and women < 65 yrs ) , and age ( men 45 yrs and women 55 yrs ) . if a person has high hdl - c ( 60 mg / dl ) , then one rf would be subtracted from the count . high non - hdl - c was defined based on the chd risk similar to high ldl - c , with cutoff points for non - hdl - c of 190 , 160 and 130 mg / dl corresponding to ldl - c levels of 160 , and 130 and 100 mg / dl , respectively . diabetes was defined as having a previous diagnosis of diabetes by a physician and currently taking hypoglycemic drugs during the prior two weeks , or those having fasting plasma glucose 7.0 mmol / l ( 126 mg / dl ) . hypertension was defined as systolic blood pressure ( sbp ) 140 mmhg or diastolic blood pressure ( dbp ) 90 mmhg , or use of blood pressure - lowering medication . in order to explore the picture of isolated and combined abnormal lipid parameters , a mixed dyslipidemia condition was categorized into eight groups as follows : ( 1 ) isolated high ldl - c ; ( 2 ) isolated low hdl - c ; ( 3 ) combined high ldl - c and low hdl - c ; ( 4 ) isolated high triglycerides ( > 2.26 mmol / l , 200 mg / dl ) ; ( 5 ) combined high ldl - c and high triglycerides ; ( 6 ) combined low hdl - c and high triglycerides ; ( 7 ) combined high ldl - c , low hdl - c , and high triglycerides ; and ( 8) no dyslipidemia . for calculation of awareness , treatment and control of high ldl - c , subjects who answered yes to the question have you ever been told by a health professional or physician that you had high blood cholesterol ? were considered to be aware of the condition . undergoing treatment for high blood cholesterol was defined as an affirmative response to the question have you taken medication for lowering blood cholesterol in the past two weeks ? we calculated the percentage of individuals who were aware of the condition . the percentage of treatment was calculated for all participants with high ldl - c and for those aware of the condition . the percentage of controlled ldl - c was calculated for all participants with high ldl - c and for those receiving treatment . all lipid parameters were presented as age - adjusted arithmetic mean , except triglycerides for which geometric mean was calculated due to the skewed distribution . the age - adjusted prevalences of high ldl - c , low hdl - c , and high triglycerides were calculated overall and for subgroups according to age group , sex , area of residence , geographic region , and educational level , as well as for those with comorbidity of diabetes or hypertension and according to chd risk categories . we also calculated the age - adjusted prevalence of mixed dyslipidemia for men and women . all comparisons were age- and sex - standardized to the national population in 2008 . adjusted wald tests we used linear regression to evaluate linear trend of each lipid parameter level by age groups and chd risk stratification , and reported the p value for trend . for evaluation of trends in prevalence of each lipid abnormality by age group and chd risk , logistic regression model was used . all of the analyses were performed using stata statistical software version 10 ( statacorp , college station tx , usa ) . table 1 shows the age - adjusted means ( se ) of total cholesterol , hdl - c , non - hdl - c and ldl - c , total cholesterol to hdl - c ratio ( tc / hdl - c ) and geometric mean of triglycerides among thai adults aged 20 yrs . overall , the age - adjusted means of total cholesterol , hdl - c , non - hdl - c , and ldl - c ( but not triglycerides and tc / hdl - c ) were higher in women than in men ( all p < 0.001 ) as well as in urban areas compared with rural areas ( all p < 0.01 ) . all lipid levels , except hdl - c , were higher in men of middle age ( 3559 yrs ) and in women of older age ( 60 yrs ) . individuals who resided in bangkok , south and central regions , had higher levels of ldl - c , non - hdl - c , and hdl - c but had lower levels of triglycerides than those living in the northern and northeastern regions . individuals with diabetes or hypertension had a markedly higher level of triglycerides than those without these conditions ( all p < 0.01 ) . those with higher chd risk were more likely to have unfavorable levels of hdl - c and triglycerides compared with those categorized as low chd risk . figure 1 displays the age - adjusted prevalence of dyslipidemia by area of residence and sex . overall , the age - adjusted prevalence of high ldl - c and of high non - hdl - c were similar for men and women . women had higher prevalence of low hdl - c but lower prevalence of high triglycerides compared with men ( p < 0.01 ) . urban residents had higher prevalence of both high ldl - c and high non - hdl - c , whereas rural residents had higher prevalence of low hdl - c . for high triglycerides , the prevalence in urban / rural areas differed by sex ; there was no significant difference between urban and rural areas among men , but the prevalence was higher for women in rural areas compared with their counterparts in urban areas . figure 2 shows the age - adjusted prevalence of dyslipidemia for each parameter and the combined lipid parameters for men and women . overall , 22.2% had isolated low hdl - c ( 14.2% in men versus 31.2% in women , p < 0.05 ) , 12.8% had isolated high ldl - c ( 15.2% in men versus 10.4% in women ) , 4.2% had high triglycerides ( 7% in men versus 1.5% in women ) , and 4.8% had a combination of three lipid abnormalities ( 4.7% in men versus 4.9% in women ) . about 6% of men and 13.5% of women had combined low hdl - c and high ldl - c , while 10.6% of men and 9% of women had combined low hdl - c and high triglycerides . the prevalence of high ldl - c combined with high triglycerides was 3.5% in men and 1.2% in women . thus , 33.5% of thai adults had no dyslipidemia ( 38.7% of men and 28.3% of women ) . table 2 shows that people in the northeast tended to have higher prevalence of high triglycerides and low hdl - c , whereas people in the south and bangkok tended to have higher prevalence of high ldl - c but lower prevalence of low hdl - c . individuals with diabetes or hypertension had higher percentages of dyslipidemia including high ldl - c and high triglycerides . men with diabetes and women with hypertension were more likely to have higher prevalence of low hdl - c compared with those without the conditions . table 3 shows the age - adjusted prevalence of awareness , treatment , and control of high ldl - c . overall , 17.8% of those with high ldl - c were aware that they had high ldl - c , and the percentages of treated and controlled among all individuals with high ldl - c were markedly low ( 11.7 and 6.3% , resp . ) . however , among those aware of their condition , 60.6% overall were treated ; of those treated , 57.6% had ldl - c at recommended levels . low percentages of awareness and treatment were observed for all characteristics ; the percentages were slightly higher among individuals in urban areas compared with those in rural areas and also were higher in bangkok compared with other regions . note that the percentages of treatment among those aware of their diagnosis were higher for those with diabetes , hypertension , or high risk of chd than those without these conditions ; however , the percentages of controlled among those treated were the opposite . there were significantly different patterns of lipid abnormality by sex , urban / rural areas , and geographic regions . high ldl - c was more prevalent in individuals residing in urban areas than in rural areas , and also was more common in bangkok , the south and central regions , than in the north and northeast , where people were more likely to have lower hdl - c and high triglyceride levels . the prevalence of dyslipidemia was also worse among those with comorbidity of diabetes , hypertension , and increased chd risk . the present study also revealed that 8 in 10 of the individuals with high ldl - c remained unaware and not treated . compared with the lipid levels of the u.s . population in 20072010 , thai people have higher levels of tc ( 206 versus 196 mg / dl ) , ldl - c ( 128.7 versus 116 mg / dl ) , non - hdl - c ( 158.5 versus 144 mg / dl ) , and triglycerides ( geometric mean , 131.45 versus 110 mg / dl ) but lower hdl - c ( 46.93 versus 52.5 mg / dl ) [ 7 , 22 ] . the current cholesterol levels of the thai population are comparable to the levels in the u.s . in 19881994 . the level of hdl - c in the thai population is slightly lower than that of the korean population reported in 2006 and 2012 [ 9 , 24 ] . the korea health survey reported that the levels of tc , ldl - c , hdl - c , and triglycerides were 184.7 , 114 , 45.2 , and 135.2 mg / dl , respectively , which were more favorable than what was found in the thai population in the present study . the findings of slightly higher levels of total cholesterol ( tc ) and ldl - c but lower level of triglycerides in women compared with men were consistent with a previous study as well as other studies in japan , korea , and the u.s . ; however , the magnitudes of differences were smaller among the high - income countries . in the present study , the finding of higher tc and ldl - c in women is concordant with the higher prevalence of obesity and abdominal obesity in thai women than in men . obesity and abdominal obesity affect lipid metabolism and contribute to dyslipidemia , whereas body weight reduction improves lipid abnormalities [ 3 , 29 ] . the findings of high prevalence of dyslipidemia in thai population might not be surprised as dietary pattern in the current thai food has gradually changed from the past . the traditional thai food normally constitutes low fat , high complex carbohydrate , and high fiber as compared with westernized food . during the past several decades since 1960 , the per capita consumption of cereals and tuber , particularly rice , has declined considerably compared with the early 1960 [ 3133 ] . consumption of animal products increased after 1975 with dramatic increases in 1985 [ 30 , 33 ] . the changes in dietary pattern owing to the economic development and urbanization are likely to contribute to the current situation of dyslipidemia . compared with the findings from a previous study in 2000 in five provinces , the levels of tc , ldl - c , non hdl - c , and triglycerides in the present study were higher ; however , the pattern of differences across regions was relatively similar , as tc , ldl - c , and hdl - c remained higher in bangkok and the central region , whereas people in the northeast had the lowest level of hdl - c and highest level of triglycerides . the different type of lipid abnormality is likely to be attributed to the different food pattern . the higher levels of tc , ldl - c , and hdl - c are likely to be related to urbanization , where people consume more meat and a fattier diet . people in the rural northeast usually consume more carbohydrates in the form of sticky rice . men in rural areas also consume greater amounts of alcohol and carbohydrates but less protein and fat in their daily diet , which might contribute to the higher levels of triglycerides and lower cholesterol among the population in this region . data from the thai consumption survey reported that average daily consumptions of protein , fat , and carbohydrate were 72 , 60 , and 311 gram per person , respectively . fat consumption was higher among urban household and carbohydrate consumption was higher in the rural areas . compared to other regions , the proportions of energy intake from carbohydrate among northeast residents were the highest at 59.2% and from fat were the lowest at 23.3% , whereas the corresponding percentages for people in bangkok were at 54.4% and 31.4% , respectively . it is unlikely that the higher consumption of carbohydrate among the rural residents was due to the higher percentages of vegetarians in rural areas ; however , this issue needs further investigation . with regard to the effect of high carbohydrate intake , a meta - analysis of 60 controlled studies showed that high dietary carbohydrate intake increased fasting triglyceride level and decreased hdl - c . in addition , consumption of high glycemic index and glycemic load food has been reported to be associated with chd . however , research into the link of dietary pattern and other behavioral and environment factors with lipid profiles and health outcomes by region needs further investigation . another important finding in the present study is the markedly low percentage of awareness and treatment of ldl in the population . the overall control percentage among those treated was relatively moderate ( 58% ) and the percentages of attaining ldl - c targets were comparable to the findings from other studies in clinical settings [ 15 , 16 ] ; however , this should be interpreted with caution , given the difference in sample characteristics , time of study , and tools to estimate chd risk . in the u.s . study , the percentage of awareness of high ldl - c was 61.5% , treatment among those aware was 70% , and control among those treated was 63.6% . the corresponding percentage for awareness in the present study was about 3.4 times lower , but percentages for treatment and control among those treated were only slightly lower . this finding might reflect that the effort to achieve a higher screening rate for detection of high serum cholesterol was more difficult than the effort to deliver treatment and control for those treated for hypercholesterolemia , which is consistent with a previous study . although thailand has a good infrastructure of district health hospitals distributed throughout the country , the shortage of manpower and laboratory facilities to screen and monitor serum cholesterol and type of cholesterol remains a problem , particularly in rural areas . this is shown by the even lower percentages in rural areas compared with urban areas and lower percentages in the peripheral regions as compared with bangkok . since the previous decade , the ministry of public health has spent a great deal of effort in an attempt to increase the coverage in screening for diabetes and hypertension , due to the higher burden of hypertension and diabetes compared to hypercholesterolemia in the thai population ; however , for dyslipidemia , more resources are needed for investment in rural health care services . a study reported that thailand had invested less efficiently compared with mexico in terms of provision of medication . further intervention for efficient allocation of technical resources and workforce is required to scale up the facilities for screening programs and therapeutic lifestyle changes . it should be noted that when comparing to those without diabetes , hypertension , or moderate / high chd risk , the percentages of awareness and treatment among those with the conditions were higher . this might be due to the fact that they were patients in the health service system , so the conditions were more likely to be detected and treated with medication . however , the findings of worse control among these groups are consistent with other studies [ 1517 , 37 ] . since guidelines in the management of dyslipidemia are available [ 4 , 5 ] , further efforts are needed to improve ldl - c control in those with diagnosed high ldl - c , particularly for those at high risk of chd . measurement of lipids for each participant was done at a single point in time , and data on type of medication is not known . the estimation might misclassify the risk category ; however , we used a thai coronary heart risk score to estimate the risk and the findings did not change substantially . treatment information was based on self - reports and did not include lifestyle modification or other herbal medication . despite the limitations , the present study is the first national representative population - based study with a large sample size and provides more detailed information on dyslipidemia in thai adults . the use of the who prediction chart for estimation of chd risk should provide more useful information to stratify individuals ' risk . in conclusion , dyslipidemia is a common condition with various forms in thai adults . effective intervention to promote healthy dietary intake and increased physical activity should be intensified at the population level . appropriate screening , treatment , and therapeutic lifestyle change programs for high - risk groups must be scaled up . | this study determined the prevalence and management of dyslipidemia in thai adults using data from the thai national health examination survey iv in 2009 .
dyslipidemia was defined based on the third adult treatment panel guidelines .
