appln_id
int64 7.41k
576M
| appln_filing_date
stringlengths 10
10
| docdb_family_id
int64 3.49M
82.2M
| granted
stringclasses 2
values | appln_abstract
stringlengths 120
10k
| appln_abstract_lg
stringclasses 1
value | appln_title
stringlengths 4
567
| applt_coun
stringlengths 4
289
| invt_coun
stringlengths 8
347
| cpc
stringlengths 11
1.62k
| ipc
sequence | __index_level_0__
int64 25
167k
|
---|---|---|---|---|---|---|---|---|---|---|---|
283,259 | 2008-03-21 | 39,415,387 | Y | Racemic mixtures and enantiomerically pure forms of novel 1-[(2'- substituted)-piperazin-1'-yl]-isoquinolines are norepinephrine (NE) transporter (NET) inhibitor compounds. Compounds of the invention are considered therapeutic agents for central nervous system (CNS) diseases and disorders, without limitation, including neurodegeneration, anxiety, depression, attention deficit disorders, drug dependency, and post traumatic stress disorder. Examples of the chemical syntheses of the compounds of the invention are provided. The isoquinoline compounds of the invention competitively bind at NET at nanomolar concentrations. The isoquinoline agents of the invention bind selectively to NET over other competitive transporter targets and receptor binding sites, including those of serotonin and dopamine, amongst others. The chemical syntheses of the invention are suitable for labeling with radionuclide atoms. Radiolabeled forms of the novel 1-[(2'-substituted)-piperazin-1'- yl]-isoquinoline comoundss are positron emission tomography and single photon emission tomography imaging tracers. Methods of in vivo imaging with the tracers within various subjects and tissues therein, including regions of the brain, are provided. Imaging methods with the tracers in combination other NET inhibitor agents are provided. The imaging methods within subjects allow quantitative detection of NET, determinations of NET distributions, and measures of tracer interactions at NET in the presence or absence of non-radioactive NET agents. The tracer imaging methods are suitable to locate, diagnose, identify, evaluate, detect or quantitate NET, or abnormalities of NET, or NE abnormalities; that are associated with various CNS diseases and disorders. | en | 1-[(2'-SUBSTITUTED)-PIPERAZIN-1'-YL]-ISOQUINOLINES AS NOREPINEPHRINE TRANSPORTER INHIBITOR THERAPEUTICS AND POSITRON EMISSION TOMOGRAPHY IMAGING AGENTS | 467474_US | 467475_US,467476_US,467478_US,467477_US | A61P 25/00,A61P 25/22,A61P 25/24,A61P 25/28,A61P 25/30,C07D 401/04 | [
"A61P 25/22",
"A61K 31/496",
"A61P 25/28",
"A61P 25/24",
"C07D 401/04",
"A61P 25/30"
] | 1,602 |
484,161,079 | 2014-07-24 | 59,887,436 | Y | FIELD: medicine.SUBSTANCE: points are determined on the skull: occipital point - located on the occipital bone brow in the center of the nape; frontal point - at the intersection of the skull base and the sagittal suture of the frontal bone; right temporal point - at the intersection of the outer skull base and a vertical line from the mandibular fossa on the right; left temporal point - at the intersection of the outer skull base and a vertical line from the mandibular fossa on the left; diagnostic point - at the intersection of the line passing through the occipital and frontal point with a line passing through the right and left temporal points. The distance is measured: on the outer part of the head between the occipital and frontal points to the right and separately to the left; between the temporal points through the frontal bone and the distance between them through the occipital bone; the distance through the upper part of the skull between the occipital and diagnostic points and the distance between the frontal and diagnostic points; the distance between the left temporal and diagnostic points, and between the right temporal and diagnostic points. The distances measured to the right and left are compared. If the distance to the right is greater than the distance to the left - skull bones displacement to the right is diagnosed, if the distance to the right is less than the distance to the left - displacement to the left is diagnosed, and if the distance to the right is equal to the distance from the left - the absence of skull bones displacement is diagnosed.EFFECT: method allows to increase the reliability of diagnosis, which is achieved through an objective assessment of the measurements.2 cl, 5 dwg | en | METHOD FOR SKULL BONE DISPLACEMENT DIAGNOSTICS | 65542657_UA | 65542657_UA | A61B 5/0059,A61B 5/107,A61B 5/1072,A61B 5/1079,A61B 5/4504 | [
"A61B 5/107"
] | 111,971 |
16,938,338 | 1988-01-04 | 21,725,325 | Y | Method and apparatus for evaluating among the trunk and limbs of the body the distribution of two types of disorder affecting posture and equilibrium control: (1) inability to receive and correctly interpret somatosensory orientation and movement information derived from those body and limb parts in contact with supporting surfaces and (2) inability to coordinate the muscular contractions in those body and limb parts in contact with a supporting surface to execute functionally effective postural movements. In a preferred embodiment of the present invention: (1) the subject (10) assumes a position of equilibrium while at least two body or limb parts are supported on independent surfaces (11,11'); (2) support surface inputs are disrupted from all but one of the supported body or limb parts; (3) the ability of the subject to utilize support surface inputs from each supported body and limb part to maintain the assumed equilibrium position is assessed by measuring the extent of spontaneously occurring displacements from the assumed equilibrium position; (4) the ability of the subject to coordinate postural movements with each supported body or limb part is assessed by imposing brief waveforms of support surface displacements; (5) steps 1 through 4 are repeated with support surface inputs disrupted from a different combination of all but one of the supported body and limb parts; and (6) the distribution of impaired ability to receive and interpret support surface inputs and to coordinate postural movements among the body and limb parts providing postural support is selectively assessed by comparing quantitive measures of spontaneous displacements from the assumed equilibrium position and postural movements. <IMAGE> | en | Apparatus for movement coordination analysis | 449028_US | 3129074_US | A61B 5/1036,A61B 5/1116,A61B 5/389,A61B 5/4023,A61B 5/4519,A61B 5/4528,A61B 5/7264 | [
"A61B 5/11",
"A61B 5/22",
"A61B 5/103",
"A61B 5/0488"
] | 18,199 |
40,708,676 | 2004-07-02 | 33,554,503 | Y | PURPOSE: An amplification solid state image sensing device including pixels having an amplification function is provided to reduce reset noise and image sticking with a simple configuration and to maintain linearity of an output signal for an input optical signal. CONSTITUTION: An amplification solid state image sensing device includes a plurality of pixels(10) and a controller. Each of the pixels includes a photo-electric conversion region(4), a signal amplification field effect transistor(1) for amplifying a signal corresponding to the potential of the photo-electric conversion region, a reset field effect transistor(2) for discharging charges of the photo-electric conversion region to its drain, and a pixel selecting field effect transistor(3). The controller sequentially repeats a signal level reading period, the first reset period, a reset level reading period, the second reset period and the third reset period. During the signal level reading period, the potential level of the photo-electric conversion region is read through the signal amplification field effect transistor. During the first reset period, the reset field effect transistor carries out a soft reset operation by sub-threshold current. The potential level of the photo-electric conversion region, obtained by the soft reset operation, is read through the signal amplification field effect transistor during the reset level reading period. The reset field effect transistor carries out a hard reset operation to fix the potential of the photo-electric conversion region to a drain potential during the second reset period. The reset field effect transistor performs the soft reset operation by the sub-threshold current during the third reset period. | en | Amplification-Type Solid-State Image Pickup Device Incorporating Plurality of Arrayed Pixels with Amplification Function | 10403245_ | 15846963_ | H01L 27/146,H01L 27/14601,H04N 5/3597,H04N 5/363,H04N 5/374,H04N 5/378 | [
"H04N 5/378",
"H01L 27/00",
"H01L 27/146",
"H04N 5/374",
"H04N 5/363"
] | 26,362 |
524,923,796 | 2019-07-10 | 64,897,543 | N | A consensus method, device (42) and system based on effective computation power contribution. The method comprises receiving a computation task issued by a computation publisher (41) and a computation requirement corresponding to the computation task (101); creating a corresponding configuration of the computation task according to a computation requirement (102); acquiring the data needed by the computation task and compiling the computation task into a Boolean circuit (103); according to the Boolean circuit, the corresponding configuration of the computation task, and the data required for the computation task, forming a plurality of parallel computation tasks, and distributing the plurality of parallel computation tasks to a plurality of computation nodes (43) for computation (104); receiving a computation result and proof of computation created by the computation nodes (43) for the parallel computation tasks, and determining whether the computation result is valid according to the computation proof (105); if it is determined that the computation result is valid, determining a cumulative computation contribution value of the computation nodes (43) corresponding to the computation result, and allocating a preset reward for each computation node (43) according to the cumulative computation contribution value (106); receiving voting data regarding which the cumulative computation contribution value is taken by each computation node (43), and voting on candidate nodes (107); and using N preset candidate nodes that are the most voted for as N consensus nodes (108), wherein a practical Byzantine fault-tolerant algorithm is used to complete the consensus of block data among the N consensus nodes. | en | CONSENSUS METHOD, DEVICE AND SYSTEM BASED ON EFFECTIVE COMPUTATION POWER CONTRIBUTION | 71772533_CN | 71862613_CN,72014196_CN,74289936_CN | G06F 9/5027,G06F 9/5072,G06Q 20/065,G06Q 40/04 | [
"G06F 9/50"
] | 136,058 |
50,414,353 | 1973-07-13 | 27,363,994 | Y | Digital data in self-timing reference is free from error due to irregular data spacing because of variations in speed and/or direction of scan in manual or machine applications with a pulse modulation of retrospective nature. Initially reference data manifestations are established and thereafter digital data are established partly on the basis of preceding manifestations of the data. In a binary data translating system, for example, a pair of reference pulses are spaced apart by a given interval. A binary unit is thereafter manifested by a pulse following at the same or similar interval and a binary zero is manifested by a pulse following at a differing interval. Each manifestation of a binary number thereafter depends on the interval between preceding pulses. A principle advantage of retrospective pulse modulation lies in demodulation. Large variations in the spacing and relatively larger variations in the scanning speed are accommodated readily. Magnetic tape and like records can not only be addressed at conventional high speeds in searching and at conventional low speeds later used in reproducing but, also can be searched continuously as the change is made between those speeds. Adaptive rate communications are particularly enhanced by the principle. Optical scanning of bar codes is improved by differing the spacing of uniform width bars or with bars of differing widths and differing spacing. These arrangements are applicable to railroad car and like object identifying, label data processing, human identification, card data processing, graphic display data probing systems and many other uses. Synchronous and asynchronous capability permits input to almost any digital data processing system. | en | Retrospective pulse modulation including bar coding and apparatus therefor | 5217338_ | 38892680_ | G06F 3/0202,G06K 7/0166,G11B 20/1411,H04L 25/49 | [
"G06K 7/016",
"G06F 3/02",
"G11B 20/14",
"H04L 25/49"
] | 39,986 |
45,696,434 | 2003-04-16 | 29,248,341 | N | The retinal prosthesis test device is comprised of a thin wafer of glass (32) made from nanochannel glass (NGC) with very small channels perpendicular to the plane of the wafer filled with an electrical conductor forming microwires. One surface of the glass is ground to a spherical shape consistent with the radius of curvature of the inside of the retina (54). The NGC is hybridized to a silicon de-multiplexer and a video image is serially input to a narrow , flexible micro-cable (27) and read into a 2-D array of unit cells in a pixel-by-pixel manner which samples the analog video input and stores the value as a charge on a MOS capacitor. After all unit cells have been loaded with the pixel values for the current frame, a biphasic pulse is sent to each unit cell which modulates the pulse in proportion to the pixel value stored therein. Because the biphasic pulses flow in parallel to each unit cell from a global external connection, the adjacent retinal neurons are all stimulated simultaneously, analogous to image photons stimulating photoreceptors in a normal retina. A permanent retinal implant device uses a NGC array hybridized to a silicon chip, the image is simultaneously generated within each cell through a photon-to-electron conversion using a silicon photodiode. The photons propagate directly through into the backside of the device. Electrical power and any control signals are transmitted through an inductively driven coil or antenna on the chip. The device collects the charge in storage capacitors via the photon-to-electron conversion process, stimulates the neural tissue with biphasic pulses in proportion to the stored charges, and resets the storage capacitors to repeat the process. | en | MICROELECTRONIC STIMULATOR ARRAY | 36972703_US | 37025972_ | A61N 1/0543,A61N 1/36046,Y10S 977/789,Y10S 977/932,Y10S 977/943 | [
"A61N 1/05",
"A61N 1/08",
"A61N 1/36"
] | 31,448 |
15,955,401 | 2002-05-13 | 25,327,513 | N | An intelligent, rule-based processor provides a pulse indicator designating the occurrence of each pulse in a pulse oximeter-derived photo-plethysmograph waveform. When there is relatively no distortion corrupting the plethysmograph signal, the processor analyzes the shape of the pulses in the waveform to determine where in the waveform to generate the pulse indication. When distortion is present, looser waveform criteria are used to determine if pulses are present. If pulses are present, the pulse indication is based upon an averaged pulse rate. If no pulses are present, no indication occurs. The pulse indicator provides a trigger and amplitude output. The trigger output is used to initiate an audible tone 'beep' or a visual pulse indication on a display, such as a vertical spike on a horizontal trace or a corresponding indication on a bar display. The amplitude output is used to indicate data integrity and corresponding confidence in the computed values of saturation and pulse rate. The amplitude output can vary a characteristic of the pulse indicator, such as beep volume or frequency or the height of the visual display spike. The visual pulse indicator is supplemented by a signal quality alert. Combined with several indicators of signal quality, the alert is used to initiate a warning when data confidence is very low. The alert may be in the form of a message generated on the pulse oximeter display to warn that the accuracy of saturation and pulse rate measurements may be compromised. A confidence-based alarm utilizes signal quality measures to reduce the probability of false alarms when data confidence is low and to reduce the probability of missed events when data confidence is high. | en | PULSE OXIMETRY DATA CONFIDENCE INDICATOR | 52840_US | 44784984_US,44784983_US,44784982_US | A61B 5/02416,A61B 5/1455,A61B 5/14551,A61B 5/7207,A61B 5/7214,A61B 5/7221,A61B 5/7405,A61B 5/746,G16Z 99/00 | [
"A61B 5/00",
"A61B 5/1455",
"A61B 5/145",
"A61B 5/024",
"A61B 5/0245"
] | 14,282 |
4,760,396 | 2000-11-10 | 22,597,508 | N | A computational method designed to extract information about gene regulatory network from raw gene expression data sets that are comprised of a time cour se of expression levels is disclosed. At a first step in this method, genes wit h similar temporal expression profiles are clustered into modules characterizi ng by distinct expression signatures. These fundamental patterns of gene expression are analyzed using the assumption that temporal profiles are shap ed by interactions between genes belonging to different modules. The underlying genetic connectivity is retrieved using an optimization procedure developed in computational neurobiology for extracting information about neural circuitry . The objective is to find an optimal regulatory structure making calculated temporal patterns as close as possible to experimental data. A set of algorithms was used to evaluate statistical significance of putative regulatory connections derived from gene expression patterns. The method was utilized to identify regulatory subnetworks underlying the response of yeast cells to treatment with acid and alkaline conditions. Expression profiles of about 1600 genes that showed a significant change in expression during a tim e course were analyzed according to the method of the invention. The genes wer e clustered into 39 distinct modules and statistically significant connections between 16 modules representing most variable genes were identified and mapp ed to a sub-network of known connections. The results demonstrate that the computational method may be a useful tool both in elucidating of crucial elements of genetic network structure and in predicting novel regulatory connections based on gene expression. | en | COMPUTATIONAL METHOD FOR INFERRING ELEMENTS OF GENE REGULATORY NETWORK FROM TEMPORAL PATTERNS OF GENE EXPRESSION | 8613334_US | 16715397_US | G16B 5/00,G16B 25/00,G16B 25/10 | [
"C12N 15/09",
"C12N 15/00",
"G01N 33/48",
"G01N 33/50",
"C12Q 1/68",
"G06F 19/20",
"G06F 19/12"
] | 7,324 |
4,587,614 | 1998-03-23 | 25,239,653 | N | A negative-acting color proofing element comprising, sequentially, (i) a strippa ble, transparent cover sheet; (ii) a crosslinked layer, which comprises a polymer hav ing phenolic groups; (iii) a color layer, which comprises an organic binder, a polymerizable monomer, a colorant, and an optional photoinitiator, (iv) a photoadhering layer, which comprises a polymerizable component having at least one ethylenically unsaturated group; a polymer comprising polyvinyl acetal and polyvinyl alcohol segments, having from about 1 to about 40 weight % polyvinyl alcohol content; and an optional photoinitiator, wherein least one of either the color layer or the photoadhering layer contains a photoinitiator; (v) a thermoplastic adhesive layer; and (vii) a receiver sheet. Preferably the polymerizable compone nt and photoinitiator diffuse into the color layer during assembly of the element. An image is produced by laminating the photosensitive element to a receiver sheet; imagewise exposing the color layer and the photoadhering layer to actinic radiat ion through the transparent cover and crosslinked phenolic layer; peeling apart the receiver sheet and the transparent cover sheet, leaving exposed areas of the col or layer attached to the receiver sheet via the photoadhering layer and adhesive la yer and unexposed areas being removed with the cover sheet and the crosslinked phenolic layer, thereby forming a colored negative image on the receiver sheet. Preferably these image producing steps are repeated at least once wherein anothe r photosensitive element having a different colorant is transferred via its photoadhering and adhesive layers to the negative image previously produced on the receiver sheet. | en | NEGATIVE WORKING, PEEL DEVELOPABLE, SINGLE SHEET COLOR PROOFING SYSTEM WITH POLYVINYL ACETAL PHOTOADHERING LAYER | 5257420_US | 16560917_US,16162273_US,16560918_US,16560919_US,16154855_US,16560916_US | G03F 3/106,G03F 7/0048,G03F 7/027,G03F 7/029,G03F 7/033,G03F 7/0382,G03F 7/039 | [
"G03F 7/004",
"G03F 3/10",
"G03F 7/34"
] | 5,500 |
476,413,441 | 2016-11-23 | 58,256,916 | Y | A method and system for converting low-dose tomosynthesis projection images or reconstructed slices images with noise into higher quality, less noise, higher-dose-like tomosynthesis reconstructed slices, using of a trainable nonlinear regression (TNR) model with a patch-input-pixel-output scheme called a pixel-based TNR (PTNR). An image patch is extracted from an input raw projection views (images) of a breast acquired at a reduced x-ray radiation dose (lower-dose), and pixel values in the patch are entered into the PTNR as input. The output of the PTNR is a single pixel that corresponds to a center pixel of the input image patch. The PTNR is trained with matched pairs of raw projection views (images together with corresponding desired x-ray radiation dose raw projection views (images) (higher-dose). Through the training, the PTNR learns to convert low-dose raw projection images to high-dose-like raw projection images. Once trained, the trained PTNR does not require the higher-dose raw projection images anymore. When a new reduced x-ray radiation dose (low dose) raw projection images is entered, the trained PTNR outputs a pixel value similar to its desired pixel value, in other words, it outputs high-dose-like raw projection images where noise and artifacts due to low radiation dose are substantially reduced, i.e., a higher image quality. Then, from the “high-dose-like” projection views (images), “high-dose-like” 3D tomosynthesis slices are reconstructed by using a tomosynthesis reconstruction algorithm. With the “virtual high-dose” tomosynthesis reconstruction slices, the detectability of lesions and clinically important findings such as masses and microcalcifications can be improved. | en | Converting low-dose to higher dose 3D tomosynthesis images through machine-learning processes | 49986004_US | 50053097_US | A61B 6/025,A61B 6/461,A61B 6/502,A61B 6/5205,A61B 6/5211,A61B 6/542,G06K 9/6262,G06T 5/001,G06T 5/50,G06T 7/0014,G06T 11/005,G06T2207/10116,G06T2207/20081,G06T2207/30068,G16H 50/20 | [
"G06K 9/62",
"G06T 7/00",
"G06K 9/46",
"A61B 6/02",
"G06T 5/00",
"G06T 11/00",
"G06T 5/50",
"A61B 6/00"
] | 107,505 |
568,165,884 | 2020-08-03 | 67,551,104 | N | The invention is a system (1) that simulates a decision process in a mammalian brain with respect to a motion characteristic relating to a visually observed body posture of a body by means of a simulated visual path comprising an interface towards a simulated neuronal structure, the system includes an interface that converts at least luminescence information of the observed body into an optical flow data stream that delivers information relating to the visually observed body and that can be processed in the simulated neuron structure, the system being a feed-forward system that can be coupled to the simulated neuron structure. And from the visual observation that the decision comprises hierarchically: the simulated visual path and its interface (3, 3L, 3R); a simulated local motion direction detection neuron structure (4, 4L, 4R) for detecting the motion direction by means of a receptive field; a simulated opposition motion detection neuron structure (5, 5L, 5R) for detecting opposition motion at least relating to expansion and contraction; a simulated complex pattern detection neuron structure (6, 6L, 6R) for globally detecting an optical flow pattern over the entire visual observation and according to the evolution of the entire visual observation during the time, the detectable pattern being a prototype pattern; and a simulated motion pattern detection neuron structure (7, 7LR) for detecting a motion pattern and providing a decision regarding a motion characteristic. According to the invention, the neurons of the simulated motion pattern detection neuron structure (7, 7LR) comprise a forgetting ability that is a function of the delay and for each neuron an activity of the neuron. | en | System for simulating decision-making process in brain of mammal with respect to visually observed movement of body | 83796445_,84361127_ | 60327924_,74991633_,85443421_,75271411_ | G06K 9/6273,G06N 3/006,G06N 3/088,G06N 7/005,G06V 40/23 | [
"G06V 40/20",
"G06V 10/764",
"G06N 7/00",
"G06N 3/00"
] | 163,914 |
329,939,116 | 2010-06-23 | 43,354,440 | Y | A method for rapid hierarchical image segmentation based on perceptually driven contour completion and scene statistics is disclosed. The method begins with an initial fine-scale segmentation of an image, such as obtained by perceptual completion of partial contours into polygonal regions using region-contour correspondences established by Delaunay triangulation of edge pixels as implemented in VISTA. The resulting polygons are analyzed with respect to their size and color/intensity distributions and the structural properties of their boundaries. Statistical estimates of granularity of size, similarity of color, texture, and saliency of intervening boundaries are computed and formulated into logical (Boolean) predicates. The combined satisfiability of these Boolean predicates by a pair of adjacent polygons at a given segmentation level qualifies them for merging into a larger polygon representing a coarser, larger-scale feature of the pixel image and collectively obtains the next level of polygonal segments in a hierarchy of fine-to-coarse segmentations. The iterative application of this process precipitates textured regions as polygons with highly convolved boundaries and helps distinguish them from objects which typically have more regular boundaries. The method yields a multiscale decomposition of an image into constituent features that enjoy a hierarchical relationship with features at finer and coarser scales. This provides a traversable graph structure from which feature content and context in terms of other features can be derived, aiding in automated image understanding tasks. The method disclosed is highly efficient and can be used to decompose and analyze large images. | en | Image segmentation by hierarchial agglomeration of polygons using ecological statistics | 7894461_US,11613649_US,5212717_US | 11613649_US,7894461_US | G06T 7/11,G06T 7/12,G06T 7/162,G06T 7/181,G06T 7/187,G06T2207/10024,G06T2207/20016 | [
"G06K 9/34"
] | 65,528 |
4,744,139 | 2000-06-09 | 23,287,895 | N | A multitasking optical fiber probe for collecting dosimeter information from more than one position in a sample. The basic principle of the present invention involves using one or more different sensor zones along the length of the fiber each with a different photoactive constituent having a sufficiently unique emission spectra (spectral or temporal) to enable deconvolution of the emission spectra by the computer and therefore correlation of the detected parameter with the position of the sensor zone along the length of the optical fiber. In the broadest form of the invention the probe is embodied by only one sensor zone located at some point along th e length of the fiber spaced away from the end face of the fiber. Probes are provided in which multiple sensor zones are disposed along the length of the fiber and photoactive constituentswith sufficiently unique emission spectra (intensity and/or spectral shape which convey the optical information) are used in the different sensor zones so that the different spectra can be deconvoluted so that the contributions from the various etch zones can be distinguished. More than one different photoactive constituent could be incorporated into a single sensor zone for measuring several factors in the vicinity of the sensor zone. In photodynamic therapyapplications the probe i s isotropic in response and can be employed for all light (300 to 900 nm) base d medical diagnostics and therapeutics. As an extension the probe can include photosensitiser and molecular oxygen concentrations dosimetry to be used for photodynamic therapy (PDT) treatment monitoring, dosimetry and planning utilizing a mathematical model describing tissue response to PDT. | en | FIBER OPTIC MULTITASKING PROBE | 16240601_CA | 12979386_CA,16700748_CA | A61N 5/0601,A61N 5/062,G01N 21/6428,G01N 21/7703,G01N2201/0846,G01N2201/088 | [
"G01N 21/64",
"A61N 5/06"
] | 7,081 |
322,110 | 1988-09-13 | 22,261,589 | Y | SnRNP proteins are isolated, as by immunoaffinity chromatography, using antibodies from a serum sample of a living being affected by systemic lupus erythematosus. The Sm-B and/or Sm-B min polypeptides are in turn isolated from the snRNP protein complex as by gel electrophoresis and electroelution. The amino terminus of the Sm-B and/or Sm-B min polypeptides are then sequenced, and labelled DNA probes with nucleotide sequences complementary to that encoding the amino acid sequence are synthesized. A human cDNA library in a lambda cloning vector is transferred to appropriate filters such as nitrocellulose filters. These filters are screened as by hybidization with the labelled probes to identify the cDNA clones in the library with sequences matching those of the labelled probes. The cDNA encoding the Sm-B and/or Sm-B min proteins are then subcloned. The Sm-B and/or Sm-B min polypeptides are then isolated as by immunoaffinity chromatography and, if further desired, as by HPLC chromatography. An assay is then made with the isolated Sm-B and/or Sm-B min polypeptides by reacting the Sm-B and/or Sm-B min polypeptides with a serum sample of a living being to determine whether the living being is affected by systemic lupus erythematosus. The assay may also be made with a mixture of the isolated Sm-B and/or Sm-B min polypeptides and an isolated Sm-D polypeptide (isolated substantially as described above). The assay may be performed as by an enzyme-linked immunoabsorbant such as anti-human IgG/IgM antibodies covalently attached to an enzyme indicator. Lactoperoxidase/alkaline phosphatase are each an example of an enzyme indicator to indicate, as by a distinctive color, an affected person. | en | THE SM-B/B1 ANTIGENS, THE CLONING OF THE SM-B/B1 ANTIGENS AND THE DETECTION OF SYSTEMIC LUPUS ERYTHEMATOSUS BY USING THE SM-B/B1 ANTIGENS | 557088_US | 557421_US,557423_US,557422_US | G01N 33/564,G01N2800/104 | [
"C12N 15/00",
"G01N 33/541",
"G01N 33/535",
"C12P 21/02",
"C12N 15/09",
"G01N 33/564",
"G01N 33/531"
] | 1,776 |
334,019,019 | 2010-11-02 | 43,971,813 | N | The apparatus, system and method of the invention provides a toot to measure, diagnose and retrain the ability to enjoy sound and particularly musical sound for post-lingually deafened cochlear implant recipients. The invention consists of computer driven audio and visual stimulus presentation apparatus, selected and stored musical scores, subject response apparatus, and means to access the cochlear implant which act in conjunction with fundamental components, namely: (1) Firstly, a Sound Enjoyment Assessment Tool (SEAT), (2) Secondly, a Perceptual Discrimination Assessment Tool (PDAT) consisting of 2 parts, 1. a pitch discrimination assessment (PA) toot, and 2. a timbre discrimination assessment (TA) tool, (3) Thirdly, a Music Perception Ability Tool (MPAT) which functions both as an assessment and as a retraining tool, and (4) Fourthly, a Timbre Perception Ability Retraining Tool (TPART). The initial components SEAT, PDAT, and MPAT are used together principally as a composite Diagnostic Tool. When used 'once through' SEAT produces a set of diagnostic scores of the patient's enjoyment of music, PDAT produces diagnostic scores of pitch and timbre discrimination ability, and MPAT produces a profile of scores related to the person's perceptual abilities related to music patterns and melodies. Repeated uses can be part of a rehabilitation program alone or in conjunction with the remainder of the invention. The later components MPAT and TPART are additionally used as individual and composite Retraining Tools functioning as mastery-based, multi-level training systems premised on subject/system interaction in practice followed by increasing requirements for attention and complexity. | en | APPARATUS, SYSTEM AND METHOD FOR MUSIC ENJOYMENT AND ABILITY TESTING AND REHABILITATION RETRAINING WITH COCHLEAR IMPLANTS | 42497171_CA | 42497171_CA | A61N 1/36039,A61N 1/37247 | [
"A61F 11/04",
"G09B 21/00"
] | 67,605 |
53,989,725 | 1986-07-16 | 27,102,766 | Y | The keys operated by the Middle Fingers in the Second Nearest Row and the Fourth Nearest Row of the Alpha-Numeric Core, i.e. QWERTY D K 3 and 8, and the center key on the Number Pad are provided with hand positioning structures. Hand positioning with the Middle Fingers is based on the anatomical structure and bio-mechanical functioning of the arms, wrists, hands and fingers, and the hand positioning structures function by the neuro-sensory process of 2-point discrimination. With minimal practice, use of the hand positioning structures quickly functions at a subconscious reflex level. The hand positioning structures enable the operator to maintain visual focus and concentration on the text or display screen, and thereby eliminates unnecessary eye movement and text-reading errors due to eye movement. The structures and methods enable eliminating Home Row, and thereby eliminates awkward movements and contortions and eliminates the errors resulting from awkward movements and contortions. The structures and methods enable doing numbers with the hands positioned on the Number Row, rather than from Home Row, which also eliminates awkward movements and contortions, and improves speed, accuracy and efficiency in doing numbers. The hand positioning structures provide bio-mechanical balance and symmetry for the fingers and hands; improves keyboard operation by increasing operating speed, accuracy, efficiency, mobility, flexibility, fluidity of movement, and productivity; reduces operator mental, emotional, visual, and neuro-muscular stress and fatigue; and facilitates learning how to operate a keyboard. The cost of the structure is nominal; no employee retraining expense is required. | en | Bio-mechanical neuro-sensory keyboard structure and operating methods | 9698625_US,10365359_US | 10365360_US,9698628_US | B41J 5/12,H01H2009/189,H01H2217/044 | [
"B41J 5/12"
] | 47,754 |
417,821,259 | 2013-09-26 | 50,651,781 | Y | The present invention relates to an adaptive deep brain simulation system that analyzes a neural firing signal so as to set a stimulation parameter applicable thereto and to continuously stimulate the deep brain. The system uses an adaptive feedback algorithm comprising: (a) a neural firing signal detecting step of renewing two buffers that stores currently measured data and existing measured data for neural firing signals, respectively and detecting neural firing signals from the current data and existing data; a neural firing rate calculating step of calculating an existing neural firing rate and a current neural firing rate by using the detected neural firing signals; and (c) a stimulation parameter adjusting step of analyzing the changes in the neural firing rate periodically and adjusting a stimulation parameter thereby. The adaptive deep brain simulation system of the present invention can actively control a stimulation parameter for a symptom of a patient and can remarkably alleviate the symptom of the patient better than existing methods. [Reference numerals] (AA) Adaptive feedback deep brain stimulation algorithm; (BB) Start; (CC) Initiate a short-term stimulation parameter and calculate an initial firing rate; (DD) Generate stimulation waves for a set parameter; (EE) Set a stimulation time (T) randomly (several minutes to several hours); (FF) Stimulate for T hours; (GG) Calculate a firing rate for a period of time; (HH) Change the short-term stimulation parameter by the changes in the firing rate; (II) Calculate an average firing rate for N times; (JJ) Change the stimulation parameter initial value by the changes in the average firing rate; (KK) Repeat N times | en | Adaptive Deep Brain Stimulation System Actively Controlling The Stimulation Pattern for Deep Brain Stimulation | 12472871_KR | 12639826_KR,12636648_KR,12637923_KR,33074277_KR,33256260_KR | A61B 5/7225,A61N 1/0534,A61N 1/3606,A61N 1/36067,A61N 1/36082,A61N 1/36103,A61N 1/36128,A61N 1/36135 | [
"A61B 5/0476",
"A61N 1/05",
"A61N 1/36"
] | 86,359 |
513,953,572 | 2018-11-01 | 66,664,566 | N | The present invention relates to a cranial nerve control device using both of monitoring according to a real-time brain activity change and combined central and peripheral nerve stimulation, comprising: goggles wrapped on a patient's head so as to measure the patient's brain activity; a module guide bound to each of a plurality of perforation portions perforated in the goggles at the same intervals; a 32channelfNIRS+32channeltCS controller connected to each module of the module guide so as to control the same; a 2channelFES controller connected to two peripheral nerve stimulators attached to a patient's wrist so as to control the same; and a simulation device simultaneously connected to the 32channelfNIRS+32channeltCS controller and the 2channelFES controller, and receiving a brain activity measurement signal by means of functional near-infrared spectroscopy (fNIRS), a transcranial alternate current stimulation (tCS) control signal, and a functional electrical stimulation (FES) control signal and monitoring the same. The present invention automatically recognizes the functional activation of a user's brain by detecting, in real time, brain cognitive information, which is structurally and functionally complicated, and, as an artificial intelligence-based brain signal and brain electrostimulation feedback application technology, performs monitoring according to a real-time brain activity change so as to automatically control electrostimulation by identifying a brain activity state of a human being without targeting an affected area of a person's brain, thereby providing convenience for a comfortable life of a human, and simultaneously, remarkably treating brain diseases. | en | CRANIAL NERVE CONTROL DEVICE USING BOTH OF MONITORING ACCORDING TO REAL-TIME BRAIN ACTIVITY CHANGE AND COMBINED CENTRAL AND PERIPHERAL NERVE STIMULATION | 72019657_KR | 69679657_KR,69682493_KR,67577775_KR,68127012_KR | A61B 5/00,A61B 5/0075,A61B 5/24,A61B 5/316,A61B 5/369,A61N 1/0456,A61N 1/0484,A61N 1/0492,A61N 1/20,A61N 1/36003,A61N 1/36025,A61N 1/36031 | [
"A61B 5/04",
"A61B 5/00",
"A61B 5/0476"
] | 128,522 |