a total of 19,021 adults aged 20 yr and over were included .
mean ( se ) levels of total cholesterol , hdl - c , ldl - c , and triglycerides were 206.4 ( 1.03 ) , 46.9 ( 0.34 ) , 128.7 ( 1.09 ) , and 131.4 ( 2.20 ) mg / dl , respectively .
prevalence of high ldl - c , low hdl - c , and high triglycerides were 29.6 % , 47.1 % , and 38.6% , respectively . compared with individuals in the north and northeast , residents in bangkok and central region had significant higher levels of ldl - c but lower level of hdl - c .
triglyceride level was the highest in the northeast residents .
overall , 66.5% of thais had some forms of dyslipidemia .
awareness and treatment of high ldl - c among those with high ldl - c were 17.8% and 11.7% , respectively . among individuals aware of high ldl - c , those at highest chd risk compared with those at low risk had higher percentage of treatment ( 73.1% versus 51.7% , resp . ) but lower percentage of control at goal ( 32.9% versus 76.4% , resp . ) .
various forms of dyslipidemia are common in thai adults , with a low level of awareness and treatment of high ldl - c . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
congenital ichthyosis encompasses a heterogeneous group of hereditary skin disorders all of which are present at birth . after the neonatal period the affected children have widespread scaling and a variable degree of erythema or , in epidermolytic hyperkeratosis ( ehk ) , extremely thickened skin and blisters over the body . in general , clinical examinations together with dna tests confirm the diagnosis lamellar ichthyosis ( li ) , netherton s syndrome ( ns ) , ehk or harlequin ichthyosis ( hi ) . the life - long treatment includes baths and daily applications of topical emollients and , for very severe symptoms , oral acitretin . quality of life ( qol ) studies in adults with ichthyosis have shown that their skin disease has affected them negatively and that the most problematic period has been their childhood . the aim of the present study was to investigate qol in swedish children with different forms of congenital ichthyosis and also the impact of the children s disease on the qol of their families . children with the diagnosis of congenital ichthyosis aged 516 years were recruited in the years 20032007 through the uppsala genodermatosis centre and the swedish ichthyosis association . inclusion criteria were a diagnosis from a dermatology clinic , age 516 years , command of the swedish language , and oral and written informed consent . their diagnosis was based on clinical examination and in 7 cases it was further confirmed by dna tests . qol was assessed with the established questionnaires , children s dermatology life quality index ( cdlqi ) and dermatitis family impact questionnaire ( dfi ) , in the swedish language . the questionnaires covered the preceding seven days and each had 10 questions scoring 03 , giving a maximum score of 30 : the higher the score , the greater the impairment of qol . the author contacted the children s parents by telephone and study aim and design were explained . information and a questionnaire about the child s medical history and present medical condition were mailed to the parents . the children were investigated in their homes ( n=13 ) or at an annual meeting of the swedish ichthyosis association ( n=2 ) . the disease was rated by the investigator as mild , moderate , or severe , using a semi - quantitative global clinical assessment , based on degree of scaling , hyperkeratosis , erythema , and extension . after informed consent had been obtained and the severity of the ichthyosis had been scored , the parent(s ) left the room and completed the dfi . the cdlqi was completed by the author and the child alone ; the author asked the questions and filled in the child s answers . spearman s rank order correlation coefficient was computed as a measure of the association between cdlqi and dfi , and between the qol results . fifteen children ( 6 boys , 9 girls ) aged 516 years ( median 9 years ) met the inclusion criteria li ( n=10 ) , ns ( n=3 ) , ehk ( n=1 ) or hi ( n=1 ) . all patients were receiving some type of topical therapy for ichthyosis and 2 were being treated with oral acitretin . table 1demographic and clinical characteristics of the children.patient n.sex/age ( y)diagnosisglobal assessment of disease severityhypohidrosisectropion / eye problemsear - problemspruritusalopecia / abnormal haircreams containing1f/5li+++++++l / p2f/6li++++++l / p3f/7li++++p+l / p4f/7li++++++l / p5f/9li++++u l / p6m/9li+++l / p7m/12li+++l / p8m/13li+++++++u+l / p9f/14li++++be+gc10f/16li+++l / p11m/8ns++++++be12f/11ns++++u+gc13m/14ns++++p+gc14m/13ehk+++++u15f/8hi++++++bens= netherton s syndrome , li= lamellar ichthyosis , ehk = epidermolytic hyperkeratosis , hi= harlequin ichthyosis.global score of skin disease'+ = mild disease , + + = moderate disease and + + + = severe skin disease . hypohidrosis , eye problems , ear problems , eczema / pruritus , yes = + , no = creams : u = urea , l / p = lactic acid /propylene glycol , p = propylene glycol , be = bland emollient , gc = glucocorticoid . ns= netherton s syndrome , li= lamellar ichthyosis , ehk = epidermolytic hyperkeratosis , hi= harlequin ichthyosis . global score of skin disease'+ = mild disease , + + = moderate disease and + + + = severe skin disease . hypohidrosis , eye problems , ear problems , eczema / pruritus , yes = + , no = creams : u = urea , l / p = lactic acid /propylene glycol , p = propylene glycol , be = bland emollient , gc = glucocorticoid . the three items in the cdlqi questionnaire that had the highest score were question 1 itchy or painful skin , question 10 treatment problems , and question 8 calling you names , bullying or avoiding you . the median total score for dfi was 9 ( range 321 ) . the three items in the dfi questionnaire that were given the highest score were question 1 effect on housework , question 10 helping with the child s treatment , and question 6 expenditure . there was a significant correlation between the dfi and cdlqi scores ( p= 0.0048 ) . the median and mean total scores for cdlqi and dfi for the children and for the two genders ( male / female ) , for three age groups ( 58 years , 912 years and 1316 years ) and for different forms of ichthyosis are shown in table 2 . table 2the total quality of life scores for cdlqi and dfi and the scores distributed by gender , age - groups and ichthyosis forms.cdlqidfinumbermedianmeantotal score , if only one patientmedianmeantotal score , if only one patientall1599.399.0sex ( children ) male68.58.36.57.2 female999.410.070.7age ( children ) 58 years61313.312.512912 years487.87.57.31316 years586.855.8ichthyosis lamellar ichthyosis1098.699.7 netherton s syndrome3810.387.7harlequin ichthyosis11614 epidermolytic hyperkeratosis125parent ( s ) who completed the questionnaire both together466.8 the three items in the cdlqi questionnaire that had the highest score were question 1 itchy or painful skin , question 10 treatment problems , and question 8 calling you names , bullying or avoiding you . the median total score for dfi was 9 ( range 321 ) . the three items in the dfi questionnaire that were given the highest score were question 1 effect on housework , question 10 helping with the child s treatment , and question 6 expenditure . there was a significant correlation between the dfi and cdlqi scores ( p= 0.0048 ) . the median and mean total scores for cdlqi and dfi for the children and for the two genders ( male / female ) , for three age groups ( 58 years , 912 years and 1316 years ) and for different forms of ichthyosis are shown in table 2 . table 2the total quality of life scores for cdlqi and dfi and the scores distributed by gender , age - groups and ichthyosis forms.cdlqidfinumbermedianmeantotal score , if only one patientmedianmeantotal score , if only one patientall1599.399.0sex ( children ) male68.58.36.57.2 female999.410.070.7age ( children ) 58 years61313.312.512912 years487.87.57.31316 years586.855.8ichthyosis lamellar ichthyosis1098.699.7 netherton s syndrome3810.387.7harlequin ichthyosis11614 epidermolytic hyperkeratosis125parent ( s ) who completed the questionnaire both together466.8 this study of the impact of congenital ichthyosis on the qol of afflicted children and of their families confirms that the ichthyosis affects both the children and the families . the observed impact on the children s qol is in line with findings in two previous swedish studies concerning adults with ichthyosis . the two items showing the highest cdlqi and dfi scores concern problems related to the children s ichthyosis symptoms and the treatment . in this study , it was shown that both the patients and their parents need support and help to cope with this chronic disease . the mean total cdlqi score in this study was 9.0 , which was higher than in a study presented as an abstract from france , where the total cdlqi score was 6.7 . the present study comprised only children with congenital ichthyosis , while the french study included both congenital and non - congenital forms of the disease . it seems reasonable that patients with congenital ichthyosis , a more severe condition , will score higher than study groups of patients including both the more common types of ichthyosis and congenital ichthyosis . the number of patients in the present study group was small , but on the other hand the study included virtually all swedish children with congenital ichthyosis in the age group in question . there was a small gender difference in cdlqi scores when the children themselves answered the questions and also a gender difference in the dfi scores when parent(s ) answered ( not significant ) ( table 2 ) . the children s ages influenced the cdlqi and dfi scores ; a finding in line with results for children with eczema . in one study , the mother of an ichthyosis patient described her frustration about the shedding of her son s skin in their home . in that study , it was found that parents of children ( n=2 ) with ichthyosis also have an extra financial burden . this is in line with the findings in the present study concerning housework and the fact that the expenditure had an impact on their qol . when children have a congenital disease , such as epidermolysis bullosa ( eb ) or congenital ichthyosis , they have their disease from birth to the end of their life . in a study comprising 30 children with different forms of eb , the total cdlqi scores were much higher than the total cdlqi scores in this study . on the other hand , the results of this study verify that ichthyosis causes greater impairment of qol than other skin diseases in children . general questionnaires and many new studies are needed to compare the impact on qol of ichthyosis with other congenital and chronic diseases . in conclusion , this study showed that congenital ichthyosis considerably impaired the qol of afflicted swedish children and their families . furthermore , the findings confirm the result of a previous interview study on older patients with congenital ichthyosis who described their childhood as the most problematic period in their lives . | congenital ichthyosis encompasses a large group of keratinizing disorders with widespread scaling and a variable degree of erythema .
little is known about the quality of life in children with congenital ichthyosis and the impact of the disease on their family .
fifteen children aged 516 years with lamellar ichthyosis , netherton s syndrome , epidermolytic hyperkeratosis or harlequin ichthyosis , were investigated concerning the effect of their ichthyosis on their quality of life .
this was measured with the established children s dermatology life quality index ( cdlqi ) , and the dermatitis family impact questionnaire ( dfi ) modified by substituting the word ichthyosis for eczema .
the questionnaires covered the preceding seven days and each had a maximum score of 30 : the higher the score , the greater the quality of life impairment .
the median score was 9.0 ( range 219 ) for the cdlqi and 9.0 ( range 321 ) for dfi .
there was a significant correlation between the dfi and the cdlqi scores .