17,371,690 | 1998-12-31 | 20,206,976 | N | The group of the inventions relates to the field of computer science and can be used for neural network emulation and digital signal processing. Increasing of the neural processor performance is achieved by means of the ability to change word lengths of results in program mode. The neural processor comprises six registers, a shift register, a AND gate, two FIFOs, a switch, a multiplexer, two saturation units, a calculation unit and a adder circuit to execute operations over vectors of programmable word length data. Increasing of the saturation unit performance is achieved by means of the ability to process vector of input operands with programmable word length at a time. Said unit comprises a carry look-ahead circuit and a carry propagation circuit, and also by two multiplexers, one EXCLUSIVE OR gate, one EQUIVALENCE gate, one NAND gate and one AND gate with inverted input in each bit. Functionality of the calculation unit is expanded. The calculation unit comprises a delay element N/2 AND gates with inverted input N/2 decoders of multiplier bits, a N-bit shift register, which each bit consists of a AND gate with inverted inputs, a multiplexer and a trigger, and a multiplier array, comprising N columns by N/2 cells, each of them consists of two triggers, a AND gate with inverted input, an one-bit partial product generation circuit, an one-bit adder and a multiplexer. Increasing of the adder circuit performance is achieved by means of ability to sum two vectors of input operands of programmable word lengths. The adder circuit comprises a carry look-ahead circuit, and also by two AND gates with inverted input, one half-adder and one EXCLUSIVE OR gate in each bit. <IMAGE> | en | NEUROPROCESSOR, DEVICE FOR CALCULATING SATURATION FUNCTIONS, CALCULATION DEVICE AND ADDER | 47130334_RU | 3925422_RU,3925423_RU,3925424_RU,3925421_RU,3925420_RU | G06F 7/544,G06N 3/0481,G06N 3/063 | [
"G06N 3/063",
"G06F 7/57",
"G06N 3/04",
"G06F 15/18",
"G06N 3/06"
] | 20,477 |
490,468,760 | 2017-07-27 | 61,203,740 | Y | Disclosed are an unstructured data analyzing technology device, a method thereof, and a recording medium recorded with an application/program for implementing the same. The unstructured data analyzing technology device comprises: a database which stores a plurality of data matching paintings painted by infants or children over 36 months old (3 years old) with analysis texts; an analysis text output unit which analyzes paintings of the database to extract a random image depending on each theme, inputs a painting according to a theme set randomly, compares the input painting with the random image to classify the same into a normal group, an interest group and a risk group and outputs analysis texts corresponding to the classified group; an input unit which receives a painting painted by a painting tool for a theme; a format analysis unit which verifies a size or a location of the input painting by means of a coordinate value; a color analysis unit which analyzes colors used in the input painting; an analyzed content output unit which outputs an analyzed content based on the analysis result of the format analysis unit and the color analysis unit; and a reliability check unit which analyzes a correlation between the output analysis text and the output analyzed content and calculates a reliability. Accordingly, the present invention uses data matching paintings painted by infants or children over 36 months old (3 years old) with analysis texts to analyze the generated analysis data and the input painting, calculates a reliability between analyzed contents, and feedbacks the correlation between the analysis data and the analyzed contents to increase an analysis reliability. | en | / Apparatus and method for analyzing irregular data a recording medium on which a program / application for implementing the same | 68133420_KR | 69682990_KR | A61B 5/165 | [
"G06F 40/40",
"G06F 17/28",
"A61B 5/16"
] | 115,654 |
534,178,387 | 2019-12-09 | 71,406,622 | N | The present invention relates to a method for improving reliability of artificial intelligence-based object recognition using collective intelligence-based mutual verification, in which: in a server interworking with an artificial intelligence module, one or more object regions included in learning data including a structured image or an unstructured image of a recognition target object to be recognized through the artificial intelligence module are recognized; object region recognition data which sets the recognized object regions is extracted and is provided to one or more user terminals in a designated order; a procedure for receiving, from the user terminals, object region selection data which selects at least one effective object region corresponding to the recognition target object among one or more object regions included in the object region recognition data is performed for a predetermined period of time; and the object region selection data for each user received from the user terminals is mutually compared and analyzed by the same object region selection data, a collective intelligence-based mutual-verification procedure is performed, wherein the verification procedure is for selecting the object region selection data in which users of a designated ratio or more, among users who select the effective object region for each of the object region selection data, select the same effective object region, learning data to be injected into the artificial intelligence module and to be learned in order to improve reliability of the artificial intelligence module is determined, and the learning data is injected into the artificial intelligence module and is learned. | en | METHOD FOR IMPROVING RELIABILITY OF ARTIFICIAL INTELLIGENCE-BASED OBJECT RECOGNITION USING COLLECTIVE INTELLIGENCE-BASED MUTUAL VERIFICATION | 71220128_KR | 76429303_KR,69160223_KR,76451381_KR | G06N 20/00,G06V 10/255,G06V 10/778,G06V 10/7792,G06V 10/95,G06V 40/178,G06V2201/10 | [
"G06N 20/00"
] | 142,255 |
4,458,261 | 1994-02-01 | 21,799,897 | N | DIRECTIONAL LIGHT FILTER AND HOLOGRAPHIC PROJECTOR SYSTEM FOR ITS PRODUCTION A photosensitive optical body is exposed by a diverging three-dimensional standing wave interference pattern generated by a holographic projector system. The projector system, using binary optics, creates a diverging lattice of hexagonal or square rod-like intensity maxima extending through the optical body. After the standing wave image is recorded and fixed, the optical body will contain a honeycomb-like grid or pattern that will cause either an absorption or a refractive index modulation effect on light that differs in incidence to the direction of normal propagation through the created channels to a focus or convergence point. This produces either a volume-absorption hologram or a volume-phase hologram (transmittance function modulated by the permittivity ¢index of refraction!) with such properties as depth of focus, high resolution, and a one-way (directional perspective) and anti-glare effect with reduced diffraction. Unique photosensitive aromatic diazo compounds which possess high thermal stability and soluble in non-polar solvents are provided. In the volume-absorption hologram, the compounds react with couplers within the optical body during development to form azo dye in the areas corresponding to destructive interference during exposure. While chiefly intended for use in eyeglass lenses, the optical body may also find use in telescopes, detectors, film and video cameras, and various other optical devices. The holographic projector system also affords a production method of writing highly-corrected peripheral as well as center-field mesh patterns on planar or non-planar surfaces. | en | DIRECTIONAL LIGHT FILTER AND HOLOGRAPHIC PROJECTOR SYSTEM FOR ITS PRODUCTION | 16444202_US | 16444202_US | G02B 5/1885,G02B 5/32,G03H 1/02,G03H 1/0248,G03H2001/026,G03H2001/0264,G03H2240/21,G03H2240/24 | [
"G02B 5/32",
"G02C 7/02",
"G03H 1/04",
"G03H 1/02"
] | 4,615 |
4,541,532 | 1996-11-21 | 26,678,251 | Y | A polarization diversity receiver system for yielding multiple heterodyne optical output signals from an incident optical beam having a p-polarized component and an s-polarized component comprises first and second sequentially-arrayed polarizing beamsplitters, and three photodetectors, eac h of which receives a heterodyne optical signal. The polarization diversity receiver system tracks the largest of these three signals, and uses only thi s largest one for subsequent signal processing. There is a minimum for this largest signal that is dependent on the input polarizations of the two optic al fields whose beat note is the heterodyne signal. Thus, the object is to maximize the minimum of this largest of the three heterodyne signals. The first polarizing beamsplitter ideally splits the incident beam into a transm itted beam portion including approximately 100% of the p-polarized component and approximately 33% of the s-polarized component, and a reflected beam portion including approximately 0% of the p-polarized component and approximately 67% of the s-polarized component. The reflected beam portion exits from the first polarizing beamsplitter as a first heterodyne optical o utput signal, and impinges on a first photodetector. The transmitted beam portion exits from the first beamsplitter, and then undergoes an effective 45O rotat ion of its polarization eigenstates around its axis of propagation, either prior to or during its passage through the second polarizing beamsplitter. The second beamsplitter splits the rotated transmitted beam portion into second and thi rd heterodyne optical output signals, which respectively impinge upon second an d third photodetectors. | en | HIGH EFFICIENCY POLARIZATION DIVERSITY RECEIVER SYSTEM | 5445442_US | 10209190_US | G01J2009/0261,H04B 10/61,H04B 10/614,H04B 10/64 | [
"H04B 10/04",
"G01J 9/02",
"G02B 6/00",
"H04B 10/06",
"H04B 10/152",
"H04B 10/142",
"H04B 10/148",
"H04B 10/158"
] | 5,111 |
46,337,101 | 1979-06-04 | 26,718,072 | Y | A physiologic facsimile image of a biological target without multipath contamination is obtained by first producing, for each one of a plurality of sample locations which are spaced so as to define a two-dimensional array, a time delay spectrum wherein the frequency of each spectral ordinate represents the instantaneous differential propagation delay between a first microwave signal which has been propagated through the target and a second microwave signal which initially corresponds to the first microwave signal, and which has been propagated through means having a predetermined propagation delay, and measuring the amplitude of the spectral ordinate corresponding to the direct ray path of propagation through the target, so as to obtain a set of data. The set of data is then digitized and converted from time domain to frequency domain. The transformed data is then processed by sorting the data into column order; magnifying data derived from the sorting step so as to enhance and preserve the resolution of the image; mapping data derived from the magnifying step into further data using a predetermined mapping function so as to enhance the contrast between selected portions of the image; and obtaining a set of control signals which are used to actuate a display device to generate the facsimile image by filtering data derived from the mapping step using a band pass function which rejects spatial frequencies below a predetermined first frequency and/or rejects spatial frequencies above a predetermined second frequency so as to minimize, respectively, the effects of variations in the thickness of the target and/or spurious frequencies resulting from the magnifying step. | en | Method and apparatus for physiologic facsimile imaging of biologic targets without multipath contamination using remote microwave interrogation | 5230056_US | 5628656_US,5650807_US | A61B 5/05,A61B 5/0507,A61B 5/7232,A61B 5/7257,G01N 24/008,G01R 27/04 | [
"G01N 24/00",
"A61B 5/05",
"G06T 11/00",
"G06F 19/00",
"G01R 27/04"
] | 32,443 |
489,645,626 | 2016-03-24 | 55,795,009 | N | The invention relates to a device for driving the lower limbs of a person, comprising; a base frame (4); a table (2) supporting the person (1); at least one motorised mechanical orthosis arranged to constitute an interface with at least one of the lower limbs of said person (1) so that the movements of said lower limb and said orthosis are connected and identical, said orthosis being attached to one end of said table (2); and a device for functional electrical stimulation and for measuring an electromyogram (24, 25) comprising at least one pair of stimulation and measurement electrodes (28, 29) intended for acting on a muscle or muscle group of said lower limb, and for stimulating said muscle or muscle group, as well as for measuring the reaction of said muscle or muscle group, characterised in that the device also comprises a raising mechanism (3) which makes it possible to vary the vertical position of the table (2) relative to the base frame (4) between a low position, in which thetransfer and the installation of the person (1) are made easier, intermediate working positions, and a raised position making it possible to drive the person (1) in standing position, and a mechanismfor tilting said table (2) which makes it possible to vary the inclination of said table (2) relative to the base frame (4), in particular between a horizontal position, in which the person (1) is positioned in dorsal decubitus, and a vertical position, in which the person (1) is in standing position, the combination of the mechanisms for raising and tilting the table (2) allowing the mobility ofsaid orthosis across the entire respective physiological ranges of movement of said lower limb. | en | DEVICE FOR DRIVING LOWER LIMBS OF PERSON IN DORSAL OR PARTIAL DECUBITUS COMBINED WITH DRIVING WALKING IN VERTICAL POSITION | 59730540_ | 58801303_ | A61B 5/389,A61H 1/005,A61H 1/0237,A61H 1/0255,A61H 1/0262,A61H 1/0266,A61H2201/10,A61H2201/1238,A61H2201/1642,A61H2201/1652,A61H2201/5007,A61H2201/5061,A61H2201/5064,A61H2203/0456,A61H2203/0487,A61H2230/08,A61H2230/085,A61H2230/60,A61H2230/605,A61N 1/0452,A61N 1/0484,A61N 1/36003 | [
"A61N 1/04",
"A61H 1/02",
"A61N 1/36"
] | 115,325 |
478,827,865 | 2016-06-17 | 58,704,844 | Y | The present invention relates to a system, method, and program for analyzing a blood flow state using a deep neural network. According to an embodiment of the present invention, the method for analyzing a blood flow state using a deep neural network includes: a step (S100) in which an analysis server including one or more computers receives input blood flow sound wave signals from sound measurement devices attached or worn on one or more specific body parts of a user; a learning signal data generation step (S200) in which the analysis server accumulates the input blood flow sound wave signals to generate learning signal data; a blood flow state information obtaining step (S300) in which the blood flow state information is obtained by one or more computers through the analysis of the learning signal data using the deep neural network whereas the blood flow state information includes normal blood flow information and abnormal feature information; a step (S400) of using the deep neural network to analyze the learning signal data and searching and matching the abnormal situation data with the fitting abnormal feature information; a step (S500) of searching for the abnormal feature information in the input blood flow sound wave signals of the specific user obtained on a real-time basis; and a step (S600) of predicting the occurrence of a specific abnormal situation based on the matching relationship between the abnormal feature information and the abnormal situation. The present invention can diagnose the blood pressure state by using the blood flow sound wave signals to predict the occurrence of an abnormal symptom on blood vessels in a specific body part of the user. | en | SYSTEM METHOD AND PROGRAM FOR ANALYZING BLOOD FLOW BY DEEP NEURAL NETWORK | 68608923_KR | 69130781_KR,64476034_KR,64201581_KR,69685814_KR | A61B 5/026,A61B 8/06,G06N 3/02 | [
"A61B 8/06",
"G06N 3/02",
"A61B 5/026"
] | 108,938 |
340,156,358 | 2010-10-09 | 45,329,257 | N | This invention discloses methods and apparatuses for 3D imaging in Magnetoencephalography (MEG), Magnetocardiography (MCG), and electrical activity in any biological tissue such as neural/muscle tissue. This invention is based on Field Paradigm founded on the principle that the field intensity distribution in a 3D volume space uniquely determines the 3D density distribution of the field emission source and vice versa. Electrical neural/muscle activity in any biological tissue results in an electrical current pattern that produces a magnetic field. This magnetic field is measured in a 3D volume space that extends in all directions including substantially along the radial direction from the center of the object being imaged. Further, magnetic field intensity is measured at each point along three mutually perpendicular directions. This measured data captures all the available information and facilitates a computationally efficient closed-form solution to the 3D image reconstruction problem without the use of heuristic assumptions. This is unlike prior art where measurements are made only on a surface at a nearly constant radial distance from the center of the target object, and along a single direction. Therefore necessary, useful, and available data is ignored and not measured in prior art. Consequently, prior art does not provide a closed-form solution to the 3D image reconstruction problem and it uses heuristic assumptions. The methods and apparatuses of the present invention reconstruct a 3D image of the neural/muscle electrical current pattern in MEG, MCG, and related areas, by processing image data in either the original spatial domain or the Fourier domain. | en | Methods and apparatuses for 3D imaging in magnetoencephalography and magnetocardiography | 7041968_US | 7041968_US | A61B 5/05,A61B 5/243,A61B 5/245,A61B 5/7257 | [
"A61B 5/055"
] | 71,290 |
17,275,008 | 1997-06-19 | 21,797,312 | Y | A self-adjusting implantable cochlear implant system (46) includes an implant portion (50) and an external portion (53). The system provides a device and a way to objectively determine selected psychophysical parameters, such as stimulation threshold, comfort level and loudness resolution, used by the implant portion, which includes an implantable cochlear stimulator (ICS), as it carries out its stimulation function. The input to the system is an electrical stimulation. The outputs of the system include a middle ear reflex (MER) and evoked potentials, such as a compound action potential (CAP) along the auditory/cerebral pathways, both of which are sensed using objective measurement techniques and tools. In accordance with one embodiment, the adjustment process uses the MER for determining a coarse threshold value, and then (using such coarse threshold value as a starting point) uses evoked potentials to determine a more precise or fine threshold value, thereby zeroing in on a desired threshold. Such zeroing-in method is preferably carried out using implanted circuitry (e.g., included as part of the ICS), which implanted circuitry uses an implanted middle ear electrode (54) and a cochlear electrode (56), along with appropriate amplification (58, 64), filtering (60, 66) and processing circuitry (62, 68, 67), to respectively determine the MER response and evoked potentials. Another embodiment uses the presence or absence of the MER to adjust the intensity of electrical stimulation continuously and automatically, thereby relieving the patient from having to perform slow and tedious manual adjustments of the loudness control of a speech processor used with the ICS. | en | SELF-ADJUSTING COCHLEAR IMPLANT SYSTEM | 328849_US | 3756791_CA,1119217_US | A61N 1/36039 | [
"A61N 1/36",
"A61F 11/04"
] | 19,752 |