the item in the cdlqi questionnaire that showed the highest score was itchy , scratchy , sore or painful skin and the most highly scored item in the dfi questionnaire was effect on housework , e.g. washing , cleaning ; both items related to the children s symptoms . the results of the study clearly establish that congenital ichthyosis impairs the quality of life of the affected children and their families . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
osteoporosis is a condition of impaired bone strength which leads to increased risk of fracture . the enhanced bone fragility reflects the integration of the amount of bone ( bone mass ) and bone quality . bone quality depends on its macro- and microarchitecture and on the intrinsic properties of the materials that comprise it ( e.g. , matrix mineralization , microdamage accumulation , or collagen quality ) . bone is continually adapting to changes in its mechanical and hormonal environment via the process of bone remodeling . bone remodeling maintains bone structure and its mechanical competence by removing damaged bone and replacing it with new bone and thus restores bone 's material composition , micro- , and macroarchitecture . this process depends on the normal production , work and lifespan of osteoclasts , osteoblasts , and osteocytes . thus , diseases and drugs that have an impact on bone cells and bone remodeling will influence bone 's structure and its resistance to fracture . multiple sclerosis ( ms ) is a chronic progressive disease affecting the myelin sheath covering of nerve fibers in the brain and spinal cord , leading to functional impairments such as visual impairment , abnormal walking mechanics , poor balance , muscle weakness , fatigue , and progressive immobilization . the disease affects mainly young adults ( 20 to 40 years ) and its incidence is more frequent in women ( approximately 2 : 1 ) . impaired mobility or lack of weight - bearing physical activity reduced mechanical stress on bone , which causes a marked imbalance in bone remodeling with a disruption of osteocytes network . management of ms requires long - term disease - modifying therapy , such as glucocorticoids ( gcs ) with a further negative effect on bone remodeling and bone strength . secondary osteoporosis may develop and low - trauma fractures occurring in patients with ms more frequently than in healthy controls [ 915 ] . fractures and their sequelae can have important personal as well as ( economic ) implications for society . therefore , the attention on the issue of bone health among patients with ms is warranted . this paper examines the underlying pathogenic mechanisms of osteoporosis in patients with ms as well as its management . understanding the causes associated with decreased bone strength in patients with ms will help in the optimal therapeutic intervention . the analysis of a registry of 9029 patients with ms in the usa found that 27.2% responders reported low bone mass , and more than 15% of responders reported a history of fracture . most studies in patients with ms evaluated bmd in comparison with the control group of healthy subjects and showed significantly lower bmd in patients with ms than in controls [ 1116 ] . several of these studies were shown that vertebral bmd is affected to a lesser degree than femoral bmd [ 11 , 12 , 16 ] . interestingly , one study in men with ms reported low bmd ( osteoporosis ) in 37.5% ( 15 out of 40 ) and 21% ( 8 out of 38 patients ) had vertebral , rib , or extremities fractures . patients with progressive forms of ms showed a more severe loss of bmd than those with relapsing - remitting ms . cosman group found fracture rates of 22% in patients with ms compared with 2% in controls . it remains unexplained whether all patients with ms are more susceptible to osteoporosis and fractures ; for example , there is evidence that patients with a low expanded disability status scale ( edss ) score did not show any significant difference in bmd with comparison with healthy control subjects [ 17 , 18 ] . therefore , further elucidation is needed to qualify which risk factors are most responsible for a bone loss in patients with ms . bone remodeling is under way throughout life and maintains bone strength by removing damaged bone and replacing it with new bone and thus restores bone 's micro- and macroarchitecture . this process depends on the normal production , work , and lifespan of osteoclasts , osteoblasts , and osteocytes . chronic diseases , such as ms , may significantly disturb the process of bone modeling and remodeling with resulting bone loss , deterioration of bone 's quality and increased frequency of fractures [ 20 , 21 ] . secondary osteoporosis and low - trauma fractures occur in patients with ms more frequently than in healthy controls [ 9 , 11 ] . the underlying pathogenic mechanisms of the osteoporosis in patients with ms are probably based on the progressive immobilization , long - term gcs treatment , vitamin d deficiency , skeletal muscle atrophy and possibly on the presence of various cytokines involved in the pathogenesis of ms . in addition , chronic use of other drugs , such as antidepressants may contribute to the development of osteoporosis and fractures . the functional impairments also leads to an increased risk of falling that , combined with bone loss and impaired quality of bone mass , can increase the frequency of bone fracture in individuals with ms . increased bone loss in immobilized subjects is well - recognized complication in patients after spinal cord injury with tetraplegia [ 23 , 24 ] , in bedridden patients , or in astronauts , whereas localized bone loss is well documented in patients with regional disuse , for example , after fracture itself . immobilization causes an overall progressive bone loss at a similar rate to osteoporosis caused by estrogen deficiency , but at the same amount of induced bone loss , disuse led to more deteriorated bone structure and mechanical properties than estrogen deficiency . the available studies showed that cortical thinning and substantial decline of trabecular bone density account for increased bone fragility [ 2729 ] . the duration and degree of motor disability appears to be a major contributor to the pathogenesis of secondary osteoporosis in patients with ms . the degree of disability measured by the kurtzke edss score significantly correlated with bmd in patients with ms . specifically , site - specific effects of motor disability were documented in ms patients , and edss correlated mainly with bmd in the hip but not in the lumbar spine . in wheelchair - bound patients , an atrophy of hip muscles affects proximal femur , while bmd of lumbar spine is not decreased because of its adequate mechanical stimulation by the trunk and back muscles in the upright position . also , hemiplegic patients showed a significant loss of bmd in both trabecular and cortical bone at the forearm and at the neck and great trochanter on the paretic hip . higher total body bone mineral content was documented in ambulatory patients ( edss score 6.5 ) compared with nonambulatory patients ( edss score 7.0 ) [ 12 , 13 ] . also , higher prevalence of osteoporosis was found in nonambulatory patients . in male patients , a positive correlation has been observed between bmd and both edss score ( correlation with femoral and also vertebral bmd ) and bmi ( correlation with femoral bmd only ) . there was shown that also edss score and bmi two years prior to the study could be used as future indicators of low bmd . a reduced mechanical stress on bone causes a marked imbalance in bone remodeling with a transient increase in bone resorption ( which occurs initially ) and a decrease in bone formation ( which is sustained for a longer duration ) [ 25 , 33 , 34 ] ( table 1 ) . the mechanism causing this decrease in bone formation probably lies in the reduction of mechanical stress during immobilization which results in a marked disruption of osteocytes network due to increase of osteocyte apoptosis . osteocytes represent 95% of all bone cells and form a mechanosensory system which is based on a three - dimensional network of tightly interconnected osteocytes entombed in mineralized bone matrix . disruption of this system affects probably several aspects of bone homeostatic system , such as mechanosensitivity , mechanotransduction , and basic multicellular units responsible for bone remodeling . while molecular mechanisms of disuse osteoporosis are not well understood , recent evidence found that mechanical unloading caused upregulation of sost gene in osteocytes and increased levels of sclerostin ( product of sost gene ) . sclerostin is responsible for the inhibition of wnt / beta - catenin signaling in vivo and for the suppressed viability of osteoblasts and osteocytes . interestingly , sclerostin - deficient mice ( sost / ) were resistant to mechanical unloading - induced bone loss . importantly , the administration of sclerostin neutralizing antibody in experimental model of immobilization resulted in a dramatic increase in bone formation and a decrease in bone resorption that led to increased trabecular and cortical bone mass . osteocytes are also necessary for targeted bone remodeling to avoid microdamage accumulation , which could lead to whole - bone failure . recently , waldorff et al . showed that osteocyte apoptosis may be insufficient for repair of microdamage without the stimulation provided through physiologic loading . ms affects a wide range of neurological function and most of patients with ms have abnormal muscle strength , impaired balance , and gait control which leads to frequent falls [ 5 , 41 ] that combined with a bone loss increase the frequency of bone fractures . it was demonstrated that changes in postural control in most patients with ms are probably the result of slowed afferent proprioceptive conduction in the spinal cord . disuse , inflammatory changes , as well as gcs treatment or vitamin d deficiency , may also contribute to weakness and loss of muscle strength and thus to frequent falling . gcs are frequently used to control ms relapses . oral gcs treatment in patients with ms may increase the risk of osteoporosis . epidemiological studies showed that fracture risk is increased rapidly after starting oral gcs treatment and is related to the dose and duration of gcs exposure . doses as low as 2.55 mg of prednisolone equivalents per day can be associated with a 2.5-fold increase in vertebral fractures , and the risk is greater with higher doses used for prolonged periods . bone loss due to gcs treatment is steep during the first 12 months and more gradual but continuous in subsequent years . however , the fracture risk returns towards baseline levels after discontinuation of oral gcs treatment . the mechanism of osteoporosis in patients on gc treatment is complex ( table 2 ) . however , the contribution of other risk factors , such as vitamin d insufficiency and physical disability confounds the assessment of gcs effects on bone in patients with ms . repeated pulses of high - dose methyprednisolone in ms patients did not result in a subsequent decrease in bmd ; however , the risk of osteoporotic fractures remains slightly increased in patients undergoing cyclic gcs treatment at high doses . high - dose , short - term intravenous gc regimens cause an immediate and persistent decrease in bone formation and a rapid and transient increase of bone resorption . in fact , gcs may increase proresorptive il-6 signaling as well as increase the expression of receptor activator of nf-b ligand ( rankl ) and decrease the expression of its soluble decoy receptor , osteoprotegerin ( opg ) , in stromal and osteoblastic cells . however , discontinuation of such regimens is followed by a high bone turnover phase . in physically active patients with ms treated with low - dose steroids , the bone turnover markers were not different from controls . addressing the question of whether duration of low - dose gcs use in combination with other immunomodulators in patients with ms increases risk of osteoporosis requires further prospective study by taking into account other risk factors , particularly the level of disability . although no harm effect of low - dose methotrexate was observed in patients with ms , several case reports have described associations between pathological nonvertebral fractures and low - dose methotrexate ( mtx ) in rheumatoid arthritis ( ra ) patients . in addition , methotrexate osteopathy , characterized by pain , osteoporosis , and microfractures , has been very rarely observed in patients with low - dose mtx treatment . other immune - modifying drugs , such as interferon - beta or azathioprine , which are used in conjunction with gcs have not been shown to promote bone loss experimentally or clinically . on the contrary , interferon - beta may have favorable effect on bone metabolism in patients with ms , probably due to the inhibitory effect of interferon - beta on osteoclasts development . experimentally , also treatment with the s1p(1 ) agonist fty720 , a new and promising drug for the treatment of ms , relieved ovariectomy - induced osteoporosis in mice by reducing the number of mature osteoclasts attached to the bone surface . however , further investigation with regard to their effects on bone health is needed . the role of vitamin d in bone homeostasis is well understood , and the use of vitamin d to prevent and treat osteoporosis was recently reviewed . there is also evidence from both observational studies and clinical trials that hypovitaminosis d are predisposing conditions for various common chronic diseases . in addition to skeletal disorders , vitamin d deficiency is associated with increase the risk of malignancies , particularly of colon , breast , and prostate gland cancer , of chronic inflammatory and autoimmune diseases ( e.g. , insulin - dependent diabetes mellitus , inflammatory bowel disease , or multiple sclerosis ) , as well as of metabolic disorders ( metabolic syndrome and hypertension ) . vitamin d intake , decreasing latitude , increased sun exposure , and high serum vitamin d levels have all been shown to be associated with a decreased risk of ms . patients with ms have more often vitamin d deficiency due to its low intake as well as limited sunlight exposure . mean 25-hydroxyvitamin d3 ( 25ohd ) levels in patients with ms are more often lower ( below the level of 20 ng / ml ) than in age - matched controls [ 11 , 14 ] . there was no significant correlation between 25(oh)d and bmd in patients with ms [ 11 , 14 ] . thus , while patients with ms are susceptible to low 25ohd levels , the evidence implicating linking levels to reduced bmd and osteoporosis in patients with ms is unclear . only a few studies have investigated this link [ 11 , 12 , 14 ] . a low vitamin d state , from inadequate diet intake and decreased exposure to sunlight , contributes to malabsorption of calcium and vitamin d insufficiency in ms patients . secondary hyperparathyroidism may develop , which can contribute to bone remodeling imbalance and bone loss in patients with ms . moreover , patients with ms treated with gcs will be at greater risk for an imbalance between bone formation and bone resorption and , therefore , more susceptible to development of osteoporosis due to vitamin d insufficiency / deficiency . gcs treatment is associated with reduced calcium absorption from the gastrointestinal tract by opposing vitamin d action . in addition , gcs may affect pth secretory dynamic , with a decrease in the tonic release of pth and an increase in pulsatile burst of the hormone . ms is an inflammatory disease of the central nervous system ( cns ) with a prominent role of immune cells and cytokines in degradation of the myelin sheaths . recent evidence has indicated that a number of additional cell types , such as t cells , play a key role in bone loss . in inflammatory or autoimmune disease states , activated t - cells produce receptor activator of nuclear factor kappab ligand ( rankl ) and proinflammatory cytokines , such as tnf- , il-1 , or il-11 , all of which can induce rankl expression in osteoblasts and bone marrow stromal cells . the systemic or local activation of t - cells may , therefore , trigger bone loss via the expression of rankl . osteoprotegerin ( opg ) , a protein member of the tumor necrosis factor ( tnf ) receptor family and its ligand rankl were identified as a key cytokines that regulate osteoclastogenesis . significantly , higher levels of rankl and opg were found in the patients with ms with low mean edss as compared to the age - matched controls . among other cytokines , osteopontin ( opn ) has been studied in the shared pathogenesis of ms and osteoporosis . opn is a member of the sibling ( small integrin - binding ligand n - binding glycoprotein ) family of noncollagenous matricellular proteins . opn was identified as the most abundantly expressed cytokine in ms lesions , and opn levels were found to be increased in cerebrospinal fluid of ms patients [ 64 , 65 ] and in the plasma in patients with relapsing - remitting ms . however , other studies