545,751,988 | 2020-12-01 | 74,334,914 | Y | Abstract The present invention discloses a method for recognizing human knee motion postures based on an extreme learning machine (ELM). The method comprises: collecting output data of a human body under different postures with inertial sensors; segmenting sample data based on a sliding window mechanism and performing feature extraction on the output data in each sliding window; performing dimension reduction and normalization on the output data by using a principal component analysis method to obtain the sample data; constructing an ELM network model and training the ELM network model by utilizing the sample data to obtain a final recognition model; and performing online recognition on real-time measurement data collected by the inertial sensors by utilizing the final recognition model to obtain recognition results. The present invention can accurately and rapidly recognize human motion postures by utilizing the generalization performance and the characteristic of fast learning of the ELM. Drawings of Description Collect output data of a human body under different postures with S1 inertial sensors Segment sample data based on a sliding window mechanism and S2 perform feature extraction on the output data in each sliding window Perform dimension reduction and normalization on output data by using S3 a principal component analysis method to obtain the sample data Construct an ELM network model and train the ELM network model by S4 utilizing the sample data to obtain a final recognition model Perform online recognition on real-time measurement data collected by S5 the inertial sensors by utilizing the final recognition model to obtain recognition results Fig. 1 | en | METHOD FOR RECOGNIZING HUMAN KNEE MOTION POSTURES BASED ON EXTREME LEARNING MACHINE | 84740076_CN | 13117858_,16951081_ | A61B 5/1118,G06N 3/08 | [
"A61B 5/11",
"G06N 20/00"
] | 149,938 |
53,838,571 | 2004-05-28 | 34,840,995 | Y | An optical communications subsystem is proposed to permit the multiplexing of multiple, parallel electronic data streams onto a serial, very high speed optical data channel. The subsystem may also be used to generate programmable ultrafast optical data words for the testing of optical components, and system performance testing of very high speed data transmission systems. The key device component, based on a modified arrayed waveguide grating structure, is directly integratable with a high-speed optoelectronic modulator array in a simple, cost effect, and manufacturable configuration. Pulse spacings as small as 1 picosecond have been demonstrated corresponding to an effective data rate of up to one terahertz. An integrated optical pulse generator is configured to receive a laser light input and output an optical pulse train. Direct space-to-time pulse shaping and optical pulse train generation is achieved by use of an arrayed waveguide (AWG) that is double-passed. A mask is utilized for time domain pulse shaping that is employed after a single pass through the arrayed waveguide. In the case of an optical data/word generator, a spatially patterned mask translates spatial data, for example representing binary data or a binary word, of the mask to the output optical pulse train. The arrayed waveguide (AWG) system has waveguide ports that double as inputs and outputs, and provides direct space-to-time pulse shaping of a single, short pulse laser/optic signal. Direct optical access to individual guides in the waveguide array allows one to control the light intensity in each guide and therefore control the output pulse intensities with a one-guide one-pulse effect. | en | Direct space-to-time pulse shaper and optical word generator | 5210860_US | 6734366_US,5801368_US | G02B 6/12014,G02B 6/12019,H04J 14/02,H04J 14/0223,H04J 14/08 | [
"H04J 14/02",
"H04J 14/00",
"G02B 6/34",
"H04J 14/08"
] | 47,290 |
50,556,043 | 1995-02-28 | 27,462,803 | Y | An interactive control unit for determining inquiries to each of participants by images on the basis of inputted personal information of each of the participants, determining a next inquiry to each of the participants on the basis of a response of each of the participants inputted from an input unit and repeating inquiry/response relating to the attraction by an interactive method is provided for a host computer. A sensor for detecting whether or not a portable device placed in a receiving portion is touched is provided for the input unit so that input of a response from each participant is performed by touching/releasing the hand from the portable device. Further, portable devices each including ID each of which is carried by the participant of the attraction and terminal units each having an ID reading function for reading the ID of the portable devices each including ID placed in receiving portions are provided, wherein control systems of the attraction system discriminate the participants on the basis of the ID read by the terminal units and discriminate the positions of the participants on the basis of the ID and identifier of the terminal unit. Still further, personal information of each participant inputted from an input terminal unit is totaled, and a specific person is selected from the participants that meets predetermined conditions of the theme of the attraction on the basis of the totaled information. An illumination command is transmitted to the terminal unit of the selected specific person to irradiate the portable device with light by a light emitting unit of the terminal unit so as to cause the inner surface of the portable device emit light. | en | Group fortune telling attraction system | 5270741_JP | 7929948_JP | A63F 9/181,A63F 9/183,A63F2009/2476 | [
"A63F 9/18"
] | 40,208 |
575,543,077 | 2021-01-13 | 75,289,951 | N | A bearing fault diagnosis method for a dynamic joint distribution alignment network under variable working conditions, comprising the following steps: collecting bearing vibration data under different working conditions to obtain a source domain sample and a target domain sample (S1); constructing a deep convolutional neural network model for dynamic joint distribution alignment (S2); simultaneously feeding the source domain sample and the target domain sample into a parameter-initialized deep convolutional neural network model, so that a feature extractor extracts high-level features of the source domain sample and the target domain sample, and calculates a marginal distribution distance and a conditional distribution distance (S3); obtaining a joint distribution distance according to the marginal distribution distance and the conditional distribution distance, and combining the joint distribution distance with label loss to obtain an objective function (S4); optimizing the objective function by using a stochastic gradient descent method, and training the deep convolutional neural network model to obtain an optimized deep convolutional neural network model (S5); and inputting the target domain sample into the optimized deep convolutional neural network model to obtain a predicted label of a target domain, and comparing the predicted label of the target domain with a true label of the target domain to obtain diagnosis accuracy (S6). The method can reduce the influence of domain drift, so that a deep learning model can well complete a fault diagnosis task under variable working conditions; moreover, the speed is high, and the calculation amount is small. | en | BEARING FAULT DIAGNOSIS METHOD FOR DYNAMIC JOINT DISTRIBUTION ALIGNMENT NETWORK UNDER VARIABLE WORKING CONDITIONS | 67325554_CN | 68575413_CN,63806466_CN,81494142_CN,68576617_CN,85616962_CN,63528328_CN,81403209_CN,80662278_CN,84794763_CN,80746684_CN,69634021_CN,74125082_CN,84589185_CN,76449828_CN | G01M 13/045,G06N 3/04,G06N 3/08 | [
"G01M 13/04",
"G06K 9/62"
] | 167,390 |
49,689,077 | 2006-01-17 | 36,780,982 | Y | The invention is directed to a natural language generation (NLG) software system that generates rich, content-sensitive human language descriptions based on unparsed raw domain-specific data. In one embodiment, the NLG software system may include a data parser/normalizer, a comparator, a language engine, and a document generator. The data parser/normalizer may be configured to retrieve specification information for items to be described by the NLG software system, to extract pertinent information from the raw specification information, and to convert and normalize the extracted information so that the items may be compared specification by specification. The comparator may be configured to use the normalized data from the data parser/normalizer to compare the specifications of the items using comparison functions and interpretation rules to determine outcomes of the comparisons. The language engine may be configured to cycle through all or a subset of the normalized specification information, to retrieve all sentence templates associated with each of the item specifications, to call the comparator to compute or retrieve the results of the comparisons between the item specifications, and to recursively generate every possible syntactically legal sentence associated with the specifications based on the retrieved sentence templates. The document generator may be configured to select one or more discourse models having instructions regarding the selection, organization and modification of the generated sentences, and to apply the instructions of the discourse model to the generated sentences to generate a natural language description of the selected items. | en | Methods and systems for generating natural language descriptions from data | 7607620_US,7607619_US | 7607620_US | G06F 40/56,G06Q 10/087 | [
"G06F 17/28",
"G06F 17/27",
"G06Q 10/00",
"G06F 17/30"
] | 39,206 |
538,471,300 | 2020-09-29 | 68,136,153 | N | The present invention relates to the field of disease tracking and potentially even diagnostics. Specifically, it relates to a method for predicting the total motor score (EDSS) in a subject suffering from multiple sclerosis (MS) comprising the steps of determining at least one performance parameter from a dataset of measurements of active and passive gait and posture capabilities and cognitive capabilities from said subject, comparing the determined at least one performance parameter to a reference obtained from a computer-implemented regression model generated on training data, in an embodiment using random forest (RF) analysis, with the at least one performance parameters, and predicting the EDSS of the subject based on said comparison. The present invention also relates to a mobile device comprising a processor, at least one sensor and a database as well as software which is tangibly embedded to said device and, when running on said device, carries out the method of the invention as well as a system comprising a mobile device comprising at least one sensor and a remote device comprising a processor and a database as well as software which is tangibly embedded to said device and, when running on said device, carries out the method of the invention, wherein said mobile device and said remote device are operatively linked to each other. Furthermore, the invention contemplates the use of the aforementioned mobile device or system for predicting the EDSS in a subject suffering from MS using at least one performance parameter from a dataset of measurements of active and passive gait and posture capabilities and cognitive capabilities from said subject. | en | MEANS AND METHODS FOR ASSESSING MULTIPLE SCLEROSIS (MS) | 5316242_US,7641906_CH | 57612364_CH,74094649_CH,80666216_CH,80644216_CH | G16H 50/20,G16H 50/30 | [
"G16H 50/30",
"G16H 50/20"
] | 145,152 |
15,828,696 | 2001-09-10 | 24,673,503 | N | A color reversal photographic element is disclosed comprising a support having coated thereon a silver halide emulsion layer comprising a silver halide emulsion chemically sensitized in the presence of an organomercapto Au(I) complex having the formula ÄL-Au-LÜ M wherein M is a cationic counter ion and each L is an organomercapto ligand which has antifogging, stabilizing or sensitizing properties, and a rapid sulfiding agent represented by structure SS-1 <CHEM> wherein each of the R1, R2, R3, and R4 groups independently represents an alkylene, cycloalkylene, carbocyclic arylene, heterocyclic arylene, alkarylene or aralkylene group; or taken together with the nitrogen atom to which they are attached, R1 and R2 or R3 and R4 can complete a 5- to 7-membered heterocyclic ring; and each of the B1, B2, B3, and B4 groups independently is hydrogen or represents a carboxylic, sulfinic, sulfonic, hydroxamic, mercapto, sulfonamido or primary or secondary amino nucleophilic group, with the proviso that at least one of the B1R1 to B4R4 groups contains the nucleophilic group bonded to a urea nitrogen atom through a 1- or 2-membered chain. The use of the combination of the two classes of sensitizers of the present invention makes it possible to sensitize the silver halide emulsions employed in color reversal elements at a wider range of temperature. This robustness to temperature translates to less variable performance of the silver halide emulsion. Additionally, the use of individual gold and sulfur sensitizers advantageously makes it possible to sensitize silver halide reversal photographic elements such that the sulfur to gold ratio can be varied independently. | en | Color reversal photographic element | 3785_US | 1048836_US,1048835_US,830829_US | G03C 1/09,G03C 7/3022 | [
"G03C 1/09",
"G03C 7/00",
"G03C 7/30",
"G03C 1/06"
] | 13,236 |
328,540,298 | 2008-12-26 | 40,824,543 | Y | The invention relates to the field of identifying the results of medical measurements. The use thereof ensures the technical result in the form of a possibility for estimating confidently and prognosticating reliably the emotional-behavioral states and psychophysiological functioning of a human by means of data obtained as a result of studying the cardiac rhythm thereof. This result is achieved owing to the method including step of: a) performing an intraday monitoring of the patient's ECG; b) storing the data of this monitoring in the computer memory; c) carrying out a computer processing of the data stored in the step b) for constructing, in accordance with those data, an intervalogram of the patient's cardiac rhythm variability per 24-hour period; d) determining, in accordance with the intervalogram constructed in the step c), those spans corresponding to the nighttime and having at least the predetermined length, where the cardiac rhythm variability is reduced in comparison with the average daily characteristics at the intervalogram spans having the same length and corresponding to the daytime, herewith said reduction of the cardiac rhythm variability shows that the given patient has a night hypersympathicotonia syndrome; e) comparing the differences determined in the step d) with the values from the preformed correspondence set stored in the computer memory, thus defining a degree of manifestation of the predefined indices of the night hypersympathicotonia syndrome; and f) performing, on the basis of the comparison made in the step e), predictive estimations of the human day emotional-behavioral states and psychophysiological functioning. | en | Method for evaluating and prognosticating the daily emotive behavior states and psychophysiological activity of a person according to the measures of night hypersympathicotonia syndrome | 11565111_RU | 11565111_RU | A61B 5/16,A61B 5/165,A61B 5/349,A61B 5/7275,G16H 20/30,G16H 20/70 | [
"G06Q 10/00",
"G06Q 50/00"
] | 64,715 |
537,219,289 | 2020-02-28 | 72,236,810 | N | Exemplary embodiments of the present disclosure are directed towards a system for performing semantical analysis, generating contextually relevant, and topic based conversational storytelling through natural language processing techniques, comprising: a hybrid conversational storytelling system comprising an instigate artificial intelligence conversation management module, a topic managing module, a context managing module, an internal conversation engine, and external conversation engines, the instigate artificial intelligence conversation management module is configured to execute scripts, orchestrates media sequences within a conversation and analyse an input content received from a computing device, the instigate artificial intelligence conversation management module comprising a pre-processing module configured to interpret the input content and check whitelists to generate a conversational storytelling script from an internal conversation engine and the external conversation engines on the computing device, the instigate artificial intelligence conversation management module is configured to transmit the conversational storytelling script generated from the of the internal conversation engine and the external conversation engines to a post-processing module, the post-processing module is configured to aggregate the conversational storytelling script with a generative storytelling engine and a media content to generate a media-based conversational storytelling script on the computing device, the conversational storytelling script is generated from one of the internal conversation engine and the plurality of external conversation engines. | en | SYSTEM AND METHODS FOR PERFORMING SEMANTICAL ANALYSIS, GENERATING CONTEXTUALLY RELEVANT, AND TOPIC BASED CONVERSATIONAL STORYTELLING | 74683834_CA,74794950_US,74816596_IN | 74683834_CA,74816596_IN,74794950_US | G06F 40/30,G06F 40/56,G06N 5/02,G10L 15/1815,G10L 15/1822,G10L 15/183,G10L 15/22,G10L 15/30 | [
"G10L 15/18",
"G10L 15/30",
"G06N 5/02",
"G10L 15/22"
] | 144,254 |
338,445,863 | 2010-01-26 | 42,759,117 | Y | The invention provides an antiglare coating layer composition capable of overcoming the problem of conventional techniques and providing further functionality in the antiglare thin film. More specifically, the invention provides an antiglare coating layer composition for simply producing the antiglare thin film. The antiglare thin film can be applied to a display device such as a liquid crystal television. Under light beam, it does not only improve phenomenon such as mapping and bleaching, but also provides excellent contrast performance, especially for black thick (as transparent black with powerful luster), and it has excellent anti-fingerprint property. The composition of the invention is for forming the antiglare layer on the transparent substrate and comprises a first component and a second component. The first component is acrylic copolymer containing unsaturated double bonds. The second component contains polyfunctional unsaturated double bonds, containing monomers having unsaturated double bonds of two-functional groups or more. The composition further comprises a carbamate (methyl) acrylate ester (A) containing polyether skeleton as a third component; and/or a (methyl) acrylate ester (B) having cyclic structure and containing at least one reactive unsaturated double bond, in which the refractive index is above 1.52, as a fourth component. Further, after coating the composition on the transparent substrate, the first component separates from the second component based upon the physical property difference between the first component and the second component so as to form the antiglare layer having random irregularities on the surface. | en | Antiglare coating layer composition, antiglare thin film and production method thereof | 10681025_JP | 9636549_JP,32439492_JP | B05D 3/061,C08J2475/14,C09D 4/06,C09D 5/006,C09D 7/00,C09D 133/14,C09D 175/14,G02B 1/111,G02B 5/30,G02F 1/13 | [
"C09D 175/08",
"G02B 5/02",
"C09D 4/00",
"G02F 1/1335"
] | 70,386 |
45,707,455 | 2003-07-14 | 30,115,877 | N | The retinal degeneration (rdl) mutant mouse exhibits rapid rod photoreceptor degeneration caused by a mutation in the rod photoreceptor-specific gene cGMP phosphodiesterase beta (PDE). One intriguing aspect of the rdl phenotype is a secondary wave of cone photoreceptor death that follows loss of rods. In this study, we investigated gene expression changes associated with the progression of photoreceptor degeneration in rdl mice using a custom retina microarray. The microarray contains 5,376 DNA fragments that correspond to mouse genes known or postulated to be involved in normal retinal function, development, or disease. Gene expression in rdl retina was compared with age-matched wild-type controls at three time-points corresponding to critical stages in retina degeneration: peak of rod degeneration, early in cone degeneration and during cone degeneration. Statistical significance analyses demonstrated that approximately 3% of the genes on the microarray were differentially expressed, including known genes and genes that had not been previously implicated in degeneration. Interestingly, there was less overlap in the genes that were upregulated at each stage of degeneration, suggesting the involvement of distinct molecular pathways. Genes involved in transport, signalling and cytoskeleton were differentially expressed during rod degeneration whereas genes involved in growth and proliferation, oxidative stress and protein modification were increased prior to and during cone degeneration. These results provide clues to underlying molecular processes occurring during photoreceptor degeneration, and provide direction for future cell-based studies. | en | NEURONAL AND RETINAL GENE EXPRESSION PATTERNS | 7226329_US,37140339_US,37140334_US | 37140339_US,37140334_US | A61K 38/00,A61K2039/505,C07K 14/47,C12Q 1/6837,C12Q 1/6883,C12Q2600/158 | [