found that opn circulating levels are low in patients with ms . it seems likely that further future studies experiments will uncover the role of opn and additional molecules mediating bone loss in inflammatory diseases , such as ms . meta - analyses have revealed that barbiturate , antidepressant , antipsychotic , and benzodiazepine treatment increases patient 's risk of osteoporosis . more recently , current use of antidepressant drugs with a high affinity for the 5-hydroxytryptamine reuptake transporter ( 5-htt ) was associated with a higher risk of osteoporotic fractures compared to use of antidepressants with a medium or low affinity . bmd was lower among those reporting current selective serotonin reuptake inhibitors ( ssri ) use but not among users of other antidepressants [ 72 , 73 ] . in vivo studies have found that 5-ht could alter bone architecture and could reduce bone mass and density . the 5-htt has been located in osteoclasts , osteoblasts , and osteocytes , and the the inhibition of 5-htt using a ssri ( fluoxetine hydrochloride ) had antianabolic skeletal effects in rats . further research is needed to confirm this finding in light of widespread ssri use and potentially important clinical implications . despite the fact that patients with ms can develop osteoporosis and fractures more often than their age - matched healthy controls , many patients with ms are not evaluated for their bone status , and there are no clinical guidelines for prevention and treatment of osteoporosis in patients with ms . patients with ms are also at a higher risk of falls that can increase the frequency of bone fracture combined with bone loss and impaired bone 's quality . clinical evaluation in all patients with ms should include the assessment of the clinical risk factors for osteoporosis and fractures , such as the hereditary disposition of osteoporosis , previous low trauma fractures , and smoking or alcohol habits . the specific risk factors of the osteoporosis in patients with ms are the level of disability ( specifically motor disability ) and possibly a long - term gcs treatment , vitamin d deficiency , skeletal muscle atrophy , and increased risk of falling . the examination of the motor function using the edss score could provide a useful indicator for further evaluation . cutoff edss 6 represents reasonable end of motor performance of the patient ; 6.5 means only several meters with bilateral support , and 7 is only the ability of transfer to wheelchair from the bed . the edss scores of 6 or greater has been found to correlate well with decreased bmd [ 12 , 15 ] , and bmd should be routinely measured in these patients . on the other hand , patients with a good physical activity and low edss score ( < 5 ) may have normal bmd as well as markers of bone turnover . bmd measurement should be also performed in all patients who are receiving 5 mg of prednisone equivalents daily for more than 3 months . bmd testing using dual - energy x - ray absorptiometry ( dxa ) should be conducted at the lumbar spine and hip . this measure provides an assessment of fracture risk prior to the occurrence of a fragility fracture as well as monitors the course of the disease and response to therapy . no consensus exists as to how frequently patients at risk osteoporosis should have followup scans . however , bmd should be remeasured after 1 or 2 years to ascertain that it is stable or to identify the patient with ongoing bone loss , especially in patients treated with long - term gcs treatment . in the presence of clinical risk factors therefore , combination of bmd with clinical risk factors is recommended to identify a risk patient and to target pharmacologic therapy . in postmenopausal women and men ( between 40 and 90 ) , the assessment of individualized 10-year absolute fracture risk ( frax , fracture prediction algorithm ) the identification of previous low - trauma fractures , especially vertebral fractures is important for the decision - making process as a previous vertebral fracture is a particularly strong risk factor . importantly , vertebral fractures may occur in 3050% of patients receiving chronic gcs therapy and up to 50% of vertebral fractures are asymptomatic and , therefore , do not come to the attention of physicians . spinal x - rays should be performed in those with localized back pain or a loss of more than 3 cm in height in order to detect prevalent vertebral fractures . alternatively , the vertebral fracture assessment tool of the bone densitometer , which is associated with low radiation , may be useful screening test for vertebral fractures assessment . laboratory tests are indicated to exclude other secondary causes of osteoporosis , such as vitamin d deficiency , renal insufficiency , malabsorption , and hypogonadism . useful biochemical tests include routine standard tests to exclude renal or hepatic impairment , blood count , serum calcium , 24-hour urinary calcium , 25-hydroxyvitamin d3 ( to exclude vitamin d deficiency ) , and gonadal hormones ( to exclude hypogonadism ) . nonpharmacological therapies should be considered for prevention of skeletal fragility , including adequate weight - bearing exercise , nutrition ( protein , calcium , vitamin d ) , and lifestyle modifications . as reviewed above , disability is the most often cause of bone loss in patients with ms , and mechanical loading and exercise interventions can prevent osteocyte apoptosis and bone loss [ 77 , 78 ] . exercises have beneficial effects on strength , physical endurance , mobility - related activities ( transfer , balance , and walking ) , and on mood , without any evidence of detrimental effects ; however , there was no evidence that any particular exercise programs were more effective in improving or maintaining function . whole - body vibration is a new approach to improve neuromuscular functions and bone strength , but there is limited evidence that whole body vibration provides any additional improvements . further experimental studies are necessary to identify optimal physical activities for the prevention of osteocyte apoptosis and bone loss . recurrent falls may be an important risk factor for fracture in disabled patients with ms . in patients with ms , falls are related to the level of disability , and possibly other factors may contribute to muscle weakness and imbalance , such as vitamin d deficiency or gcs treatment . calcium and vitamin d supplementation has been routinely provided in most clinical trials of bone protective therapy for both primary and secondary osteoporosis , for example , in glucocorticoid - induced osteoporosis ( gio ) . the effect of calcium and vitamin d supplementation is maximized in patients whom baseline intake is low . as patients with ms are at a higher risk of calcium and vitamin d deficiency should have their calcium and vitamin d status checked and intake must be individualized . those with a personal or family history of nephrolithiasis an increase in serum calcium is provoked by bed rest alone and additional calcium intake would not be helpful and might be harmful and provoke an increased risk of kidney stone formation . however , calcium and vitamin d should be used as an adjunct treatment , because a low calcium intake may exacerbate calcium loss during low mechanical loading . in general , the amount of vitamin d supplementation should aim at achieving serum 25ohd levels above 50 nmol / a daily dose of 8001000 iu of vitamin d3 should be able to obtain this minimal 25ohd target . due to vitamin d resistance in patients receiving gcs , those patients may require amounts of 10002000 iu of vitamin d3 daily . measurement of serum 25oh vitamin d is recommended , especially in gcs - treated patients . although some evidence suggests that daily supplemental intake of 20004000 iu colecalciferol is required to obtain at least 75 nmol / l 25ohd , which may be optimum for many health outcomes , prospective trials showing that higher 25ohd levels ( > 7580 although a number of drugs have been evaluated for the prevention and treatment of postmenopausal osteoporosis and gio , the evidence of their efficacy in patients with ms , especially in premenopausal women and younger men is less strong . as osteoporosis in ms patients have multiple pathogenesis , medical interventions used in women with postmenopausal osteoporosis may not be similarly efficient . patients requiring long - term gcs treatment and those being immobilized may require pharmacological therapy to prevent excessive bone loss and fractures . options for treatment include antiresorptive drugs , such as estrogen , or aminobisphosphonates , or anabolic agents such as teriparatide . although the use of bps may be appropriate , the etiology of osteoporosis in patients with ms is fundamentally different from the osteoporosis commonly found in the postmenopausal women for whom these drugs were originally developed . as immobilization in patients with ms can cause substantial bone loss and increase in the risk of fractures , bps may be option for treatment for those patients . although bps have not been systematically evaluated in the therapy of these conditions , some studies support the potential benefit of bps in the management of bone loss associated with immobilization [ 24 , 85 , 86 ] . in immobilized patients , bps is known to reduce immobilization - induced hypercalcaemia by inhibiting bone resorption of calcium . an immobilization - related elevated serum calcium level may inhibit parathyroid hormone ( pth ) secretion , and hence renal 1 , 25(oh)2d3 production , in disabled long - standing ms patients . if oral therapy of bps can not be tolerated or excluded due to gastroesophageal disease , intravenous route of administration of ibandronate or zolendronate may be applied . however , acute phase reaction with fever , particularly after the first application of bp , may occur . bps ( alendronate , risendronate , or zolendronate ) were also approved for the treatment of gio . these drugs were shown to improve bmd , whereas the data on fractures were scanty in gio , particularly in premenopausal or younger men . the mechanism by which bps reduce the adverse skeletal effects of gcs have not been elucidated . the disadvantage of long - term bps treatment is that it may lead to a reduction in bone turnover to a level inadequate to support normal bone remodeling . although experimental data showed that bps also prevents osteocyte apoptosis , there is also experimental evidence of increased accumulation of microdamage with long - term bps therapy . also , as bps accumulate in the skeleton ( with a long - term residual time ) , they cross the placenta , accumulate in fetal skeleton , and cause toxic effects in pregnant rats . therefore , bps should be used with caution in women who may become pregnant . drugs , such as bps , that suppress bone resorption have been proposed as interventions for prevention of gio as well as disuse osteoporosis . the disadvantage of this approach is that it may lead to a reduction in bone turnover to a level inadequate to support normal bone remodeling . an alternative approach is to maintain a normal level of bone formation using a bone anabolic agent such as pth . the human recombinant n - terminal parathyroid hormone ( pth 134 or teriparatide ) is a potent osteoanabolic agent , which decreases osteoblast and osteocyte apoptosis and increases bone formation and bone strength . because of gcs - induced decrease in the number of osteoblasts and rate of bone remodeling , anabolic , and antiapoptotic treatment with teriparatide may directly counteracts the key pathogenetic mechanisms of gcs excess on bone , thus , it may be a more effective treatment than bps . the same rationale applies to immobilization - induced osteoporosis , as progressive immobilization as well as long - term gcs exposure results in osteocyte apoptosis and reduced bone formation . as sclerostin augments osteocyte apoptosis , the antibody - mediated blockade of sclerostin represents a promising new therapeutic approach for the anabolic treatment of immobilization - induced osteoporosis and probably also for gcs - induced osteoporosis . indeed , more recently , experimental data showed that administration of sclerostin neutralizing antibody in rat model of right hindlimb immobilization resulted in a dramatic increase in bone formation and a decrease in bone resorption that led to increased trabecular and cortical bone mass . we have described a spectrum of pathogenetic factors which may contribute to the development of osteoporosis and low - trauma fractures in patients with ms . whilst there is evidence to support an important role for many of the risk factors , the most significant etiology of bone loss in patients with ms seems to be the level of motor disability and reduced bone load within individual patients . other risk factors , such as long - term gcs treatment , hypovitaminosis d , or inflammation , may also play an important part in subset of patients with ms ; however , further examinations in prospective studies are required . with regard to diagnostic as well as therapeutic interventions , there are currently no specific recommendations in patients with ms ; however , identification and treatment of underlying cause should be the goal of therapeutic management . optimally , the patients in a higher risk of osteoporosis should be early identified and preventively promptly treated to avoid the bone loss and fractures . because the long - term disability and long - term gcs are probably two most significant etiologic risk factors for osteoporosis development in the majority of the patients with ms , the interventions which can counteract the osteocyte apoptosis as well as loss of muscle mass and muscle weakness will be promising . | multiple sclerosis ( ms ) is a gait disorder characterized by acute episodes of neurological defects leading to progressive disability .
patients with ms have multiple risk factors for osteoporotic fractures , such as progressive immobilization , long - term glucocorticoids ( gcs ) treatment or vitamin d deficiency . the duration of motor disability appears to be a major contributor to the reduction of bone strength .
the long term immobilization causes a marked imbalance between bone formation and resorption with depressed bone formation and a marked disruption of mechanosensory network of tightly connected osteocytes due to increase of osteocyte apoptosis .
patients with higher level of disability have also higher risk of falls that combined with a bone loss increases the frequency of bone fractures .
there are currently no recommendations how to best prevent and treat osteoporosis in patients with ms
. however , devastating effect of immobilization on the skeleton in patients with ms underscores the importance of adequate mechanical stimuli for maintaining the bone structure and its mechanical competence . the physical as well as pharmacological interventions which can counteract the bone remodeling imbalance , particularly osteocyte apoptosis ,
will be promising for prevention and treatment of osteoporosis in patients with ms . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