"A61K 38/00",
"C12N 5/08",
"C12Q 1/68",
"C07K 14/47"
] | 31,619 |
52,338,562 | 2000-07-31 | 29,741,193 | Y | A schema provides for the storage of geographic information on a personal digital assistant (PDA). Embodiments provide differential encoding and indexing of raster and vector based data. A schema provides for compact and performable storage of both data and metadata for raster, vector, and redlining information. A single database is utilized for mapset metadata and data. Timestamp/history information allows smart, incremental updates of the database. Indexing information allows compact and efficient storage and retrieval of objects and vector geometry. The schema allows a variable number of mapsets, maps, raster tiles, and geometry layers. Metadata for geometry types and redlining markup information are permitted. Geo-referencing information for raster and vector data allows the display of objects at the correct map location. Raster data is augmented with compact vector data. The vector data may be used for efficiently storing and retrieving the map data, allowing interactive selection, and the highlighting and querying of objects. Vectors are generalized by removing detail without losing shape information in a manner appropriate to PDA display resolution. Object location data is differentially encoded to provide precision using a fewer number of bytes (2 bytes per coordinate). The vector object includes spatial indexing information, to allow for spatial filtering of objects that fall within a specified view. Thus, the invention uses cartographic generalization, encoding, and indexing to provide for compact, and efficient spatial storage structures that deal with the PDA constraints of limited storage, processing power, memory and bandwidth. | en | Generalized, differentially encoded, indexed raster vector data and schema for maps on a personal digital assistant | 5248581_US | 9233216_US,9233217_US | G06T 9/00,G06T 9/004,G06T 17/05,G09B 29/007 | [
"G06T 15/00"
] | 43,873 |
50,355,385 | 2003-02-25 | 21,708,497 | Y | The present invention relates to methods and materials for the detection and quantitation 8-OH-Ade in biological specimens. Specifically, the present invention is directed to a group of highly specific monoclonal antibodies reactive with the modified nucleoside structure 8-OH-Ade, and to various immunoassays for 8-OH-Ade utilizing these monoclonal antibodies. The monoclonal antibodies of the present invention may be used in assays for diagnosing or monitoring the progression of certain types of cancer, in addition to a variety of other diseases associated with mutagenesis resulting from oxidative damage of DNA. Assays utilizing the monoclonal antibodies of the present invention may also be used to analyze or monitor toxicant exposure, such as from environmental sources. The monoclonal antibodies of the present invention were prepared with the immunogen 8-OH-adenosine coupled to keyhole limpet hemocyanin (KLH), not to 8-OH-Ade directly. It is believed that the monoclonal antibodies bind with the base portion of the structure (8-OH-Ade) and not the carbohydrate (ribose) or protein linkage region of the conjugate, because, as demonstrated, conjugates bound to nucleosides other than 8-OH-adenosine were unreactive with these antibodies. Therefore, the antibodies of the present invention can be used to detect and quantitate (by the use of a standard curve) the presence of 8-OH-Ade in biological specimens of DNA. Procedures for such an assay include immobilizing the DNA, denaturing it to disrupt the base-pairing scheme exposing the free base structures, and quantitating the amount of 8-OH-Ade present per amount of DAN in a quantitative immunoassay. | en | Detection and quantitation of 8-OH-adenine using monoclonal antibodies | 7827038_US | 7827039_US,5646072_US | G01N 33/5308,G01N 33/57484 | [
"G01N 33/574",
"G01N 33/53"
] | 39,917 |
421,766,798 | 2014-03-11 | 48,816,157 | N | The present invention provides a method in place of a brain to learn other languages for a native language speaker. The reading comprehension of a bilingual text for a native language speaker is moved onto a computer. During reading comprehension, word strings that can be used as a sentence cabin are identified by the speaker using mouse clicks or are automatically identified by software; word strings are then marked as sentence cabins and cabin eyes such that a sentence comprehension template and an ideographic structure are generated via stored reading comprehensions, the template and the structure having the same semantic meaning and mapping to one another; 'learning' is thus accomplished by the software in place of a brain, and a sentence comprehension template database collects everything everyone has learned. The software then divides a source sentence into an ideographic structure, converts the ideographic structure into a target sentence, and provides the sentence to be adjusted for correction; if no correction is required, the next sentence is processed; if a correction is required, 11 simple correction methods interacting with a self-learning module are provided; after the correction, later conversions from a sentence A to a sentence B become more precise. Multiple applications in place of a brain for foreign language reading using native language, foreign language - native language translation, native language - foreign language translation, and sentence frame assisting writing, along with abilities to read and refer to foreign language material, are thereby provided to native language speakers who cannot read foreign languages. | en | SOFTWARE AND SYSTEM IN PLACE OF BRAIN TO LEARN OTHER LANGUAGES FOR A NATIVE LANGUAGE SPEAKER | 40943033_CN | 40943033_CN | G06F 16/3337,G06F 16/3344,G06F 16/36,G06F 40/45,G09B 19/06 | [
"G06F 17/28",
"G06F 17/30"
] | 88,559 |
16,020,450 | 2003-01-13 | 27,658,520 | Y | An eye diagram analyzer assigns a plurality of SUT data signals (8) to be members of a labeled group (5) of channels. There may be a plurality (6,7) of such groups. In addition to mere superposition in an (X, Y) display space of the various i-many (X, Y)-valued pixels for individual component eye diagrams associated with that group, other measured data for those pixels within a group can be merged in various different modes (13) to produce corresponding composite eye diagram presentations (11). E.g., in a Normalized Signal Density Mode the number of hits at each trial measurement point is summed over all channels in the group, and then divided by the total number of clock cycles measured for the i<sub>th</sub> measurement point in that group to produce a density D<sub>i</sub> associated with the corresponding i<sub>th</sub> pixel: (X<sub>i</sub>, Y<sub>i</sub>, D<sub>i</sub>). If D<sub>i</sub> is rendered as a color or an intensity, the resulting eye diagram includes a representation (the D<sub>i</sub>) of a normalized density of transitions at each point (X<sub>i</sub>, Y<sub>i</sub>), relative to that group as a whole. As a further example, in a Channel Density Mode, each D<sub>i</sub> is produced by accumulating, for each of N-many channels, a 1/N for each sample (value of i) with non-zero signal activity, and dividing the accumulation by N. If that collection of D<sub>i</sub> is rendered as a color or an intensity, the resulting composite eye diagram includes a representation (the D<sub>i</sub>) at each (X<sub>i</sub>, Y<sub>i</sub>) point of the degree of coincidence among, or a degree of similarity between, the channels in the group. | en | Method of creating a composite eye diagram | 28262_US | 1408349_US,280540_US | G01R 13/029,G01R 31/31711,G01R 31/31901,G01R 31/3191,G01R 31/31912,G01R 31/31937 | [
"G01R 31/28"
] | 14,762 |
548,499,189 | 2020-09-18 | 75,250,082 | N | The present invention relates to a brain plasticity control device to increase or suppress brain plasticity by applying theta-burst ultrasound stimulation, and a brain plasticity control method thereof. According to the present invention, the neural plasticity control device using theta-burst ultrasound and the method thereof can safely control the plasticity of the brain in a non-invasive way without surgical operation. In addition, unlike conventional transcranial magnetic stimulation or transcranial electrical stimulation, transcranial ultrasound stimulation has a high spatial resolution to control stimulation control in a required brain region and has the permeability, spatial resolution, and duration of the follow-up effect are significantly increased more than those of the conventional transcranial magnetic stimulation using theta-burst pulses so that the effect lasts up to 1 hour even after a few minutes of stimulation. Accordingly, the neural plasticity control device using theta-burst ultrasound and the method thereof increases or suppresses the plasticity of the brain according to an application pattern of theta-burst pulse, thereby being useful in brain function-related fields such as improvement of learning ability, memory, and the like through long-term strengthening and suppression of the brain, prevention and treatment of various neurological diseases such as depression and the like, and regulation of abnormally increased brain activity such as epilepsy and seizures. According to the present invention, a theta-burst ultrasound stimulation generation unit comprises a pulse generator, a function generator, and a transducer. | en | - Neural Plasticity Control Device and Method Using Theta-Burst Ultrasound | 67962749_KR | 75616406_,60752900_,76671136_,80855921_ | A61M 21/00,A61M2021/0038,A61M2205/058,A61N 7/00,A61N2007/0026 | [
"A61N 7/00",
"A61M 21/00"
] | 151,781 |
482,032,838 | 2016-11-16 | 59,313,837 | Y | Abstract Modeling semantic concepts in an embedding space as distributions is described. In the embedding space, both images and text labels are represented. The text labels describe semantic concepts that are exhibited in image content. In the embedding space, the semantic concepts described by the text labels are modeled as distributions. By using distributions, each semantic concept is modeled in the embedding space as a continuous cluster which can overlap other clusters that model other semantic concepts. Once an embedding space is trained, the embedding space can be used to discover text labels to describe content of an image. To use a trained embedding space to discover text labels that describe content of an image, multiple semantically meaningful regions of the image can be determined and corresponding text labels can be discovered in the trained embedding space for each of the regions. Inventor: Lin et al. Title: Modeling Semantic Concepts in an Embedding Space as Distributions Process a training image having multiple text labels to generate a set of image regions that correspond to the respective multiple text labels Embed the set of regions within an embedding space that is configured to embed both text labels and image regions mapped to the text labels Apply label discovery techniques to a query image to map image regions of the query image to the text labels in the embedding space to discover text labels that correspond to the image regions Annotate the query image with the discovered text labels to describe the content of the query image Present the regions of the query image that correspond to the discovered text labels | en | MODELING SEMANTIC CONCEPTS IN AN EMBEDDING SPACE AS DISTRIBUTIONS | 71788041_US | 53765045_,56191630_,56286350_,48525521_ | G06F 16/5866,G06F 40/169,G06F 40/30,G06K 9/6273,G06N 3/0454,G06N 3/08,G06N 20/00 | [
"G09G 5/377",
"G06T 11/60",
"G06F 17/10"
] | 110,679 |
17,262,060 | 1997-11-04 | 17,774,839 | Y | An object is to provide a novel game card for a sympathetic game or the like, which enables a plurality of players to enjoy a psychological sympathetic game. The card comprises: a positional specific information entering space with a frame, a player's specific information entering space with a frame, a digital information entering space with a frame and an analog information entering space with a frame, wherein the game card is used for playing a game in which the game cards are dealt to a plurality of players one by one; each player enters a positional information for specifying a position of the each player in the positional specific information entering space, enters a player's specific information for specifying the player in the player's specific information entering space, enters an information selected from among a plurality of written information predetermined as selective information in the digital information entering space and enters an information which optionally occurs to the player in the analog information entering space, and then the game cards are collected; the plurality of collected game cards are arranged in accordance with the positional information entered in the positional specific information entering space; and a degree of sympathy between one digital information entered in one game card and another digital information entered in another game card which is arranged around the one game card, and a degree of sympathy between one analog information entered in one game card and another analog information entered in another game card which is arranged around the one game card are estimated by giving points. <IMAGE> | en | CARD FOR GAMES | 3733328_JP | 3733329_JP | A63F 1/02,A63F 9/10 | [
"A63F 9/10",
"A63F 1/04",
"A63F 1/02"
] | 19,637 |
556,253,943 | 2020-10-23 | 71,430,335 | N | A big-data-based zero anaphora resolution method. The method comprises: acquiring a sentence to be resolved and preceding text information thereof, and performing vectorization processing on the sentence to be resolved and the preceding text information thereof so as to obtain a context vector representation of each word in the sentence to be resolved and a context vector representation of each word in the preceding text information (S101); inputting the context vector representation of each word in the sentence to be resolved and that in the preceding text information into a bidirectional long short-term memory network to enhance the context expression and position information of each word, so as to obtain an enhanced context vector representation of each word (S102); traversing the enhanced context vector representation of each word, and according to a parameter vector in a bert model, predicting an anaphora item head word probability and an anaphora item tail word probability of each word (S103); traversing each word, constructing continuous text segments, and according to the anaphora item head word probability and the anaphora item tail word probability of each word, calculating anaphora item probabilities of the continuous text segments (S104); and selecting the continuous text segment with the maximum anaphora item probability from among the continuous text segments as an anaphora item of the sentence to be resolved (S105). The method solves the problems of existing zero anaphora resolution techniques being excessively dependent on an anaphora item candidate set, and a resolution result being low in accuracy and being unstable. | en | BIG-DATA-BASED ZERO ANAPHORA RESOLUTION METHOD AND APPARATUS, AND DEVICE AND MEDIUM | 63942312_CN | 71605847_CN,76757661_CN,71086078_CN | G06F 16/3329,G06N 3/0445,G06N 3/0454,G06N 3/08 | [
"G06F 40/211"
] | 157,047 |
541,996,389 | 2020-11-26 | 68,886,753 | N | The invention relates to a method to provide a computer-modified picture (13) of a desired face of a person (2), which method comprises the following steps: - Generate a data set of visuals of faces and extracted face property data thereof linked to face characteristics data provided by a representative set of humans that rate the visuals of these faces about their face characteristics and store the data set in a database (8); - Extract further face property data of these visuals of faces and use these extracted face property data together with the generated data set for training of an artificial intelligence to enable the artificial intelligence to provide an automated rating of the characteristics of the visuals of faces; - Generate a data set of visual modifications of a face achievable by cosmetic and/or medical treatments (16) and store the data set in a database (9); - Take a standardized visual of the face of the person (2); - Input at least one desired characteristic of the face of the person (2) to be changed; - Use the artificial intelligence to analyse the visual of the person's face and to generate a data set of modifications (12) based on the selected desired characteristic(s) and modifications achievable by at least one cosmetic and/or medical treatment; - Modify the visual of the face of the person (2) based on the data set of modifications (12) and generate the computer-modified visual (13) of the desired face of the person (2) with the modification of the face achievable by the least one proposed cosmetic and/or medical treatment (16); - Display the computer-modified visual (13) of the desired face of the person (2). | en | METHOD AND SYSTEM TO PROVIDE A COMPUTER-MODIFIED VISUALIZATION OF THE DESIRED FACE OF A PERSON | 80660286_AT | 81489149_AT | A61B 5/004,A61B 5/0077,A61B 5/167,A61B 5/7267,G06K 9/6256,G06N 5/00,G06N 7/00,G06N 20/00,G06T 7/0012,G06T 11/60,G06T2200/24,G06T2207/10148,G06T2207/20081,G06T2207/30201,G06V 40/169,G06V 40/171 | [
"A61B 5/16",
"A61B 5/00",
"A61B 34/10",
"G06K 9/00"
] | 147,277 |
329,622,369 | 2008-10-21 | 40,590,667 | Y | An electroencephalogram IF system includes an electroencephalogram measurement section for measuring an electroencephalogram signal, a function control section for analyzing an event-related potential contained in the electroencephalogram signal and outputting a function control signal for controlling a function of a device based on the result of analysis, and an output section for outputting the function control signal. The activation apparatus includes: an activation determination section for, while the electroencephalogram IF system is not functioning, transmitting to the output section a stimulation control signal for controlling presentation and vanishing of a visual stimulation on a single-item on the output section and, within the electroencephalogram signal acquired from the electroencephalogram measurement section, allowing a P200 component value of an event-related potential since the timing of presenting the visual stimulation as a starting point to be compared against a predetermined threshold value, and determining whether or not to output an activation trigger to the function control section based on the result of comparison; and a stimulation attention determination section for determining whether or not the user is paying attention to the visual stimulation based on an N100 component of the event-related potential since the timing of presenting the visual stimulation as a starting point, and causing processing by the activation determination section to begin depending on the determination result. When the activation determination section outputs an activation trigger, the electroencephalogram IF system is activated. | en | Activation apparatus, method, and computer program for brainwave interface system | 5210911_JP,7534224_JP,8621117_JP,7534225_JP | 8621117_JP,7534224_JP,7534225_JP | A61B 5/378,G06F 3/015 | [
"A61B 5/0476",
"A61B 5/04"
] | 65,418 |
425,707,229 | 2003-07-02 | 29,999,713 | N | An analog neural computing medium, neuron and neural networks comprising same are disclosed. The neural computing medium includes a phase change material that has the ability to cumulatively respond to multiple synchronous or asynchronous input signals. The introduction of input signals induces transformations among a plurality of accumulation states of the disclosed neural computing medium. The accumulation states are characterized by a high electrical resistance that is substantially identical for all accumulation states. The high electrical resistance prevents the neural computing medium from transmitting signals. Upon cumulative receipt of energy from one or more input signals that equals or exceeds a threshold value, the neural computing medium fires by transforming to a low resistance state that is capable of transmitting signals. The neural computing medium thus closely mimics the neurosynaptic function of a biological neuron. The disclosed neural computing medium may also be configured to perform a weighting function whereby it weights incoming signals and transmits modified signals. The neural computing medium may thus be configured to provide an accumulation function or weighting function and may readily be reconfigured from one function to the other. The disclosed neurons may also include activation units for further transforming signals transmitted by the accumulation units according to a mathematical operation. The artificial neurons, weighting units, accumulation units and activation units may be connected in a variety of ways to form artificial neural networks. Embodiments of several neural networks are disclosed. | en | Analog neurons and neurosynaptic networks | 9273156_US | 9936570_US | G06N 3/0635,G11C 11/54,G11C 11/5678,G11C 13/0004 | [
"G06F 19/00"
] | 91,265 |
542,956,211 | 2017-10-31 | 60,201,620 | Y | FIELD: medicine.SUBSTANCE: method for determining a perivascular water index (PVWi) of a blood vessel includes: (i) using data collected from a computed tomography scan along the length of the vessel to determine the total volume of water voxels within the attenuation window around the attenuation for water within the perivascular space at a predetermined distance from the outer wall of the vessel and (ii) correcting the total volume of water voxels by the volume of the vessel by dividing the total volume of water voxels determined at stage (i) by the total perivascular volume. The perivascular water index (PVWi) is used as a functional biological marker of vascular inflammation. A method for predicting the risk of mortality or risk in a patient suffering from a cardiac event includes: (a) using data collected from a computed tomography (CT) scan along the length of a blood vessel to determine: (i) a calcium index (Calcium-i) and/or (ii) a fibrous plaque index (FPi) and at least one of (iii) a fat attenuation index in perivascular adipose tissue (FAIPVAT); (iv) a perivascular water index (PVWi) and/or (v) a fat attenuation index in epicardial adipose tissue (FAIEpAT); and (b) comparing each of values determined in (a) with a predetermined separation value or applying the absolute value of each variable to obtain an output value that indicates the risk that the patient suffers from a cardiac event.EFFECT: use of this group of inventions will allow non-invasive detection of vascular inflammation and will provide the possibility to identify patients who are at risk of suffering from serious cardiac events.26 cl, 9 dwg, 4 tbl, 1 ex | en | PERIVASCULAR WATER INDEX AND ITS APPLICATION FOR PREDICTING ALL-CAUSE MORTALITY OR MORTALITY FROM CARDIAC EVENTS | 82688459_GB | 82972981_GB,82724344_GB,83092506_GB,82940955_GB | A61B 6/032,A61B 6/504,A61B 6/5217,G06T 7/0012,G06T 7/62,G06T 11/008,G06T2207/10081,G06T2207/30048,G06T2207/30101,G16H 30/40,G16H 50/30,Y02A 90/10 | [
"A61B 6/03"
] | 147,873 |
15,931,433 | 2002-10-08 | 36,590,817 | Y | An apparatus and a method for computing a Speech Absence Probability (SAP), and an apparatus and a method for removing noise by using the SAP computing device and method are provided. The provided SAP computing device for computing the SAP indicating probability that speech is absent in a m<th> frame, from a first through Nc<th> posteriori (Nc means the total number of channels) Signal to Noise Ratios (SNR) calculated with regard to the m<th> frame of a speech signal and a first through Nc<th> predicted SNRs predicted with regard to the m<th> frame, includes: a first through Nc<th> likelihood ratio generators for generating a first through Nc<th> likelihood ratios from the first through Nc<th> posterior SNRs and the first through Nc<th> predicted SNRs, and outputting them; a first multiplying unit for multiplying the first through Nc<th> likelihood ratios by a predetermined a priori probability, and outputting the multiplication results; an adding unit for adding each of the multiplication results received from the first multiplying unit to a predetermined value, and outputting the added results; a second multiplying unit for multiplying the added results received from the adding unit and outputting the multiplication result; and a inverse number calculator for calculating inverse number of the multiplication result received from the second multiplying unit and outputting the calculated inverse number as the SAP. Therefore, since the accuracy of the calculated SAP is high, noise can be efficiently removed from the speech signal that may have noise and an enhanced speech signal with an enhanced quality can be provided. <IMAGE> | en | Speech absence probability estimation and noise removal | 3278_KR | 1262372_KR,1262371_KR,1262370_KR | G10L 21/02,G10L 21/0208,G10L 25/78 | [
"G10L 21/02",
"G10L 15/20",
"G10L 15/04",
"G10L 11/02",
"G10L 15/00",
"G10L 25/93",
"H04B 1/10"
] | 14,073 |
17,024,308 | 1993-05-21 | 26,691,675 | N | A driver training system (100) for a user (102) of a simulated vehicle. The system (100) includes input devices (104-112) for controlling the simulated vehicle, a video display (122) having three-dimensional graphics, a computer (114), modeling software for determining position information based on the input devices, atmospheric effects software to simulate time-of-day and weather conditions, realistic operating feedback software for simulating on the input devices the feedback normally experienced with operating the vehicle, and recursive training software to display a previous route (180) through an environment simultaneously with a present route (192) through the environment together with associated performance data (182-188). Another aspect of the recursive training software replays either the previous route (180) or present route (192) and controls one of the input devices (112) to provide ''hands-on'' feedback to the user (102). The user (102) then incrementally and recursively maximizes parameters associated with vehicle operation skill. The preferred embodiment includes a low frequency sound system (800) having a low frequency speaker (830) mounted on an enclosure (828) adjacent to the simulation user's seat (802) through which road feel cues such as hitting an object are transmitted to the user (102) in response to signals received from the computer (114). Another aspect of the invention is a system (900) for simulating the feel to the user (102) of anti-lock brakes on a brake pedal (106) in response to signals received from the computer (114). The driver training system (100) may be embodied as a vehicle simulator. | en | DRIVER TRAINING SYSTEM WITH PERFORMANCE DATA FEEDBACK. | 2624265_US | 3295492_US,3295494_US,3295493_US | A63F 13/005,A63F 13/08,A63F 13/10,A63F 13/285,A63F2300/1037,A63F2300/302,A63F2300/636,A63F2300/64,A63F2300/66,A63F2300/8017,G06T 15/00,G06T 15/50,G09B 9/04,G09B 9/05 | [
"G09B 9/05",
"G09B 19/16",
"A63F 13/10",
"A63F 13/08",
"G09B 9/04",
"G06T 15/50",
"A63F 13/00",
"G06T 15/00"
] | 18,420 |
4,110,284 | 1979-11-22 | 25,520,878 | Y | APERIODIC ANALYSIS SYSTEM, AS FOR THE ELECTROENCEPHALOGRAM An aperiodic signal is preliminarily processed by an active network (34) to provide three relatively separate components that include: slow waves (waveform cycles or fragments of equivalent frequency from 1 to 8 hertz), fast waves (waveform cycles or fragments of equivalent frequency from 8 to 30 hertz), and a signal component which may contain spikes (fast, large, sharp single waves). The component signals or waves are applied to individual detector circuits (42, 44, and 46) which indicate amplitude and period (or equivalent frequency) information for detected waves and the amplitude for recognized spikes, as well as the time of their occurrence. Detected waves (including spikes) produce representative trigger signals which are applied through a multiplexer (50) to a storage device (16), specifically a cathode ray tube (18) on which the waves and spikes are representatively displayed and stored to complete a static picture which indicates an interval of the waveform. As disclosed, a representation or picture is generated on the storage tube (18) by controlling the horizontal and vertical amplifiers and appropriately blanking the beam to develop a composite display that summarizes many seconds of the aperiodic signal. The display (FIGURE 2) is a three-dimensional representation with each wave represented by a line (24, 26, 28, 30, or 32) that extends in one dimension to indicate amplitude The position of the line in another dimension indicates the period or equivalent frequency, and its position in the third dimension indicates the time of occurrence of the wave. | en | APERIODIC ANALYSIS SYSTEM AS FOR THE ELECTROENCEPHALOGRAM | 15821169_ | 16038770_ | A61B 5/339,A61B 5/369 | [
"A61B 5/0476",
"G06F 17/00",
"A61B 5/044",
"A61B 5/0432"
] | 3,357 |
402,513 | 2006-06-23 | 36,190,788 | N | Para-phenylene diamine compounds (I), their solvates and acid addition salts are new. Para-phenylene diamine compounds of formula (I), their solvates and acid addition salts are new.R 1R 2= combine to form 4-7 membered rings (containing carbon and two atoms of O or N) (optionally substituted). Provided that when the ring comprises two atoms of O or N, then the two atoms are in non-adjacent position. Provided that (I) is not 2,3-dihydro-benzo[1,4]dioxine-5,8-diamine, 3,4-dihydro-2H-benzo[b][1,4]dioxepine-6,9-diamine, 2-methyl-benzo[1,3]dioxole-4,7-diamine, 1,1-dimethyl-indan-4,7-diamine, 5,6,7,8-tetrahydro-naphthalene-1,4-diamine or bicyclo[4.2.0]octa-1,3,5-triene-2,5-diamine. Independent claims are included for: (1) the preparation of (I); (2) a diazo intermediate compound of formula (II); (3) a dye composition comprising (I) (except 2,3-dihydro-benzo[1,4]dioxine-5,8-diamine, 3,4-dihydro-2H-benzo[b][1,4]dioxepine-6,9-diamine or 2-methyl-benzo[1,3]dioxole-4,7-diamine) in a coloring medium; (4) a dyeing process of human keratinous fibers i.e. hair, comprising applying the dye composition on hair up to the development of a desired color, in air, using an oxidizing agent, optionally in the presence of an oxidation catalyst; and (5) a kit having several compartments comprising the dye composition in a first compartment and an oxidation composition in a second compartment. R 3 : H, sulfonic or 1-4C alkyl. Provided that (II) is not 4-phenylazo-5,6,7,8-tetrahydro-naphthalen-1-ylamine, 4-(4-butyl-phenylazo)-5,6,7,8-tetrahydro-naphthalen-1-ylamine or 4-(4-amino-5,6,7,8-tetrahydro-naphthalen-1-ylazo)-benzenesulfonic acid. [Image]. | en | New primary 2,3-disubstituted para-phenylendiamins and their use as oxidative colouring of keratinic fibers | 35697_FR | 705256_FR | C07C 211/51,C07C 215/70,C07C 245/08,C07C2602/06,C07C2602/08,C07C2602/10,C07D 209/44,C07D 217/04,C07D 307/87,C07D 311/76,C07D 317/46,C07D 319/18,C07D 321/10 | [
"C07C 211/51",
"C07C 245/08",
"A61K 8/41",
"C07D 217/00",
"C07D 209/44",
"C07C 215/70",
"C07D 307/87",
"A61Q 5/10",
"A61K 8/49",
"C07D 311/76"
] | 2,291 |
16,826,849 | 1990-12-13 | 24,045,698 | Y | A method and apparatus of modeling a word by concatenating a series of elemental models to form a word model. At least one elemental model in the series is a composite elemental model formed by combining the starting states of at least first and second primitive elemental models. Each primitive elemental model represents a speech component. The primitive elemental models are combined by a weighted combination of their parameters in proportion to the values of the weighting factors. In order to tailor the word model to closely represent variations in the pronunciation of the word, the word is uttered a plurality of times by a plurality of different speakers. From the prior values of the weighting factors, and from the values of the parameters of the first and second primitive elemental models, the conditional probability of occurrence of the first primitive elemental model given the occurrence of the composite elemental model and given the occurrence of the observed sequence of component sounds is estimated. A posterior value for the first weighting factor is estimated from the conditional probability. By constructing word models from composite elemental models, and by constructing composite elemental models from primitive elemental models, it is possible for the resulting word model to closely represent many variations in the pronunciation of a word. By providing a relatively small set of primitive elemental models in comparison to a relatively large vocabulary of words, the models can be trained to the voice of a new speaker by having the new speaker utter only a small subset of the words in the vocabulary. <IMAGE> | en | Method and apparatus for modeling words with composite Markov models | 11589_US | 2910572_US,2910574_US,263_,2910573_US,2910575_US,2899312_US | G10L 15/144 | [
"G10L 15/10",
"G10L 15/06",
"G06F 7/00",
"G10L 15/14",
"G06F 17/18"
] | 17,910 |
508,719,664 | 2019-02-19 | 61,970,236 | N | A device, including one or more processors that receive information that identifies an item to be categorized, the item including a set of first terms, map the item to a first vector based on the set of first terms, the first vector including a set of first values that correspond to the set of first terms, compare the first vector and a second vector associated with a categorized item, the second vector including a set of second values that correspond to a set of second terms associated with the categorized item, determine an amount of the first values that match the second values based on comparing the first vector and the second vector, determine a similarity value between the first vector and the second vector based on the amount of the first values that match the second values, determine that the similarity value satisfies a threshold, determine a category associated with the item based on the similarity value satisfying the threshold, the categorized item being associated with the category, compare a third vector and the first vector, the third vector associated with another item to be categorized, determine that another similarity value between the third vector and the first vector satisfies the threshold, determine that the other item is associated with the category based on the other similarity value satisfying the threshold, and provide information that identifies the category associated with the item and the other item to permit and/or cause an action to be performed. LO) > C 0 Co Iz L..L UU) -C 0> N 0-0 Nc L.4- d E co 0 EE m) 0 0~ u a) 2l 1 D C : :> U) C/)h.A / *~ ~0 / 02c,, C) 0 '2E E E CO 2) 'U)I) a) U) | en | ITEM TO VECTOR BASED CATEGORIZATION | 54000148_IE | 57229768_ | G06F 16/334,G06F 16/35,G06F 40/205,G06N 20/00 | [
"G06F 15/00"
] | 125,808 |
375,082,126 | 2009-02-27 | 41,016,720 | N | Disclosed is a method of predicting a predisposition to developing an addictive disease or disorder in a test subject, said method comprising: providing a biological sample obtained from the test subject; determining whether the subject has the G allele or is homozygous for the T allele of the single nucleotide polymorphism rsl042173 of the serotonin transporter gene SLC6A4, wherein the presence of the G allele is an indication that the test subject has a lower predisposition to developing an addictive disease or disorder relative to a subject homozygous for the T allele and wherein homozygosity of the T allele in the test subject is an indication that the test subject has a higher predisposition to developing an addictive disease or disorder compared with a subject with the G allele; thereby predicting a predisposition to developing an addictive disease or disorder in a subject. Further disclosed is the use of an antagonist of the serotonin receptor 5-HT3 in the manufacture of a medicament for treating a subject with an addictive disease or disorder, wherein: (a) the use includes determining whether the serotonin transporter gene SLC6A4 of the subject has the LL genotype of functional polymorphism serotonin transporter-linked polymorphic region 5-HTTLPR, and determining whether the subject has the G allele or is homozygous for the T allele of the single nucleotide polymorphism rsl042173 of the serotonin transporter gene SLC6A4; and, (b) the antagonist of the serotonin receptor 5-HT3 is formulated for administration to a patient found to have the LL and TT genotypes so as to treat an addictive disease or disorder. | en | Serotonin transporter gene SLC6A4 and treatment of alcoholism | 5223325_ | 43949654_ | A61K 31/4178,A61K 45/06,A61P 25/30,A61P 25/32,C12Q 1/6883,C12Q2600/106,C12Q2600/118,C12Q2600/156,C12Q2600/158,G01N 33/6872,G01N 33/6893,G01N 33/942,G01N2800/307,G01N2800/50 | [
"G01N 33/53"
] | 75,712 |
266,831,851 | 2009-02-10 | 40,985,382 | N | Characteristic data comprised of times and levels of a rising-up point and a direct wave peak point are outputted from a characteristic point detection unit (102). A characteristic point detection adaptive control unit (103) receives the characteristic point data as an input and inputs the characteristic point data to a next characteristic point prediction unit (1034), a memory unit (1031), and a prediction result judgment unit (1033) in the characteristic point detection adaptive control unit (103). The memory unit (1031) stores at least characteristic point data used only by the next characteristic point prediction unit (1034) from the latest data to back-dated past data. The memory unit (1031) stores the characteristic point data up to two sets of the rising-up points and the direct wave peak points. The next characteristic prediction unit (1034) uses the present characteristic data and characteristic point data up to former two periods on a pulse waveform read out from the memory unit (1031), so as to predict a characteristic point in future one period on the pulse waveform. A control information generation unit (1035) generates control information for the characteristic point detection unit (102) to carry out an operation of the characteristic point detection only in the predicted range and outputs the control information to the characteristic point detection unit (102). Thus, the pulse waveform measured from a living body has a single peak or double peaks per one period waveform depending on an overlapped condition of reflection waves, so that error detection has been caused in the rising-up point detection. | en | LIVING BODY SIGNAL ANALYSIS DEVICE | 5233002_JP,40943239_,32383867_ | 40943239_,32383867_ | A61B 5/02433 | [
"A61B 5/0245"
] | 57,456 |