consumption of green tea is inversely associated with risk for cardiovascular diseases and stroke,1 as well as with lower cardiovascular and total mortality.2 improvement of endothelial function is thought to be one major mechanism for these beneficial effects . green tea improved flow - mediated dilation in chronic smokers3 and in healthy individuals.4 a meta - analysis indicates that green and black tea ingestion increases endothelial - dependent vasodilation.5 because endothelial dysfunction is characterized by reduced availability of nitric oxide ( no ) , interventions able to stimulate vascular no production represent a promising tool in the prevention of cardiovascular diseases . the catechin epigallocatechin-3-gallate ( egcg ) represents the most potent physiologically active tea compound in vitro . egcg has been shown to induce vasodilatory effects in isolated blood vessels in various studies.612 besides an no - dependent mode of action , other no - independent mechanisms for egcg - induced vasodilation were also proposed . to elucidate conclusively whether egcg - induced vasodilation is dependent on no , we studied effects of egcg in isolated aortic rings of endothelial no knockout ( enos ) mice compared with wild type controls . eight- to 10-week - old male enos mice ( strain b6.129p2-nos3/j ) from jackson laboratory were used for the experiments . the background strain c57bl/6j with functional enos expression ( wild type ) served as control . extraction of organs from genetically modified animals was approved by the local authority ( landesamt fr gesundheit und soziales , berlin ) under the permit number t0026/05 . mice were anesthesized by intraperitoneal injection of thiopental ( 0.3 g / kg body weight ) . thoracic aortae from anesthesized mice were rapidly excised , cleaned of connective tissue , and cut into rings of 1 mm in length for organ - chamber experiments . rings were then mounted on platinum hooks in 10-ml jacketed organ baths containing modified krebs henseleit solution ( composition , in mmol / l : nacl 144 , kcl 5.9 , cacl2 1.6 , mgso4 1.2 , kh2po4 1.2 , nahco3 25 , and d - glucose 11.1 ) and 1 mol / l of diclofenac . the solution in the bath was maintained at 38c with a gas mixture of 5% co2 and 95% o2 . after equilibration , the reactivity of rings was tested with kcl ( 40 mm ) . after repeated washouts , the tension of rings was again adjusted to 1 g. after equilibration , the rings were precontracted with the 1-receptor agonist phenylephrine ( 200 nm ) . to obtain cumulative concentration response curves , egcg ( sigma aldrich , dissolved in water ) at concentrations of 5 , 10 , and 15 m was added at 30-minute intervals to the rings . for the relaxation experiments with tea , 1.2 g of darjeeling green tea ( provided by king 's teagarden , berlin , germany ) was brewed with 100 ml of boiled water for 3 minutes . relaxations to cumulative doses ( 10 nm5 m ) of the endothelium - dependent vasodilator acetylcholine were also performed . maintenance of smooth muscle integrity was confirmed by evaluation of endothelium - independent vasodilation to sodium nitroprusside ( snp , 0.1100 nm ) . statistical calculations were carried out with student t tests for independent samples for pair - wise comparisons of mean values , and with mann whitney rank sum test when comparing medians . eight- to 10-week - old male enos mice ( strain b6.129p2-nos3/j ) from jackson laboratory were used for the experiments . the background strain c57bl/6j with functional enos expression ( wild type ) served as control . extraction of organs from genetically modified animals was approved by the local authority ( landesamt fr gesundheit und soziales , berlin ) under the permit number t0026/05 . mice were anesthesized by intraperitoneal injection of thiopental ( 0.3 g / kg body weight ) . thoracic aortae from anesthesized mice were rapidly excised , cleaned of connective tissue , and cut into rings of 1 mm in length for organ - chamber experiments . rings were then mounted on platinum hooks in 10-ml jacketed organ baths containing modified krebs henseleit solution ( composition , in mmol / l : nacl 144 , kcl 5.9 , cacl2 1.6 , mgso4 1.2 , kh2po4 1.2 , nahco3 25 , and d - glucose 11.1 ) and 1 mol / l of diclofenac . the solution in the bath was maintained at 38c with a gas mixture of 5% co2 and 95% o2 . after equilibration , the reactivity of rings was tested with kcl ( 40 mm ) . after repeated washouts , the tension of rings was again adjusted to 1 g. after equilibration , the rings were precontracted with the 1-receptor agonist phenylephrine ( 200 nm ) . to obtain cumulative concentration response curves , egcg ( sigma aldrich , dissolved in water ) at concentrations of 5 , 10 , and 15 m was added at 30-minute intervals to the rings . for the relaxation experiments with tea , 1.2 g of darjeeling green tea ( provided by king 's teagarden , berlin , germany ) was brewed with 100 ml of boiled water for 3 minutes . relaxations to cumulative doses ( 10 nm5 m ) of the endothelium - dependent vasodilator acetylcholine were also performed . maintenance of smooth muscle integrity was confirmed by evaluation of endothelium - independent vasodilation to sodium nitroprusside ( snp , 0.1100 nm ) . statistical calculations were carried out with student t tests for independent samples for pair - wise comparisons of mean values , and with mann whitney rank sum test when comparing medians . vasodilation to the no donor snp was not impaired in enos mice compared with wild type mice . moreover , we observed a slight but significantly enhanced relaxation to snp in enos mice ( fig . * p < 0.05 aortic rings of wt versus enos mice at equal concentrations of ach . b , cumulative doses of the endothelium - independent vasodilator snp ( 0.1100 nm ) were given to the rings to illustrate maintenance of smooth muscle integrity . * p < 0.05 aortic rings of wt versus enos mice at equal concentrations of snp . next , we exposed phenylephrine - precontracted aortic rings to cumulative concentrations of egcg in a time interval of 30 minutes between applications . low doses of egcg ( 515 m ) induced concentration - dependent vasorelaxations in wild type mice . in aortic rings of enos mice , however , egcg had no effect on vascular tone . an original recording of a representative experiment is shown in figure 2a . in accordance with our previous results obtained in rats,7 treatment of aortic rings from wild type mice with in contrast , neither initial contractions nor any relaxation in response to egcg could be detected in enos mice ( fig . egcg of 5 m led to a relaxation of 82.3 ( 4.2 ) % of precontraction , and doses of 10 m and 15 m resulted in 56.9 ( 5.0 ) % and 41.3 ( 5.4 ) % vasodilation , respectively . however , egcg completely failed to induce vasodilation in rings of enos mice ( fig . 2 ) . to extend our findings to the whole beverage , green tea was added to aortic rings of wild type and enos mice . green tea in lower concentrations caused vasodilation only in wild type aortic rings , whereas a slight vasorelaxation was also obtained in enos mice at higher concentrations ( fig . original recording of a single experiment of egcg - induced vasorelaxation in phenylephrine - precontracted aortic rings of enos and wt mice ( a ) . the graphs show an initial transient contraction after each egcg dose in wt aortic rings that is followed by sustained relaxation . b , cumulative concentrations of egcg were added to phenylephrine - precontracted aortic rings of enos and wt mice . shown * p < 0.05 aortic rings of wt versus enos mice at equal concentrations of egcg cumulative doses of green tea were added to phenylephrine - precontracted aortic rings of enos and wt mice . p < 0.05 aortic rings of wt versus enos mice stimulated with equal amounts of green tea . n.s . , not significant ; wt , wild type . predominantly , a no - dependent mechanism for egcg - induced vasorelaxation has been described , as demonstrated by pharmacological inhibition of endothelial no production.7,1012 however , alternative modes of action are discussed . the egcg - induced inhibition of ca influx in smooth muscle cells as a mechanistic factor for vessel relaxation was proposed.6 inibition of various phosphodiesterase ( pde ) isoforms was also suggested as an underlying mechanism for vasodilating effects of egcg . egcg reduced the enzymatic activities of isolated pde1-pde5 isoenzymes , with strongest inhibitory effects on pde1 and pde2 . consequently , the contraction - induced decrease in cyclic nucleotide levels ( camp and cgmp ) in aortic smooth muscle cells was reversed by egcg.8 in addition , an increase in endothelial prostacyclin production by egcg was reported at the cellular level.13 we demonstrate in our study that the vasodilating effects of egcg strongly rely on the presence of enos and thus no production in endothelial cells . however , several mechanisms can result in stimulation of cellular no production , for example , the generation of reactive oxygen species.10,11 besides vasodilation , a number of studies describe vasoconstrictive effects of egcg . does egcg induce rather vasorelaxation or vasoconstriction ? a transient ca - dependent contractile response to egcg was observed in resting rat aortae ( without precontraction).14 egcg - induced contractions involved the formation of h2o2 , which results in ca influx in smooth muscle cells through nonvoltage - dependent ca channels.15 the apparent contradiction between these opposite effects ( vasoconstriction vs. relaxation ) could be attributed to the time - course in egcg - induced changes in vessel tone . egcg results in vasoconstriction7,8,12,14,15 that is transient in resting rings8,14,15 or followed by vasodilation in precontracted vessels.7,8,12 an initial activation of ca influx into smooth muscle cells through voltage - operated ca channels followed by inhibition of voltage - operated ca channels was suggested as potential explanation for biphasic actions of egcg on vessel tone.9 interestingly , this biphasic mode of action was completely absent in enos mice in our study . the lack of egcg - induced contractions was also obtained after pharmacological inhibition of enos and after removal of the endothelium in rat aortae.7,12 the reason for this endothelial - dependent and no - dependent transient vasoconstriction induced by egcg is unknown at present . this would not be surprising because loss of endothelial no likely increases sensitivity to exogenous no . in summary , irrespective of potential upstream signaling molecules and pathways involved , our study clearly demonstrates that the egcg - induced changes in vessel tone ( both initial contractions and subsequent relaxations ) are exclusively dependent on the presence of enos and endothelial no production . | abstract : the underlying mechanisms for the vasodilating effects of the tea catechin epigallocatechin-3-gallate ( egcg ) are still not fully understood . besides nitric oxide ( no)-dependent effects , other modes of action
are discussed . to elucidate whether the no pathway is a prerequisite in mediating vasodilating effects , we investigated egcg - induced vasorelaxation in isolated aortic rings of endothelial nitric oxide knockout ( enos/ ) mice .
vasodilation to acetylcholine was fully prevented in aortic rings of enos/ mice , confirming lack of vascular no production .
vasodilation to the exogenous no donor sodium nitroprusside was preserved in enos/ mice aortic rings .
low concentrations of egcg ( 515 m ) resulted in strong vasorelaxation in aortic rings of wild type mice , whereas it was completely absent in enos/ mice . in corroboration ,
relaxation in response to green tea was significantly inhibited in aortic rings of enos/ mice .
these results demonstrate that egcg - induced vasodilation strongly relies on functional no synthase in endothelial cells and subsequent stimulation of no production in vessels . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the principle of innocent until proven guilty is accepted in the legal field of society , but in the field of infectious diseases , the principle of guilty until proven innocent applies , a part of koch s definition of infection . in case of helicobacter pylori infection , despite of international agency for research on cancer ( iarc ) s definition that h. pylori is class i , definite , carcinogen for gastric cancer , the principle the eradication of h. pylori can decrease or prevent gastric cancer remains obscure and under debates.1 though proactive preventive measures are adopted for cancers that are suspected to be caused by infection , for instances , hepatitis b and c virus , human papilloma virus , and some other parasite or protozoa for the prevention of hepatocellular carcinoma , cervical or esophageal cancer , bladder cancer , etc , and thereby resulting in a reduction of cancer related deaths , obscure debates still exist between h. pylori infection and the prevention of gastric cancer . based on enormous medical costs that the cost of gastric cancer treatment in japan has been reported currentlyaround 300 billion yen per year and will exceed 500 billion yen annually if measures are not taken for a decade or so , the japanese government decided to eradicate h. pylori in patients with gastritis , indication not permitted in korea yet , from february 21 , 2013.24 these facts cast the homework should we follow up japanese decision or collect more evidences for korean population ? to our korean college of helicobacter and upper gastrointestinal research and the korean society of cancer prevention . we ca nt just observe japanese government belief that potentially , it might be possible to eliminate gastric cancer - related deaths from japan around the middle of this century , but the problems might be either the shortage of korean government effort or insufficient evidences to persuade government policy maker sue to lack of convincing clinical evidence . in this review , the korean perspective of h. pylori infection as well as japanese efforts will be described in this background . gastric cancer is the second most common cause of cancer deaths worldwide . until the early 20th century , europe and the united states suffered a high incidence of gastric cancer , of course , very high incidence as well as mortality in asian including japan , korea , china , and russia , but with the changes in life style such as improved sanitation and the widespread adoption of refrigeration for food preservation , the incidence of gastriccancer rapidly decreased coincidently . however , in spite of the drastic advancement of health care system and endoscopic screening in japan and korea , still gastric cancer threatened population and notorious statistics showing 2050 mortality per 100,000 populations is put forwarded.5 besides of h. pylori infection , dietary factors such as excessive intake of salt or nitrates and hidden hereditary factors are still hurdle to be solved . among these risks ranked , the proportion of h. pylori infection is still high supported with definition that in 1994 , h. pylori was classified as a definite carcinogen by the iarc of the world health organization.1 since that time , many clinical studies have been conducted to examine how eradication of h. pylori might contribute to the prevention of gastric cancer , but the results was proven to be ambiguous , half of trials supported the eradication to achieve the gastric cancer prevention , but the remains negative outcome . these discrepancies might be explained as arelatively low incidence of gastric cancer , the relatively short duration of available studies , the lack of risk stratification , differences in eradication times , and differences in observation periods.6,7 among these trials , in 2008 , a multicenter clinical study was conducted in japan to examine the incidence of new gastric cancer afterendoscopic submucosaldissection or mucosal resection ( esd or emr ) in high - risk patients with earlygastric cancer who were randomly allocated to eradication of h. pylori group by fukase et al.8 the study concluded that h. pylori eradication resulted in a reduction in the incidence of new gastric cancers by approximately one - third , thus demonstrating the efficacy of h. pylori eradication in reducing the incidence of gastric cancer . though eradication could not completely prevent metachronous gastric carcinogenesis , but statistically eradication provide clear benefit to prevent secondary gastric cancer . along with the evidence that uemura et al s nejm paper9 that h. pylori infection is associated with gastric carcinogenesis in japan , these lancet paper stimulated government policy maker to conclude that h. pylori infection played an important role in the development of japanese gastric cancer and that h. pylori eradication could prevent or reduce the incidence of gastric cancer , releasing a new strategy to eliminate gastric cancer through eliminating h. pylori in patients with gastritis in japan at february 21 , 2013.4 the new strategy could be one that combined primary prevention by h. pylori eradication with secondary prevention using surveillance of high - risk patients . in japan , h. pylori infection was approved as an official disease name in the 2003 edition of the international statistical classification of diseases and related health problems ( icd-10 ) . h. pylori infection itself is soon expected to be accepted by the japanese national health scheme as a disease entity . according to the guidelines for the management of helicobacter pylori infection in japan : 2009 revised edition of the japanese society of helicobacter research ( jshr ) , h. pylori eradication has , based on strong evidence , been strongly recommended as level a ( minds recommendation grades ) for all h. pylori infections . in the guidelines , the level of evidence for each recommendation was classified from level i to level vi . for example , peptic ulcer , itp , atrophic gastritis , and fd were categorized as level i. in contrast , early gastric cancer post - endoscopic treatment , gastric hyperplastic polyp , and reflux esophagitis were categorized as level ii ( supported by at least one randomized controlled clinical trial ) , while gastric malt lymphoma , iron - deficiency anemia , and chronic urticaria were categorized as level iii.10 in korea , eradication should be considered in subjects younger than 40 years who have a family history of gastric cancer and in subjects with long - term medications that might lead to bleeding ( anti - platelet agents ) or atrophy ( proton pump inhibitors ) as well as peptic ulcer diseases , malt lymphoma , and nsaid administration beyond these currently accepted indications , including various upper gastrointestinal disorders and extra - gastric diseases , a significant amount of new information regarding h. pylori eradication is emerging . certain types of acute gastritis , such as nodular gastritis , hypertrophic gastritis , mntrier s disease , hemorrhagic gastritis , and granulomatous gastritis are reversible after h. pylori eradication.11 further , for chronic gastritis , closed - type atrophic gastritis and complete - type intestinal metaplasia appear to be more reversible after h. pylori eradication than open - type atrophic gastritis and incomplete - type intestinal metaplasia . emerging evidence indicates that h. pylori eradication could be an effective treatment for some extragastric diseases that are unresponsive to conventional therapy.12 future indications for h. pylori eradication should focus more on reversible lesions before preneoplastic conditions develop , but not now in korea . additionally , functional dyspepsia is the most common reason for patients to experience chronic epigastric pain or discomfort of which causes are quite multifactorial . since h. pylori infection clearly results in chronic mucosal inflammation in the stomach and duodenum , which might lead to abnormalities in gastroduodenal motility and sensitivity.13 chronic gastritis might affect a variety of endocrine functions of the stomach including the production of the gastrointestinal hormones and neurotransmitters somatostatin , gastrin and ghrelin . however , more evidences should be accumulated more to eradicate h. pylori in order to improve functional dyspepsia . this evidence has led to alterations in most of the major guidelines throughout the world , which now recommend h. pylori eradication in patients with functional dyspepsia if they test positive for this bacterium . with the accumulated proof from gastric cancer prevention through h. pylori eradication , more high level of proof will be set for functional dyspepsia since eradication of h. pylori was commenced in h. pylori - associated chronic gastritis , mostly presenting with symptoms of functional dyspepsia . h. pylori is a gram - negative , flagellated bacterium that expresses catalase and urease , enzymes which help neutralize host responses and enable intragastric colonization , these facts led to the development of accurate diagnostic tests , including the rapid urease test ( rut ) and the urea breath test ( ubt ) , very essential and core diagnostic modality in clinic exceeding direct bacterial cultures for diagnosis . additionally stool antigen test has emerged as an informative , non - invasive means in pediatric or icu patients . the modern discovery of h. pylori may have been delayed by palmer s declaration in 1954 that there were no microorganisms in the human stomach , stomach as desert to pathogen under the belief that microorganisms were believed to be unable to survive in the acidic gastric environment . in 1983 , marshall and warren successfully cultures unidentified microorganism in stomach and proved pathogen responsible for gastritis by ingesting cultured specimen.14 novel prize in medicine was given to them at 2005 . our department has published data that h. pylori infection was insufficient to develop gastric cancer in wild - type animal , whereas h. pylori infection led to gastric tumors in genetically defective animals.15 on additional experiment , we have identified that h. pylori infection might be promoter for gastric carcinogenesis , gastric cancer developed in salt drinking mice followed with h. pylori infection , mnng initiated- , h. pylori - infected mice.16 also we are using animal model that h. pylori infection followed with high salt containing water drinking developed in either wild - type or il-10 ko / tgf - type ii receptor ko mice signifying that h. pylori infection contributed to gastric carcinogenesis , but combined with additional risk factor . clear findings were that since gastric epithelium changes during the progression from inflammation to cancer , with evidence of disruption of normal epithelial cell differentiation and recruitment of inflammatory cells , h. pylori infection was pivotally and critically associated with the changes of tumor microenvironment as well as critical mutagenic activities . therefore , detouring the unpleasant journey from chronic strophic gastritis to gastric cancer might yield cancer prevention through either removal of etiologic microbes or detouring the mutagenic path ( fig . early diagnostic strategies might be the best proven way of gastric cancer prevention , available program in either korea and japan as public health interventions in gastric cancer , but the mortality rates of 2040/100,000 still rendered gastric cancer troublesome malignancy . h. pylori infection , smoking , and salt are strong independent risk factors for gastric cancer besides of individual genetic risk condition . fresh fruits , vegetables and certain micronutrients such as selenium , vitamin c reduce the risk , but foods that can inhibit h. pylori viability , colonization and infection may reduce cancer risk , for which korean red ginseng , licorice special extracts , s - allyl cysteine from garlic , some probiotics , and even korean gimchi cuisine were proven to very effectively impose anti - bacterial activities , exert anti - mutagenic actions as well as rejuvenating activities . though these findings should be proved to be evidence based medicine , great deals might be the adoption of generalized policy to eliminate bug to achieve gastric cancer prevention or sitrp ( short - term intervention to eliminate premalignancy ( fig . 2 and table 1 ) , execution , part of which was already approved in japan this year that eradicate h. pylori in patients with h. pylori - associated chronic gastritis . as member of the korean society of cancer prevention and the korean college of upper gastrointestinal disease and helicobacter research , cautious step should be put forwarded to generalize policy that h. pylori eradication to prevent gastric cancer in korea , but our group want to extend more the supplementation of efficacious phytoceuticals or phytonutrients to catch both rabbits of higher eradication rate and efficacious prevention of gastric cancer based on our accomplishments that merely eradication yielded lower than eradications accompanied with the attenuation of bug associated gastric inflammations through certain periods of phytoceuticals or phytochemicals , presumptively korean red ginseng ( 23 g for additional 10 weeks after eradication regimen ) , probiotics based on evidence higher eradication rates , fewer side effects of triple regimen , and higher levels of anti - inflammatory cytokines , special licorice extracts achieving lower mutagenic actions as well as high rejuvenating activities of h. pylori - associated chronic atrophic gastritis , n-3 polyunsaturated fatty acids ( so called , omega-3 pufa ) through inhibiting bacterial adhesion and colonization , anti - inflammatory actions , higher regenerative activities , and lowered mutagenic outcomes , and s - allyl cysteine ( sac ) from garlic as demethylating agent globally regulating h. pylori - inflammatory activities.1722 common concerted mechanisms might be some rescue from antibiotics resistance . conclusively , natural phytochemicals possessing potential antioxidant and/or anti - inflammatory and anti - carcinogenic activities , which are exerted by regulating or targeting specific molecules against gastric cancer might potentiate the efficacy of h. pylori removal to achieve gastric cancer prevention.23 currently we are waiting the results from anticipating role of stem cells to rejuvenate h. pylori - atrophic gastritis , on - going study . korean perspective regarding h. pylori eradication and gastric cancer prevention will be enriched with a couple of year because clear limitation of current strategy of endoscopic surveillance was shown in korea . recent cancer statistics from united states24 showed that a total of 1,660,290 new cancer cases and 580,350 cancer deaths are projected to occur in the us in 2013 . during the most recent 5 years for which there are data ( 20052009 ) , delay - adjusted cancer incidence rates declined slightly in men ( by 0.6% per year ) and were stable in women , while cancer death rates decreased by 1.8% per year in men and by 1.5% per year in women . interestingly , death rates continue to decline for all 4 major cancer sites ( lung , colorectum , breast , and prostate ) and over the past 10 years of data ( 20002009 ) , the largest annual declines in death rates were for chronic myeloid leukemia ( 8.4% ) , cancers of the stomach ( 3.1% ) and colorectum ( 3.0% ) , and non - hodgkin lymphoma ( 3.0% ) . the reduction in overall cancer death rates since 1990 in men and 1991 in women translates to the avoidance of approximately 1.18 million deaths from cancer , with 152,900 of these deaths averted in 2009 alone . though small decline witnessed in gastric cancer mortality from this statistics , japan government is also awaiting remarkable decline in gastric cancer incidence as well as mortality from the commencement of h. pylori eradication in patients with chronic gastritis . our korean government should pay attention in this japanese effort to prevent gastric cancer through extending treatment guideline of h. pylori infection in spite of ambiguous debates . | the guideline of the korean college of helicobacter and upper gastrointestinal research group for helicobacter pylori infection was first produced in 1998 .
definite indication for h. pylori eradication is early gastric cancer in addition to the previous indications of peptic ulcer ( pud ) including scar lesion and marginal zone b cell lymphoma ( malt type ) .
though treatment regimen was similar , japan government declared the inclusion of h. pylori eradication in patients with h. pylori - associated chronic gastritis , suggesting the treatment guideline is quite different between korea and japan from february 21 , 2013 .
the prime rationale of japanese extended treatment guideline for h. pylori infection was based on the drastic intention to prevent gastric cancer according to their beliefs that h. pylori eradication can decrease gastric cancer incidence as well as mortality . in this review ,
the discrepancy in treatment guideline between korea and japan will be explained . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
color and surface roughness are very important properties in aesthetics , characterizing
a smile . since the introduction of
composites in 1960 , efforts have been made to increase the longevity of composite
restorations . although some progress has been made , optical properties in this type of
materials need to be improved . the color change of composites is multifactorial , being associated with intrinsic
discoloration and extrinsic staining of the material . intrinsic factors involve changes
in the chemical stability of resin matrix and matrix / particles interface , and extrinsic
factors are related to absorption of staining solutions from exogenous sources related
to hygiene habits , food , and smoking . composite structure and the characteristics of the inorganic fillers have a direct
impact on composite resin surface smoothness and susceptibility to extrinsic staining . several studies have shown that
composite resins are susceptible to color alteration when exposed to staining solutions ,
especially red wine , coffee , cola , tea and whisky . furthermore , this
property depends on both water absorption of the composite and its hydrophilic resin
matrix to allow permeation of staining agents , thus resulting in greater color
changes . today , the number of people using mouth rinse solutions for anti - microbial control has
increased not only because of professional recommendations , but also due to the capacity
of such materials to provide cooling sensation and to reduce halitosis . mouth rinse solutions have various
components such as detergents , emulsifiers , organic acids , dyes and alcohol . it is known
that composite resins exposed to ethanol exhibit lower microhardness values compared to
non - exposed materials . according to
sarret , et al.(2000 ) , alcohol acts
as a plasticizer of the polymeric matrix , making the material more ductile . in addition ,
ethanol can reduce bonding between resin matrix and inorganic fillers , which might
decrease erosion resistance and cause staining of resin matrix . thus , the purpose of this study was to evaluate the effect of mouth rinse solutions on
color stability , surface roughness and microhardness of composite resins . the null
hypothesis stated that mouth rinse solutions would not promote changes in the properties
of the studied composites . two direct composite resins ( shade a3 ) currently indicated for esthetic anterior and
posterior restorations were used in the present study . bis - gma : bisphenol a diglycidyl ether dimethacrylate ; bis - ema : ethoxylated
bisphenol a dimethacrylate , tegdma : triethylene glycol dimethacrylate ; udma :
urethane dimethacrylate fifty cylindrical test specimens ( 12 mm diameter x 2 mm thick ) of each composite were
made using a teflon matrix . each material was inserted into the matrix in 2
increments and light - activated by a led device ( flashlite 1401 , discus dental , culver
city , ca , usa , light intensity 1100 mw / cm , wavelength in the range
between 460 and 480 nm ) , for 20 seconds , according to manufacturer 's recommendations .
the specimens were polished with 320 , 600 , 1200 and 2000-grit sandpapers . the
thickness of every test specimen was checked with a digital caliper ( digimess , so
paulo , sp , brazil ) . next , the test specimens were randomly separated into 5 groups
( n=10 ) according to the mouth rinse solution in which they had been immersed ( figure 2 ) : group 1 - distilled water ( control ) ;
group 2 - plax classic ; group 3 - plax alcohol - free ; group 4 - periogard ; and group 5
- listerine cool mint . to simulate the use of mouth rinse solutions once a day during a period of 1 year , the test specimens were submitted to 12 cycles of 1-min immersion , then washed in
running water and immersed in distilled water for 29 min at 37c , during 30 days ,
totaling 360 cycles . before immersion , color reading of the test specimens was performed according to the
cie ( commission internationale de l'eclairage ) l*a*b * system , against a white
background ( standard for 45/0 ; gardner laboratory inc . , bethesda , md , usa ) in a
reflection spectrophotometer ( pcb 6807 , byk gardner , geretsried , germany ) . this
equipment is specific for color reading and has 30 led lamps with 10 different colors
arranged in a circle , which directs a light bundle at 45 with the material surface . this light bundle is reflected 0 back to the equipment , which captures and records
the l * , a * and b * values of each specimen . the l * axes refers to the lightness
coordinate and its value ranges from zero ( black ) to 100 ( white ) . the axis a * and b *
are chromaticity coordinates in the red - green axis and the yellow - blue axis ,
respectively . positive a * values indicate a shift to red and negative values indicate
a shift to green . similarly , positive b * values indicate the yellow color range and
negative values indicate the blue color range . after immersion in mouth rinse solutions , specimens color was measured by the
spectrophotometer , as previously described . based on the l * , a * , b * values , color
variation ( de ) was determined using the following equation : e=[(l*)+(a*)+(b * ) ] values of e3.3 were considered clinically unacceptable . surface roughness ( ra ) and knoop microhardness of the test specimens were
performed before and after mouth rinse solution immersion . surface roughness was
measured with a rugosimeter ( mitutoyo sj-201p , mitutoyo , tokyo , japan ) , cut - off -
0.25 mm , lc parameter - 1.25 , speed - 0.1 mm / s . the rugosimeter needle ( 10
m diameter ) was positioned over each test specimen , performing three readings in
different locations of the sample surface , after which , the mean roughness of the
test specimens were obtained . surface roughness changes were calculated by the
differences between mean values obtained before and after immersion . the knoop microhardness of the test specimens was measured ( shimadzu device , hmv
shimadzu , kyoto , japan ) in three different points , with a 10 n/15 s load . after three
readings , the microhardness mean values of the test specimens were obtained . for
knoop microhardness calculation , the baseline mean values were subtracted from those
obtained after immersion . for each property , data obtained were subjected to two - way anova and the measurements
were compared by the bonferroni 's test . two direct composite resins ( shade a3 ) currently indicated for esthetic anterior and
posterior restorations were used in the present study . bis - gma : bisphenol a diglycidyl ether dimethacrylate ; bis - ema : ethoxylated
bisphenol a dimethacrylate , tegdma : triethylene glycol dimethacrylate ; udma :
urethane dimethacrylate fifty cylindrical test specimens ( 12 mm diameter x 2 mm thick ) of each composite were
made using a teflon matrix . each material was inserted into the matrix in 2
increments and light - activated by a led device ( flashlite 1401 , discus dental , culver
city , ca , usa , light intensity 1100 mw / cm , wavelength in the range
between 460 and 480 nm ) , for 20 seconds , according to manufacturer 's recommendations .
the specimens were polished with 320 , 600 , 1200 and 2000-grit sandpapers . the
thickness of every test specimen was checked with a digital caliper ( digimess , so
paulo , sp , brazil ) . next , the test specimens were randomly separated into 5 groups
( n=10 ) according to the mouth rinse solution in which they had been immersed ( figure 2 ) : group 1 - distilled water ( control ) ;
group 2 - plax classic ; group 3 - plax alcohol - free ; group 4 - periogard ; and group 5
- listerine cool mint . to simulate the use of mouth rinse solutions once a day during a period of 1 year , the test specimens were submitted to 12 cycles of 1-min immersion , then washed in
running water and immersed in distilled water for 29 min at 37c , during 30 days ,
totaling 360 cycles . before immersion , color reading of the test specimens was performed according to the
cie ( commission internationale de l'eclairage ) l*a*b * system , against a white
background ( standard for 45/0 ; gardner laboratory inc . , bethesda , md , usa ) in a
reflection spectrophotometer ( pcb 6807 , byk gardner , geretsried , germany ) . this
equipment is specific for color reading and has 30 led lamps with 10 different colors
arranged in a circle , which directs a light bundle at 45 with the material surface . this light bundle is reflected 0 back to the equipment , which captures and records
the l * , a * and b * values of each specimen . the l * axes refers to the lightness
coordinate and its value ranges from zero ( black ) to 100 ( white ) . the axis a * and b *
are chromaticity coordinates in the red - green axis and the yellow - blue axis ,
respectively . positive a * values indicate a shift to red and negative values indicate
a shift to green . similarly , positive b * values indicate the yellow color range and
negative values indicate the blue color range . after immersion in mouth rinse solutions , specimens color was measured by the
spectrophotometer , as previously described . based on the l * , a * , b * values , color
variation ( de ) was determined using the following equation : e=[(l*)+(a*)+(b * ) ] values of e3.3 were considered clinically unacceptable . surface roughness ( ra ) and knoop microhardness of the test specimens were
performed before and after mouth rinse solution immersion . surface roughness was
measured with a rugosimeter ( mitutoyo sj-201p , mitutoyo , tokyo , japan ) , cut - off -
0.25 mm , lc parameter - 1.25 , speed - 0.1 mm / s . the rugosimeter needle ( 10
m diameter ) was positioned over each test specimen , performing three readings in
different locations of the sample surface , after which , the mean roughness of the
test specimens were obtained . surface roughness changes were calculated by the
differences between mean values obtained before and after immersion . the knoop microhardness of the test specimens was measured ( shimadzu device , hmv
shimadzu , kyoto , japan ) in three different points , with a 10 n/15 s load . after three
readings , the microhardness mean values of the test specimens were obtained . for
knoop microhardness calculation , for each property , data obtained were subjected to two - way anova and the measurements
were compared by the bonferroni 's test . the mean values and standard deviations for color stability ( e ) changes are
presented in table 1 . none of the studied
composites exhibited color change with values above the clinically acceptable limit
( e3.3 ) . with regard to
z250 , comparison of the effects of different mouth rinse solutions revealed a small
color change for specimens immersed in listerine , with statistically significant
difference compared with the other mouth rinse solutions ( p<0.05 ) when immersed
in plax classic solution , this composite exhibited an intermediate de value without
statistically significant difference compared to other mouth rinse solutions
( p>0.05 ) . with regard to z350 , the highest de change was observed for plax
alcohol - free solution , with statistically significant difference compared with the
other solutions ( p>0.05 ) , except for listerine . comparing the composites to each
other , it was observed statistically significant difference ( p<0.05 ) for the test
specimens immersed in distilled water ( control ) , with both plax classic and periogard
solutions allowing smaller color changes for z350 . means ( standard deviations ) for e values ( 2-way anova , bonferroni 's
test ; p<0.05 ) different lowercase letters in lines and uppercase letters in columns
indicate statistically significant difference . the mean values and standard deviations for surface roughness ( ra ) changes
are presented in table 2 . for both
composites , the greatest change in ra occurred when the samples were
immersed in listerine solution , with statistically significant difference compared
with plax alcohol - free ( p<0.05 ) . when compared to each other ,
z250 and z350 , showed no statistically significant difference
( p>0.05 ) regarding any studied mouth rinse solution . means ( standard deviations ) for ra ( % ) values ( 2-way anova ,
bonferroni 's test ; p<0.05 ) different lowercase letters in lines and uppercase letters in columns
indicate statistically significant difference . the mean values and standard deviations for knoop microhardness changes are presented
in table 3 . when compared to each other , z250
and z350 showed no statistically significant difference ( p>0.05 )
regarding any studied mouth rinse solution . immersion of z350 in plax alcohol - free
solution resulted in greater decrease of microhardness values , with statistically
significant difference in relation to the other mouth rinse solutions
( p<0.05 ) . means ( standard deviations ) for knoop microhardness ( % ) values ( 2-way anova ,
bonferroni 's test ; p<0.05 ) different lowercase letters in lines and uppercase letters in columns
indicate statistically significant difference . the mean values and standard deviations for color stability ( e ) changes are
presented in table 1 . none of the studied
composites exhibited color change with values above the clinically acceptable limit
( e3.3 ) . with regard to
z250 , comparison of the effects of different mouth rinse solutions revealed a small
color change for specimens immersed in listerine , with statistically significant
difference compared with the other mouth rinse solutions ( p<0.05 ) when immersed
in plax classic solution , this composite exhibited an intermediate de value without
statistically significant difference compared to other mouth rinse solutions
( p>0.05 ) . with regard to z350 , the highest de change was observed for plax
alcohol - free solution , with statistically significant difference compared with the
other solutions ( p>0.05 ) , except for listerine . comparing the composites to each
other , it was observed statistically significant difference ( p<0.05 ) for the test
specimens immersed in distilled water ( control ) , with both plax classic and periogard
solutions allowing smaller color changes for z350 . means ( standard deviations ) for e values ( 2-way anova , bonferroni 's
test ; p<0.05 ) different lowercase letters in lines and uppercase letters in columns
indicate statistically significant difference . the mean values and standard deviations for surface roughness ( ra ) changes
are presented in table 2 . for both
composites , the greatest change in ra occurred when the samples were
immersed in listerine solution , with statistically significant difference compared
with plax alcohol - free ( p<0.05 ) . when compared to each other ,
z250 and z350 , showed no statistically significant difference
( p>0.05 ) regarding any studied mouth rinse solution . means ( standard deviations ) for ra ( % ) values ( 2-way anova ,
bonferroni 's test ; p<0.05 ) different lowercase letters in lines and uppercase letters in columns
indicate statistically significant difference . the mean values and standard deviations for knoop microhardness changes are presented
in table 3 . when compared to each other , z250
and z350 showed no statistically significant difference ( p>0.05 )
regarding any studied mouth rinse solution . immersion of z350 in plax alcohol - free
solution resulted in greater decrease of microhardness values , with statistically
significant difference in relation to the other mouth rinse solutions
( p<0.05 ) . means ( standard deviations ) for knoop microhardness ( % ) values ( 2-way anova ,
bonferroni 's test ; p<0.05 ) different lowercase letters in lines and uppercase letters in columns
indicate statistically significant difference . the variability in our results was consistent with other studies , which showed that
several factors , including composite resin type , mouth rinse solution and immersion
cycle , had a significant influence on color stability , surface roughness and
microhardness of composites . the methodology used in the present
study is according to previous studies that used spectrophotometry and the cie l*a*b *
coordinates system . the cie l*a*b * system was chosen to evaluate color
variation ( de ) because it is appropriate for small color changes determination and have
advantages such as repeatability , sensitivity and objectivity . several authors have reported that e values ranging from 1 to 3 are perceptible to the
naked eye and e values greater than
3.3 are clinically unacceptable . considering these concepts ; the composite resins tested in the present study
demonstrated acceptable color stability when stored in the different types of mouth
rinse solutions ( table 1 ) . the affinity of the resin matrix for stains is modulated by its conversion degree and by
some physical properties , such as water sorption . it has been reported that
water uptake in bis - gma based composite resins increased from 3 to 6% , as the proportion
of tegdma increased from 0 to 1% . udma seems to be more stain resistant than bis - gma , and under normal curing conditions , udma based composite resins
presented lower water sorption and higher color stability than other dimethacrylates in
their resin matrix , which could be observed in the present study . moreover , it is important that the composite resin presents uniform filler particle
distribution in the polymer network to minimize the formation of filler - rich and
filler - depleted areas within the composites . this is especially important regarding the
performance of composites in aqueous environments , such as mouth rinse solutions , since
voids or nonbonding spaces at the filler / matrix interface may increase the water
sorption of composites . nanocomposites correspond to a class of new materials with nanoscale inorganic filler
particles dispersed within the resinous matrix . in comparison with microhybrid composites , these materials have
been reported to have improved properties , such as , elasticity modulus , mechanical
strength and color stability . furthermore , these improvements are achieved at low
concentrations of the inorganic filler particles . this fact contrasts strongly with
conventional filled composites , which generally require high loadings within the range
of 60% . this is an important factor in aesthetic maintenance of
non - particulate composites , since filler particles are responsible for spreading the
light , which in turn , provides the opacity of the restorative resin materials . the
larger the filler particle size the greater the light spread , and consequently , the
greater the opacity . the opacity of
composites increases as the difference between the refraction indexes of resinous matrix
and filler particles also increases . in addition , the smaller the filler particle , the smaller the amount of water absorbed
by the polymer network , which results in lower degradation of the interface
matrix / particle , and consequently , lower color change . the z250 contains filler particles with average size of
0.6 m , while z350 contains filler particles ranging from 5 to 20 nm , which could
explain the greater color stability for z350 . also , according to kawaguchi , et al.(1994 ) , microhybrid composites present a lower
coefficient of light transmission due to the various sizes of their particles , which
contributed to the higher values of e for z250 . according to villalta , et al.30
( 2006 ) , the low ph and alcohol concentration of solutions affect the
surface roughness of composite resins and cause staining . nevertheless , the composite
z350 presented statistically significant difference regarding color stability , surface
roughness and microhardness values when the composite was immersed in the alcohol - free
mouth rinse solution ( plax alcohol - free ) , thus contradicting the results of a previous
study ( 2011 ) demonstrated that
despite the absence of alcohol , plax alcohol - free has phosphoric acid in its
composition , which might alter the polymer matrix of composites by catalysis of the
ester groups present in the dimethacrylate monomers . the hydrolysis of the ester groups
forms alcohol and carboxylic acid molecules , which accelerate polymer network
degradation by the decrease of ph inside the composite matrix . the
degradation of the polymer network leads to a phenomenon called " plasticization " , which
decreases microhardness values in composites . according to the methodology used in the present study , the negative values regarding
microhardness represent a smoothening of the resin matrix , and positive values ,
hardening . despite the great decrease in the composite microhardness ( -25.73 ) , the
surface roughness improved when compared to the pre - immersion values , except when the
composite was immersed in the plax alcohol - free solution . the same result was observed
for z250 , since a significant change in surface roughness was found after immersion into
the same mouth rinse solution . it is worth emphasizing , however , that there exists a
critical value regarding surface roughness change ( ra0.2 m ) . according to
bollen , et al.(1997 ) , another critical value for
ra is 0.3 m , which can be detected when the patient 's lips or tongue
enters in contact with the restorative material , causing discomfort . none of the studied composites showed
values for surface roughness change above the critical limits , irrespective of the type
of mouth rinse solution used . asmussen ( 1984 ) reported that mouth
rinse solutions with high alcohol content might soften the composite resin , especially
bis - gma - based composites . ( 1997 ) showed that regardless of the alcohol concentration , both
alcohol - containing and alcohol - free mouth rinse solutions could affect the properties of
composite resins . immersed of z350 in listerine , the mouth rinse solution with the
highest alcohol concentration ( 30% ) , resulted in decrease in microhardness values ,
though with no significant difference from the other mouth rinse solutions . as for z250 ,
the results were the opposite ; there was an increase in the microhardness values when
immersed in listerine and a decrease when immersed in plax alcohol - free solution , with
statistically significant difference . these results suggest that changes in the
microhardness of composites do not depend on mouth rinse 's ethanol
concentration . z350 showed significant
changes when immersed in listerine and plax alcohol - free solutions , both having entirely
different concentrations of ethanol . however , this fact could be explained , once again , by the presence of phosphoric acid in
plax alcohol - free composition . studies have reported the release of by - products from
polymer network degradation , such as methacrylic acid , formaldehyde and specific
methacrylate molecules , which are capable of promoting color change in
composites . on the other hand , z250 had greater color change when immersed in listerine compared to
the other solutions , unlike celik , et al . ( 2008 ) , who found no color change in the composites immersed in the
same mouth rinse solution , despite the high ethanol concentration . clinically , the effect of mouth rinse solutions on restorative materials can be modified
by several factors that were not replicated in this in vitro study .
among these factors , saliva could dilute or buffer ph of mouth rinse solutions , thus
reducing the effect of resinous matrix plasticization and forming a pellicle that could have a protective
effect on the composite surface , thus , decreasing material staining . based on such factors , further
in vivo studies are needed to determine the effects of mouth rinse
solutions on these properties of composites . the results of the present study allow us to conclude that the changes observed in the
composites depended on the material itself rather than the mouth rinse solution
used . | objectivethe purpose of this study was to evaluate the effect of mouth rinse solutions on
color stability , surface roughness and microhardness of two composite resins .
material and methods fifty test specimens of each composite ( filtek z250 and z350 ; 3 m espe ) were made
using a teflon matrix ( 12x2 mm ) .
color , surface roughness and knoop microhardness
baseline measurements of each specimen were made and specimens ( n=10 ) were
immersed in 5 mouth rinse solutions : g1 : distilled water ( control ) , g2 : plax
classic , g3 : plax alcohol - free ; g4 : periogard , and g5 : listerine .
final
measurements of color , roughness and microhardness were performed and the results
submitted to statistical analysis ( 2-way anova , bonferroni 's test ; p<0.05 ) .
results the most significant color change was observed for z250 when immersed in
listerine ( p<0.05 ) .
z350 showed greater color change when immersed in plax
alcohol - free ( p<0.05 ) , but with no significant difference for listerine
( p>0.05 ) .