11,268,826 | 1993-08-23 | 26,525,874 | Y | Intracellular ion concn. is measured using a fluorescent dye probe (I) which is introduced into the cell and free ion concn. measured from the intensity of fluorescence excited. The process comprises: (1) measuring intensity of fluorescence excited, at 3 different wavelengths, in a set of solns. contg. (I) and free ion at various concns.; (2) measurements, as in (1), for a set of solns. contg. (I) and an interfering biosubstance (II), other than the free ion, which binds with (II) and ion causing a change in fluorescent intensity; (3) measurement a set of solns. of (II), (I) and free ion; (4) establishing initial values of the 3 types of equilibrium constants (reactions of (I) with free ion, (II) and intracellular complexes) and of the 12 types of fluorescent coefficients (for calculating fluorescent intensities) used to provide relations between (I), free ion, (II) and complexes; estimating error value, between estimated and measured fluorescence intensities and iterative asymptotic correction the modified simplex method until the error values are within the permitted range; and (5) measuring intensity of fluorescence excited in cells at the same 3 wavelengths and solving the simultaneous equations for fluorescence intensity (by inserting the measured values) and the equilibrium reaction equations to give a value for the free ion concn. USE/ADVANTAGE - Esp. used to measure distribution and variation in Ca or Mg ion concn. within cells. Compared with conventional 2-wavelength methods, the workload involved is reduced. It can account for errors caused by interaction of (I) with components other than the analyte. | en | Determn. of intracellular ion concn. with fluorescent dye probe - by taking measurements at three wavelengths to account for interaction of dye with interfering proteins, partic. for calcium and magnesium ions | 23195259_JP,22598944_JP | 23195259_JP,23195261_JP,23195260_JP | G01N 21/6428,G01N2021/6419,G01N2021/6421,G01N2021/6439,Y10S 435/973 | [
"C12Q 1/06",
"G01N 21/64",
"G01N 33/487",
"G01N 21/78",
"G01N 21/80",
"G01N 33/84",
"C12Q 1/02"
] | 11,216 |
559,875,966 | 2021-04-22 | 78,222,440 | N | Computer-implemented systems and methods are provided for the synchronization of data from asynchronous datasets to form a merged, synchronized data set, and more particularly to systems and methods for merging disparate and asynchronous data sets that include common dimensions, such as space and time dimensions, and more particularly space and time data relating to a driving simulation environment (such as driving simulator data and eye tracking data having disparate time data resolutions), to enable data extraction from and analysis of the merged, synchronized data set. A driving simulator system includes a driver interface having driving controls and a display and creates driving simulator data files for each driver of the driving simulator system having data entries that are captured at a first timing frequency. Likewise, an eye tracking system includes eye tracking cameras for tracking a driver's eye movements when using the driving simulator system and creates eye tracking data files for each driver of the driving simulator system having data entries that are captured at a second timing frequency that is different from the first timing frequency at which driving simulator data is captured. A driving behavior analysis computer is also provided that merges the asynchronous data embodied in each of the driving simulator data files and the eye tracking data files to form a single merged data file based upon an interpolation of data entries in those data files. The merged data files may then be further processed to enable extraction and analysis of the merged data in order to identify various driver behaviors. | en | SYSTEM AND METHOD FOR SYNCHRONIZATION OF ASYNCHRONOUS DATASETS | 12373409_US | 81780468_US,81870409_US,81872526_EG | G01S 5/16,G06F 3/013,G06F 16/254,G06F 30/15,G06F 30/20,G06V 20/64,G06V 40/18,G06V 40/19,H04N 5/247 | [
"G06F 16/25",
"G06F 3/01",
"G06K 9/00",
"H04N 5/247",
"G06F 30/20"
] | 159,303 |
48,497,793 | 1994-01-28 | 26,322,571 | Y | A doll eye mechanism responsive to the voice and designed as a replaceable unit provided in a toy or doll to simulate communication with a child. When the child speaks to the doll, the mechanism provides eye rotation, to simulate a human response. The mechanism comprises control circuitry which receives the voice as an input to a microphone, and converts this into a drive signal which powers a transmission designed as a motor and gears to provide rotation. The voice-responsive mechanism provides a metaphor for the natural mechanism of the brain which makes communication possible. The human eye, the organ of sight, receives the information (the child's voice) through the cornea (microphone) and passes on the message (via the control system) to the rear lobe of the brain (transmission mechanism) which coordinates the movement of the two eyes (two axes of motor). For example, a stuffed toy dog may be designed with the inventive mechanism and when the child calls the dog by its name, the dog responds by moving its eyes. The louder the child speaks to the dog, the faster the eye movement. The voice stimulus/repeated eye response from the toy represents, in effect, 'communication' between the child and the toy dog. The inventive voice-responsive mechanism may be provided in many toys and doll designs, including toy cars, stuffed animals, etc. Each item is designed with facial features, 'humanizing' it to simulate communication via the eye expression. The facial features encourage voice communication, and as a result, simplified electronics sensitive to the voice frequency are usable for voice-responsive operation. | en | Voice-responsive doll eye mechanism | 6729568_IL,6729567_IL | 6729569_IL,6729570_IL | A63H 3/40,A63H 30/04 | [
"A63H 3/40",
"A63H 30/04"
] | 37,294 |
50,567,937 | 1999-09-16 | 26,797,514 | Y | The present invention relates to a method for diagnosing visuospatial disorientation or assessing visuospatial orientation capacity in a subject including conducting an optic flow test on the subject, recording results of the test, and comparing the results of the test against a threshold for optic flow perception. The present invention also relates to a method for diagnosing visuospatial disorientation or assessing visuospatial orientation capacity in a subject including conducting an optic flow test on the subject, conducting at least one optic perception and interpretation test other than an optic flow test on the subject, recording results of the optic flow test and the at least one optic perception and interpretation test, making a first comparison of the results of the optic flow test against a threshold for optic flow perception, and making a second comparison of the results of the at least one optic perception and interpretation test against a threshold for the at least one optic perception and interpretation test. Another aspect of the present invention is a method for diagnosing visuospatial disorientation or assessing visuospatial orientation capacity in a subject including conducting an optic flow test on the subject, measuring brain wave responses to record an evoked potential in response to the optic flow test, and comparing the evoked potential against a threshold for optic flow perception. The present invention is also related to a method for enhancing visuospatial orientation capacity in a subject which includes presenting optic flow stimuli on a device to provide a sense of self-movement. | en | Methods for diagnosing visuospatial disorientation or assessing visuospatial orientation capacity | 5385952_US | 7937616_US,7937617_US | A61B 5/16,A61B 5/165,A61B 5/378,A61B 5/4023 | [
"A61B 5/0484",
"A61B 5/16"
] | 40,239 |
409,744,921 | 2012-09-14 | 48,903,352 | Y | Various embodiments of gaming systems, gaming devices, and methods of the present disclosure provide one or more alternative wagering propositions to a player when the player's credit balance is less than (or, in certain embodiments, less than or equal to) a designated wager amount. If the player accepts one of the alternative wager propositions, the player risks an amount of the player's remaining credit balance for a chance to win an alternative award. If the player wins the alternative award, the gaming system enables the player to play one or more plays of the wagering game at the designated wager amount. If the player does not win the alternative award, the gaming system reduces the player's credit balance by the amount risked. FIG. 4 /-100 Enable a player to place one or more wagers for one or more -1-102 plays of a wagering game Display a credit balance of the player 104 Is the No players credit balance less than a designated wager amount? Yes Display an alternative wager proposition that is separate from and in addition to any wagers that can be made on any plays of the wagering game, and enable the player to accept the alternative wager proposition, ~~1-108 wherein the alternative wager proposition, if accepted, requires the player to risk an amount of the player's credit balance Did No the player accept the alternative wager proposition? Yes No ~Should Y No an alternative award beYe provide? Reduce the player's Provide the alternative award credit balance by 116 such that the player is enabled the amount risked 114 - to play one or more plays of the wagering game at the designated wager amount | en | Gaming system, gaming device, and method providing one or more alternative wager propositions if a credit balance is less than a designated wager amount | 12474623_US | 46678112_,15079301_ | G07F 17/3209,G07F 17/3211,G07F 17/323,G07F 17/3244,G07F 17/3255,G07F 17/3262,G07F 17/3267,G07F 17/34 | [
"A63F 13/47"
] | 81,723 |
48,570,911 | 2002-07-15 | 26,891,990 | Y | A word game which is provided using a deck of cards and one or more dies. The cards comprise 26 alphabet cards each card containing a letter. A single die can be employed having a combination of numbers and right and left hand designations on each face thereof. In alternative embodiment, a pair of dice can be used, one containing numbers on respective faces and the other containing right and left designations on the die faces. The object of the word game is to think of words that contain the letter on the card, the letter being in the position within the word specified by the die. As an example if the card shows the letter A and the die shows 3R, the players must think of words in which A is the third letter from the right end of the word; for example, 'state'. In one scoring regime, one point is earned for each letter of the word. Thus in the above example the word 'state' earns 5 points. A higher scoring word would be 'invigorate' in which the letter A is in the third position from the right end, and, being a 10 letter word, earns 10 points. The game pieces can be housed in a multi-compartment box having a compartment for containing the cards, a separate compartment for pencils and one or more dies, and a portion of the box for containing score sheets and instructions. Scratch sheets or a scratch pad may also be included in the box. According to another aspect of the invention the game can be embodied as an electronic or computer game in which letters stored in memory are randomly presented upon user request and number position and left-right indication are also randomly presented upon user request. | en | Word game | 6787759_US | 6787760_US | A63F 3/0421,A63F 3/0423,A63F2001/0466,A63F2009/0486 | [
"A63F 9/04",
"A63F 3/04",
"A63F 1/04"
] | 37,409 |
16,635,607 | 1986-01-16 | 24,886,741 | Y | @ A gyroscope system includes a coherent light source that supplies counterpropagating waves to a sensing loop through a pair of directional couplers. The polarizations of the waves are controlled so that they traverse identical paths before recombining in one of the couplers to form an interference pattern. Rotation of the sensing loop, a phase modulator and a frequency shifter cause phase changes in the counter propagating waves. A detector monitors the interference pattern of the combined waves and provides a signal to the coherent demodulator that controls the phase modulator. The output of the coherent demodulator is input to a servo loop circuit that drives a voltage controlled oscillator. The output of the voltage controlled oscillator is an oscillatory signal having a frequency equal to the shift in frequency that the counter propagating waves experience in traversing the frequency shifter. The feedback circuitry adjusts the frequency shift to null the phase difference between the counterpropagating waves. The frequency shift is linearly related to the frequency of the signal output from the voltage controlled oscillator. Each cycle of the output of the voltage controlled oscillator corresponds to a fixed angular increment of displacement of the sensing loop. The rotation rate of the sensing loop is a function of the frequency shift and transit time of the waves through the sensing loop. The gyroscope system determines rotation rates and angular displacements over a wide dynamic range by measuring the frequency and zero crossings of the oscillatory output of the voltage controlled oscillator. | en | CLOSED LOOP ALL FIBER OPTIC GYROSCOPE WITH DIFFERENTIAL FREQUENCY PROPAGATION | 549222_US | 2453461_US | G01C 19/64,G01C 19/726 | [
"G01C 19/64",
"G01P 9/00",
"G01C 19/72",
"G02F 1/01",
"H01S 3/083"
] | 17,478 |
4,786,398 | 2002-12-24 | 32,507,788 | N | Neuromuscular monitoring, the monitoring of muscle relaxation, is as essential as controlling blood pressure or heart rate during surgery. A patient who is extubated when still partially relaxed is at great risk of respirator y complications. Also, a patient incompletely relaxed during surgery can endanger the success of surgery. Since muscle relaxants are the single most important cost factor in anesthetic drug selection, neuromuscular monitoring should help to titrate the exact dosing of muscle relaxants during surgery. Further application of neuromuscular monitoring are in intensive care whe re peripheral neuropathies with impaired muscle function play an essential role in morbidity of long term ventilation and repetitive and objective neuromuscular monitoring could help to control and monitor this problem. Unfortunately, despite these facts, knowledge about the action of muscl e relaxants is still quite limited and the tools to measure their function in daily routine are even more limited. In the ideal world, (a) we would be able to easily monitor neuromuscular function for all physiologically important muscles in a non-invasive and reliable way, (b) we would have a neuromuscular method and easy-to-use monitoring device giving precise and reliable information about the state of neuromuscular transmission at any given time during surgery, and finally (c) we would have established reliabl e data for any given muscle relaxant of onset, offset and peak effect for different muscles. Phonomyographic method and device for neuromuscular monitoring have been developed in view of reaching these objectives. | en | NEUROMUSCULAR MONITORING USING PHONOMYOGRAPHY | 16740027_CA,16740028_CA,12600857_CA,12493811_CA,16740025_CA,13535451_CA,16740026_CA | 16740027_CA,16740025_CA,13535451_CA,16740028_CA,12493811_CA,16740026_CA,12600857_CA | A61B 5/4821,A61B 5/7217,A61B 7/006,A61B2560/0443 | [
"A61N 1/08",
"A61B 7/00",
"A61B 8/00"
] | 7,672 |
39,987,465 | 2006-01-14 | 36,677,897 | N | A clustering method and apparatus using region division templates are provided. The method includes: dividing a photo into regions by using region division templates; modeling a semantic concept included in a divided region; when it is assumed that a measured value indicating the degree that the image of the region includes a semantic concept corresponding to the region is a confidence degree, merging the semantic concepts of respective regions with respect to the confidence degree of the local meaning measured from the modeling; modeling a global semantic concept included in the photo by using a final local semantic concept determined after the merging; and determining one or more categories included in the input photo according to the confidence degree of the global semantic concept measured from the modeling. According to the method and apparatus, in order to more reliably extract semantic concepts included in a photo, multiple content-based feature values are extracted from region images divided by using region division templates, and the confidence degree of an input image in relation to the local semantic concept defined by using the feature values is measured. With respect to the confidence degree, the local semantic concepts of the photo are merged and a more reliable local semantic concept is extracted. By using the merged local semantic concept, the confidence degree of a global semantic concept is measured, and according to the confidence, multiple category concepts included in the input photo are extracted. By doing so, photo data can be quickly and effectively used to generate an album. | en | METHOD AND APPARATUS FOR CATEGORY-BASED CLUSTERING USING PHOTOGRAPHIC REGION TEMPLATES OF DIGITAL PHOTO | 5213673_KR,32879095_KR | 16684859_KR,24592526_KR,24072734_KR,32879096_KR,32598793_KR | G06V 10/50,G06V 20/10 | [
"G06T 7/00"
] | 26,233 |
40,369,625 | 2000-09-23 | 7,923,266 | Y | PURPOSE: A method for color-displaying is provided to display color distribution by a colorimetric system, while taking adaptive color deviation of human eyes into account. CONSTITUTION: A reproduction medium displays one color under the control of the reproduction medium by using an output value, a monochrome locus of the color in the reproduction medium is measured and the measured value is stored, the processing step above is repeated by each output up to all the areas of the reproduction medium to store measured value pairs of the monochrome loci, the measured value pairs are converted into a color system, a white point of the reproduction medium is decided under a conversion origin, the converted value pair is stored in a calibration data-set, one converted value pair is assigned uniquely to each output value, the measured value of the luminous intensity distribution to be reproduced is converted into the color system used for the calibration of the reproduction medium, the proper conversion origin is selected by taking the adaptive color deviation of human eyes into account in a way such that the chromatic color visually perceived in the luminous intensity distribution to be reproduced is displayed as an achromatic color even by the reproduction medium, an output value (k) corresponding to each converted measured value pair in the luminous intensity distribution to be reproduced is selected from the calibration data-set for the reproduction medium and the luminous intensity distribution is displayed, by controlling the reproduction medium by using all output values obtained in the steps above. | en | METHOD AND APPARATUS FOR THE COLOR FIDELITY DISPLAY OF A COLORMETRICALLY MEASURED LIGHT DISTRIBUTION | 10226110_ | 72532890_,72730968_,73649300_,72619058_ | G01J 3/462,G01J 3/463,G01J 3/465,G01J 3/50,H04N 17/00 | [
"G01J 3/50",
"H04N 17/04",
"G01J 3/46",
"G01J 3/02",
"H04N 17/00"
] | 26,285 |