with regard to roughness , both composites showed significant changes
when immersed in listerine in comparison with plax alcohol - free ( p<0.05 ) .
microhardness of z350 was shown to be significantly changed when the composite was
immersed in plax alcohol - free ( p<0.05 ) .
conclusion composite changes depended on the material itself rather than the mouth rinse
solution used . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
munchausen syndrome is characterized by feigning physical symptoms to seek attention ; it was first reported by asher in 1951 . we report a case of cutaneous munchausen syndrome in a patient who self - inflicted trauma to a postoperative wound . a 50-year - old japanese woman consulted the emergency department of our hospital in august 2015 for bleeding due to an intractable postoperative wound on the lower abdomen ; the postoperative wound was owing to a laparoscopic cholecystectomy performed 1 year previously for acute cholecystitis . the wound was sutured and the patient consulted with the dermatology department 3 days later ( fig . , she presented with a painful ulcer ( diameter 6 cm ) on her right lower abdomen , and its suture had disappeared ( fig . she also presented with multiple scars , skin grafts on the extremities , and a missing left lower leg , the causes for all of which were unexplained ( fig . 2 ) . her white blood cell count , neutrophil number , platelet count , renal and liver functions , c - reactive protein level , and ch50 level were normal , except for the hemoglobin level ( 9.2 g / dl ; normal range 12.015.0 g / dl ) . negative results were obtained for cytoplasmic antineutrophil cytoplasmic antibodies , myeloperoxidase antineutrophil cytoplasmic antibodies , and anti - ss - a antibodies . a histology of the skin biopsy specimen from the margin of the abdominal ulcer did not show any specific findings such as pyoderma gangrenosum or vasculitis , although we had considered these as differential diagnoses . she had been presenting with repeated intractable wounds since she was a child , which resulted in the amputation of her left lower leg . although we asked her about the scar and amputation , she did not reveal any details . the previous surgeon who had performed the laparoscopic cholecystectomy 1 year before revealed that surgical wound dehiscence had occurred during her admission . after her medical records indicated that she had been admitted to the department of plastic surgery at our hospital for skin grafting of a leg ulcer 10 years before . during that admission , she refused to consult with the department of psychiatry , although the staff suspected mental disorders . therefore , we diagnosed her with cutaneous munchausen syndrome , although we could not determine how she had traumatized the postoperative wound . after vacuum - assisted closure ( vac ) therapy had been performed to prevent her from traumatizing the ulcer again , it rapidly became granulated and reepithelialized ( fig . soon after we had told her that we had diagnosed her with cutaneous munchausen syndrome , she discharged herself . munchausen syndrome is a disorder characterized by a triad of features : simulated illness , pathological lying , and nomadic living . people with this syndrome self - inflict numerous lesions , keep getting admitted to different hospitals , and feign acute illness , usually spectacular diseases ; and they willingly undergo invasive diagnostic procedures and risky therapies [ 3 , 4 ] . typical findings in cutaneous munchausen syndrome caused by the intracutaneous presence of foreign material are erythema , swelling , necrosis , and tissue breakdown , which present as ulcerations , abscesses , nodular panniculitis , and pyoderma gangrenosum [ 2 , 5 ] . most patients with cutaneous munchausen syndrome inject foreign materials into their skin and soft tissue ; however , our patient traumatized her postoperative wound . the diagnosis of munchausen syndrome , which can sometimes be fatal , is often difficult to make . also , hospital room and personal - belonging searches can provide evidence of methods for faking symptoms , and video monitoring or a bedside sitter can be helpful , as these techniques often reduce or eliminate symptom frequency during observation . however , searches and monitoring should be performed after approval has been granted from the institution 's legal counsel . diagnostic clues include cultured organisms from cutaneous wounds that are uncommonly found on the skin , usually on the nondominant side of the body [ 1 , 2 ] . cutaneous munchausen syndrome should be considered as a differential diagnosis when a patient 's skin lesions do not heal or when they repeatedly recur despite appropriate treatment , and if routine detailed examinations show negative or normal results . | a 50-year - old japanese woman consulted the emergency department of our hospital for bleeding due to an intractable postoperative wound on the lower abdomen ; the postoperative wound was owing to a laparoscopic cholecystectomy performed 1 year previously for acute cholecystitis .
she presented with a painful ulcer on her right lower abdomen .
she also presented with multiple scars , skin grafts on the extremities , and a missing left lower leg , the causes for all of which were unexplained .
the results of her blood test were normal , except for the hemoglobin level .
histology of the skin biopsy specimen from the ulcer did not show any specific findings .
the previous surgeon who had performed the laparoscopic cholecystectomy revealed that surgical wound dehiscence had occurred during her admission .
after a body restraint had been applied , the ulcer improved .
medical records indicated that she had been admitted to the department of plastic surgery at our hospital for skin grafting of a leg ulcer . during that admission
, she refused to consult with the department of psychiatry , al - though the staff suspected mental disorders .
therefore , we diagnosed her with cutaneous munchausen syndrome .
after vacuum - assisted closure ( vac ) therapy had been performed to prevent her from traumatizing the ulcer again , it rapidly became granulated and reepithelialized . munchausen syndrome is characterized by feigning physical symptoms to seek attention .
patients self - inflict numerous lesions , keep getting admitted to different hospitals , and feign acute illness , usually spectacular diseases .
vac therapy may be effective for preventing patients with cutaneous munchausen syndrome from traumatizing their wounds . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
successful rehabilitation of patients with severely atrophied jaws who demand implant therapy is a challenging procedure 1 due to insufficient bone for implant insertion , a reversed intermaxillary relationship 2 and an increased inter - arch space 3 . although the sinus bone grafting is a reliable reconstructive technique which provides adequate bone volume 4,5 in maxillary posterior area , sagital , and vertical discrepancies in such cases are more than what could be solved with sinus lifting or simple bone grafting . therefore , for correcting extreme deficiencies , ortho - surgery along with bone grafting is recommended 69 . in these complex cases , the treatment plan includes several surgical interventions including orthognathic surgery , bone grafting , and implant insertion , which could be done in a variant number of steps and sequences 2,10,11 . one approach which has shown good results is le fort i osteotomy combined with interpositional grafts 12,13 . it could be followed by delayed 14 or immediate 2 implant insertion . however , the skeletal relapse is considered the most common complication after orthosurgery 15,16 . as any adaptive changes in the orofacial complex may lead to relapse 17 , the occlusion stability is important to prevent it ; but unfortunately we usually encounter edentulous patients whose dentures lack retention and occlusal stability . this article reports a modified approach for step by step rehabilitation of an edentulous case that has experienced two unsuccessful ortho - surgical jaw corrections . in 2012 a 64-year - old female patient referred to the clinic claiming for esthetic and functional oral rehabilitation . she expressed extreme dissatisfaction with her profile and her loose - fitting prosthesis ; and she wanted to have a fixed prosthesis . the patient stated that she had been subjected to reconstructive surgery twice in order to improve her profile but both procedures resulted in relapse . the first had been done during trauma management after a car accident she had , and the second ortho - surgical correction was 18 months later . clinical and radiographic examination revealed that only left maxillary premolars and both mandibular canines were present in the oral cavity ( fig . in addition , midfacial soft tissue collapse due to the maxillary retrusion and a class iii jaw relationship were detected ( fig . in panoramic view , bilateral pneumatized sinus cavities and the plates and screws of the previous surgeries were evident ( fig . the residual bone height ( rbh ) was 12 mm at the former position of the maxillary central and lateral incisors , 8 mm of the second premolar , and 7 mm of the first molar ( fig . after the whole procedure was explained to the patient ; she signed a written informed consent form . primary impressions of maxillary and mandibular arches were made using irreversible hydrocolloid impression material ( alginate ; zhermack , spa , padua , italy ) ; then record bases and wax rims were fabricated on the casts according to normal landmarks , and were arbitrarily mounted on a semi - adjustable articulator ( stratos 300 , ivoclar vivadent , liechtenstein ) . , they were hand articulated based on a normal imaginary maxilla - mandibular relationship . setting up the denture teeth was accomplished on the residual ridge , and clear dentures as surgical guides for implant insertion were processed . as there was no need to increase height of the bone , they were also used as surgical guides for bone grafting . in one session , implant insertion and bone grafting were carried out simultaneously . as height of bone in the anterior region of maxilla was adequate , it is was only augmented in width ; and the posterior region was sinus lifted . in the mandibular view fourteen implants ( implantium , dentium , seoul , south korea ) , eight in the maxilla ( sites 1.2 , 1.4 , 1.5 , 1.6 , 2.1 , 2.3 , 2.4 , and 2.5 ) and six in the mandible ( sites 3.1 , 3.3 , 3.4 , 4.2 , 4.3 , and 4.5 ) were inserted ( fig . the implant insertion torque value applied was not less than 20n cm for all implants . ( b ) postimplant insertion lateral cephalometric view . obviously , because of the extreme intermaxillary relationship ( fig . 2b ) , the patient could not have a good prosthesis with these implants ; especially a fixed one . after a healing period of 4 months , six implants in mandible and five implants in maxilla were uncovered and implant level impressions with a regular - viscosity polyether ( impregum , espe dental , seefeld , germany ) in a custom impression tray were made . once again record bases were fabricated ; and the casts were hand articulated the same as before . castable abutments ( implantium , dentium , seoul , south korea ) were selected , and maxillary and mandibular frameworks for supporting provisional restorations were made and tried in the mouth to check passive fitness . each framework had five hooks in the buccal side which were considered to use elastics after orthognathic surgery ( fig . the metal - acrylic provisional restorations were finalized and were checked in the mouth ( fig . 4a and b ) . as expected , they could not have occlusion in mouth ; because they were fabricated on an arbitrarily mounted relation . an interocclusal record with an addition silicone - based occlusal registration material ( futar d fast ; kettenbach , eschenburg , germany ) and a facebow record were taken . pick up impressions with polyvinyl siloxane impression material ( panasil , kettenbach , eschenburg , germany ) were made , and study casts for the model surgery were prepared ( fig . ( a ) try in of maxillary metal framework with hooks in the buccal side . ( b ) try in of mandibular metal framework with hooks in the buccal side . ( a ) intra - oral frontal view of provisional restorations before ortho - surgery . ( b ) lateral view of the patient with provisional restorations in mouth before surgery . ( c ) mounted provisional restorations according to the class iii jaw relationship of the patient . by preoperative evaluations , the surgeon determined 8 mm maxillary advancement and 6 mm mandibular setback required to be done . as a bimaxillary surgery was considered , an intermediate splint 18 was made with self cure acrylic resin ( meliodent cold , herauskulzer , ltd . , model surgery was performed ; and exactly a day before surgery , the provisional restorations were delivered to the patient . therefore , during surgery , the surgeon was able to use the intercuspation of prosthesis in order to reorient maxilla and mandible ( fig . definitive implant level impressions were made ; after setting up the teeth , a silicone index was used to aid in abutment selection . c ) . ( a ) intra - oral frontal view of metal frameworks of final restorations . to achieve a satisfactory result in treating a case of severely atrophied jaws , particular problems including lack of bone volume to insert implants 2 and compromised facial esthetics in both antero - posterior and vertical dimensions are encountered 3 . according to the available literature , different approaches have been proposed to address these problems and each differ in the number of steps and in the sequence of the steps 2,10,11 . some investigators 2,1921 reported a one step procedure in which orthognathic surgery , bone grafting , and implant placement were all simultaneously done . based on the case , the one step procedure would be a combination of le fort i osteotomy and implant placement without any bone grafting 22 . the one step procedure still poses risk of graft and implant loss 2,23 which should be weighed against its advantage of short time of rehabilitation 20 . some others 10,24 described a two - step procedure including le fort i osteotomy combined with grafting of the floor of the sinus and nose at first step , and implant placement at further step . in addition ; precise position and inclination of implants using a drill guide based on ct scans is possible gil et al . 11 suggested a three - step procedure including maxillary bone reconstruction , implant insertion and a fixed prosthetic rehabilitation in the existing class iii occlusion ; followed by orthognathic surgery . beside the mentioned advantage of implant placement in a separate step , due to its special sequence , a desirable esthetic outcome is related to the accurate repositioning of the maxilla with the aid of fixed prosthesis ; which is hard to achieve with a removable one 11 . orthognathic surgical procedures first developed to correct the intermaxillary relationship in dentate patients 25 . however ; prosthesis assisted ortho - surgery allows fully edentulous 18 , partially edentulous 26 and some dentate patients like the ones who suffer from amelogenesis imperfecta 27 to take advantage of orthognathic surgery benefits . in this article , the authors emphasize the importance of implant assisted ortho - surgery in severely atrophied edentulous cases who could not receive a stable denture . in this way , by implant insertion before orthognathic correction we can not only treat the patient with implant supported prosthesis but also we can ensure the intra- and postsurgical occlusal stability and the final result as well . moreover , patients could have normal function and esthetic faster after surgery . in this method , considering hooks in the framework of provisional restorations eliminated the need of using orthodontic appliances to allow intermaxillary fixation ; which made it distinct from the method introduced by gil et al . however , to assess long - term success rate of implants followed by ortho - surgery and the possibility of relapse , longer follow - up on a larger group of cases is required . | key clinical messagethe severely atrophy of jaws often complicates ideally oral reconstruction of esthetics and functionality , and necessitates different preprosthetic surgeries including bone grafting , ortho - surgery , and implant insertion .
the mentioned procedures could be done within different approaches .
this report describes the management of an edentulous case by implant insertion before orthognathic correction . |
Subsets and Splits