548,784,663 | 2020-07-30 | 75,116,315 | N | A speech breakpoint detection method, apparatus and device based on artificial intelligence. The method comprises: acquiring a query sentence input by a user (201); performing sentence recognition on the query sentence, and obtaining at least one candidate result of the query sentence and a probability corresponding to each candidate result (202); performing, through a pretrained semantic completeness model, semantic completeness detection on candidate results with a probability higher than a predetermined threshold (203); after it is determined that the candidate results with a probability higher than the predetermined threshold are semantically complete, performing natural language understanding on the candidate results with a probability higher than the predetermined threshold, and obtaining intentions corresponding to the candidate results with a probability higher than the predetermined threshold (204); and obtaining a response corresponding to the query sentence according to the candidate results with a probability higher than the predetermined threshold and the corresponding intentions (205). On the basis of a traditional acoustic model, the semantic completeness model is used for querying the query sentence input by the user, and whether the speech of the user ends is dynamically determined on the basis of the semantic completeness, so that the real intention of the user can be recognized more accurately, and whether the speech of the user ends can be accurately determined in scenarios such as repetitive speech and prolonged sound of the user, and thus, the user experience can be improved. | en | SPEECH BREAKPOINT DETECTION METHOD, APPARATUS AND DEVICE BASED ON ARTIFICIAL INTELLIGENCE | 63625819_CN | 81423435_CN,66833830_CN,80676944_CN,68575625_CN,64524840_CN,68619713_CN,80688331_CN | G06F 16/63,G10L 15/04,G10L 15/06,G10L 15/063,G10L 15/08,G10L 15/18,G10L 15/1815,G10L 15/183,G10L 15/22,G10L 15/26 | [
"G10L 15/22",
"G10L 15/183",
"G06F 16/63"
] | 151,978 |
378,589,044 | 2012-05-21 | 47,217,514 | N | In an embodiment a system for facilitating a subject's functional development includes sensing devices configured for sensing mind state signals; sensing devices configured for sensing body state signals; and a set of processing resources configured for generating a mind state indicator / measure, a body state indicator / measure, and a mind - body synergy indicator / measure that corresponds to an expected extent to which each of the subject's mind state and the subject's body state are cooperatively or synergistically aligned with respect to facilitating the subject's functional development. In an embodiment, the system can be configured for concurrently presenting a set of activities involving a model body part; engaging the subject in attempted imitation of the set of activities by way of attempted movement of a subject body part that is a mirror image of the model body part; presenting an indication of an expected extent to which each of the subject's mind state and body state are cooperative with respect to subject performance of the set of activities; and presenting an indication of an extent of subject relaxation. An associated multiple (e.g., up to 12) degree of freedom robotic orthosis can include a set of appendage motion modules configured for engaging with a portion of a subject appendage; a set of mechanical power interface modules coupled to the set of appendage motion modules and configured for facilitating movement of appendage motion modules within the set of appendage motion modules; and a set of flexible drive shafts couplable to the set of mechanical power interface modules. | en | SYSTEMS, APPARATUSES, DEVICES, AND PROCESSES FOR SYNERGISTIC NEURO-PHYSIOLOGICAL REHABILITATION AND/OR FUNCTIONAL DEVELOPMENT | 44162800_SG,44162801_SG,6157434_SG | 44162801_SG,44162800_SG | A61B 5/1107,A61B 5/1125,A61B 5/162,A61B 5/165,A61B 5/224,A61B 5/291,A61B 5/374,A61B 5/375,A61B 5/389,A61B 5/743,A61B 5/7445,A61B 5/7475,A61B2505/09,A61H 99/00,A61M 21/02,A61N 1/36003,A63B 21/00181,A63B 21/4017,A63B 21/4019,A63B 21/4035,A63B 21/4045,A63B 23/1209,A63B 23/14,A63B 24/0059,A63B 24/0062,A63B 71/0622,A63B2022/0094,A63B2024/0065,A63B2024/0068,A63B2024/0096,A63B2071/0647,A63B2071/0655,A63B2213/004,A63B2225/20,A63B2225/50,A63B2230/06,A63B2230/08,A63B2230/10,A63B2230/207,A63B2230/30,A63B2230/42,A63B2230/60,G06F 3/014,G06F 3/015,G09B 19/003,G16H 20/30,G16H 20/70,G16H 40/67,G16H 50/30 | [
"A63B 23/00",
"A61N 1/36",
"A61B 5/375",
"A61B 5/374"
] | 77,059 |
17,003,927 | 1993-06-23 | 25,418,821 | Y | A spinning strip aperture imaging radiometer sensor system and data processing method that is capable of synthesizing full circular aperture images from a plurality of image frames acquired by the strip aperture imaging sensor. One embodiment of the imaging system comprises a rotating strip aperture wide field of view telescope, a two dimensional detector array used to detect images in the telescope's focal plane, a rotation compensation device used to prevent rotational smear during the integration time of the detectors, a signal processor used to record a plurality of image frames of a target scene that is imaged by the telescope as it rotates around its optical axis, and a signal processor and method used to synthesize the full circular aperture image from the recorded images. The operation of the full aperture image synthesis method hinges upon the ability of the rotating strip aperture to measure all of the spatial frequencies contained in a full circular aperture image measurement. Having knowledge of the strip apertures' spatial frequency passband, and the temporal registrations of each of the recorded strip aperture images permits synthesis of the full aperture image by the sensor system and image synthesis method. Image synthesis may be accomplished in the spatial or spatial frequency domains. General and illustrative examples of the image synthesis procedure and first order noise performance predictions are described. A general form of the invention utilizes two dimensional spatial frequency informtion to greatly reduce the line of sight stability requirements of the telescope. <IMAGE> | en | Full aperture image synthesis using rotating strip aperture image measurements | 562035_US | 3109234_US,3256721_US | G01K 11/006,G01S 3/7865,G01S 17/90 | [
"G06T 5/20",
"G01S 17/89",
"G01R 29/08",
"G01K 11/00",
"G01S 3/786",
"G06T 1/00",
"G02B 26/00",
"G02B 23/00",
"G01S 17/00"
] | 18,353 |
16,817,008 | 1990-07-11 | 23,561,769 | N | A computer method is disclosed for determining predicate-argument structures in input prose sentences of English. The input sentence, in the form of a string of words separated by blanks, is first analyzed (parsed) by a rule component that has access only to morphological and syntactic information about the words. The output of this rule component, in the form of a data structure consisting of attribute-value pairs, is then processed by the argument-structure component, which consists of a set of partially ordered procedures that incorporate further linguistic knowledge. The output of these procedures is the same attribute-value structure, now enhanced by the presence of semantic (i.e., meaningful, non-syntactic) attributes. These semantic attributes, taken together, form the argument structure of the input sentence. The resulting invention constitutes a fully modular, comprehensive and efficient method for passing from syntax to the first stage of semantic processing of natural (human) language. The invention applies to all prose sentences of the language for which it is designed, and not just to a subset of those sentences. It does not use domain-specific semantic information to improve the accuracy or efficiency of the syntactic component. It therefore constitutes an unrestricted broad-coverage method for natural language processing (NLP), as opposed to the restricted methods used in most NLP applications today. Although the specific rules and procedures will be different for different natural languages, the general concept embodied in this invention is applicable to all natural languages. | en | A COMPUTER METHOD FOR IDENTIFYING PREDICATE-ARGUMENT STRUCTURES IN NATURAL LANGUAGE TEXT | 11589_US | 2891057_US | G06F 40/211,G06F 40/253,G06F 40/268,G06F 40/30 | [
"G06F 17/28",
"G06F 17/27"
] | 17,888 |
4,326,079 | 2002-11-06 | 23,292,253 | N | A servo controlled system is disclosed for providing simulated feel equivalent to that of traditional mechanical hand controllers using servomotors. Position and force sensor signals are processed and used in a feedback loop that controls the motor mechanically connected to the stick. The overall feedback loop is comprised of a low-level motor feedback loop, and high-level force feel loop. The two loops have associated performance parameters that can be specified independently. The high-level feel force loop is comprised of a static and dynamic performance components. Static and dynamic performance components can be specified independently. The system allows variable and/or additional force cues to be specified externally to the system and felt by the operator. The system also allows external signal to backdrive the stick to follow a specified motion. The control framework permits the electronic coupling of the motion and applied forces of pilot and co-pilots in a dual arrangement while retaining the above-mentioned features. It also allows asymmetric force feel gradients to be implemented for each stick, or for a stick relative to a second one. A zero breakout or detent can be provided at the stick null displacement. For cross-coupled sticks, the detent can be shared as in a mechanically cross-coupled system, implemented independently on each stick, or any combination of these two. The control framework also provides the simulation of mechanical compliance in the cross-coupling of the two sticks in case of a jam or of force fight between the pilots, and automatic de-coupling of the sticks. | en | APPARATUS FOR CONTROLLING A JOYSTICK HAVING FORCE-FEEDBACK | 6233957_CA,16247137_CA,16247138_CA | 16247138_CA,16247137_CA | B64C 13/0421,B64C 13/503 | [
"B64C 13/10",
"B64C 13/12",
"B64C 13/46",
"B64C 13/04",
"B64C 13/50"
] | 4,030 |
524,039,871 | 2017-12-22 | 57,681,420 | N | The present invention provides a visible light communication transmitter (13), a visible light communication receiver (14), a visible light communication system (2), and a method of visible light communication, wherein the transmitter, the receiver, the system and the method are suitable for colour shift keying (CSK), as well as providing a method of colour shift keying. The visible light communication transmitter (13) comprises at least six, preferably seven, and more preferably eight, graphene-based light emitting devices (LED-1, LED-2,... LED-8) of different peak transmission wavelengths from each other. The visible light communication receiver (14) comprises a corresponding number of graphene-based photodetectors (PD-1, PD-2,... PD-8) of different peak reception wavelengths from each other. A visible light communication system according to the invention comprises such a transmitter and such a receiver, wherein each respective one of the different peak reception wavelengths of the six graphene-based photodetectors corresponds to a respective one of the different peak transmission wavelengths of the graphene-based light emitting devices. Such a system allows a method of visible light communication, preferably using colour shift keying, with a colour constellation of at least six, maybe seven, or even eight base colours. These can provide an increased number of symbols, a reduced symbol error rate and an improved signal-to-noise ratio in comparison to traditional visible light communication systems for colour shift keying, which use a colour constellation of only three orfour base colours. | en | VISIBLE LIGHT COMMUNICATION USING COLOUR SHIFT KEYING | 73295825_,75984447_ | 75541184_,72878440_ | H01L 25/0753,H04B 10/116,H04B 10/501,H04B 10/502,H04B 10/572,H04B 10/67,H04B 10/69 | [
"H01L 33/00",
"H01L 31/00"
] | 135,320 |
378,077,153 | 2011-05-26 | 46,795,113 | N | PURPOSE: A stereoscopic image visual effect processing method is provided to enhance a visual effect and to improving interaction of man-machine. CONSTITUTION: A stereoscopic image is provided(S11). A cursor with a cursor coordinate value is provided(S12). The corresponding depth coordinate parameters of target object coordinate values of a plurality of target objects are changed when the cursor coordinate value is overlapped with anything among the target object coordinate values of the target objects(S13,S14). The image of the target object corresponding to the cursor coordinate value is re-imaged(S15). [Reference numerals] (AA) Yes; (BB) No; (S11) Providing a stereoscopic image composed of a plurality of target objects each having one target object coordinate value; (S12) Providing a cursor having a cursor coordinate value; (S13) Determining which one of target object coordinate values of the target objects is overlapped with the cursor coordinate value; (S14) Changing depth coordinate parameters of the target object coordinate values of the target objects in case that the cursor coordinate overlaps with one of the target objects coordinate values of the target objects; (S15) Re-imaging the target object corresponding to the cursor coordinate; (S16 ) Redetermining which one of target object coordinate values of the target objects is overlapped with the cursor coordinate value in case of changing the cursor coordinate value; (S17 ) Redetermining which one of target object coordinate values of the target objects is overlapped with the cursor coordinate value after each predetermined time | en | 3D IMAGE VISUAL EFFECT PROCESSING METHOD | 36867140_TW | 44119070_TW,40946523_TW | G06F 3/04812,G06T 15/00,G06T 17/00,G06T 19/00 | [
"G06T 17/00",
"G06T 15/00"
] | 76,793 |
511,548,653 | 2018-09-21 | 66,164,314 | N | The present invention relates to a composition for improving cognitive functions, comprising somatostatin or cortistatin as an effective component and, more specifically, to a composition for improving cognitive functions, which activates somatostatin receptors to improve visual perception skills. Also, the present invention relates to a composition for preventing or treating cognitive disorders, comprising somatostatin or cortistatin as an effective component. According to the present invention, somatostatin or cortistatin may be used to directly activate the somatostatin receptors to reduce excitatory synaptic transmission to inhibitory neurons expressing parvalbumin genes and to improve selective reactivity to visual information within a cortical circuit. Also, the somatostatin of the present invention and its biological peptide analogue can maintain their structures stably, and unlike artificially produced peptides, show non toxicity, and thus can be safely implanted in a living body. Also, the present invention may find a direct application in the restoration of cognitive functions through inducing the activation of somatostatin receptors by implanting somatostatin or its neuropeptide analogue directly into the brain or cerebrospinal fluid of a patient with damaged brain cognitive functions. Furthermore, the present invention may be beneficially used in the development and in vivo applications of biological peptide analogue compounds and artificial peptide compounds for the purpose of improving signal transduction through the activation of somatostatin receptors in cortical neurons. | en | Enhancement or Impairment of Cognitive Brain Function via Regulation of the Somatostatin Receptors in the Brain | 68128238_KR | 71570017_,59292289_,70325633_ | A61K 38/31 | [
"A61K 38/31"
] | 127,069 |
441,055,225 | 2014-12-05 | 53,270,808 | Y | An optical coherence tomography (OCT) system including a source of broadband optical radiation and a beamsplitter coupled to the source is provided. The beamsplitter divides the source radiation into a reference path and a sample path. The reference path includes an optical switch to switch the reference path between a first path having a first reference reflector at a first reference optical path length and a second path having a second reference reflector at a second reference optical path length, different from the first reference optical path length. The system further includes a beam combiner that mixes source radiation reflected from a subject in the sample path with source radiation returned from the first reference reflector during a first time interval and the second reference reflector during a second time interval. A detection system detects a first wavelength dependent interferogram during the first time interval and a second wavelength dependent interferogram during the second time interval. A processor preconditions the first and second wavelength dependent interferograms; multiples the first preconditioned wavelength dependent interferogram and the second preconditioned wavelength dependent interferogram; and computes a first A-scan from the first wavelength dependent interferogram; a second A-scan from the second wavelength dependent interferogram; a spatial offset between the first and second A-scans derived from the multiplicative product of the preconditioned first and second wavelength dependent interferograms; and a combined A-scan from the first and second A-scans. | en | Image registration, averaging, and compounding for high speed extended depth optical coherence tomography | 12422002_US | 7237656_US,7974320_US,10584636_US,49984023_US,12422003_US,5409064_US,50062296_US | A61B 3/102,G01B 9/02004,G01B 9/02028,G01B 9/02044,G01B 9/02087,G01B 9/02091 | [
"A61B 3/10",
"G01B 9/02"
] | 93,870 |
324,156,831 | 2010-06-01 | 43,033,076 | N | A system for scoring a singing voice comprises a receiving means (1) for receiving a singing reference audio signal and/or a user audio signal and/or a pitch contour representation (PCR) of the reference and/or user singing audio signals; a processor means (2) connected to the receiving means (1) and comprising a pitch contour representation (PCR) module (10) for determining a PCR of the singing reference and/or user audio signal, a time synchronization module (11) for time synchronizing the PCRs of the reference and user audio signals respectively, a selection module (12) for selecting a segment of the PCRs of the reference and user audio signals based on pre-defined criteria, a cross-correlation module (13) for performing time-warped cross-correlation on the selected segments of the PCRs of the reference and user audio signals and outputting a cross-correlation score, a key matching module (14) and rhythm matching module (15) for key matching and rhythm matching the remaining unselected segments of the PCRs of the reference and user audio signals respectively and outputting a respective key matching score and rhythm matching score, a scoring module (16) for determining a singing score based on a combination of a pre-determined weightage of the cross- correlation, key matching and rhythm matching scores; a user interface means connected to the processor means for changing at least one module parameter within at least one module; a storing means (4) connected to the processor means (2) and a display means (5) connected to the processor means (2) for displaying the PCR and singing score. | en | A SYSTEM AND METHOD FOR SCORING A SINGING VOICE | 41985878_IN,14940191_,41985877_IN,29791625_IN | 41985878_IN,29791625_IN,41985877_IN | G10H 1/363,G10H2210/066,G10H2210/076,G10H2210/091 | [
"G10H 1/36"
] | 64,287 |
49,182,406 | 1999-03-17 | 27,574,284 | Y | A networked system for remotely assessing and monitoring psychological conditions. The system includes a server and a remote interface for entering in the server prompts, such as queries and instructions, to be responded to by the individual. The server is preferably a web server and the remote clinician interface is preferably a personal computer connected to the server via the Internet. The system also includes a remotely programmable patient apparatus connected to the server via a communication link, preferably the Internet. The patient apparatus interacts with the individual in accordance with a script received from the server. The server includes a script generator for generating the script from the set of prompts entered through the remote interface. The script is received and executed by the patient apparatus to communicate the prompts to the individual, to receive responses to the prompts, and to transmit the responses from the patient apparatus to the server. In accordance with the invention, the patient apparatus is programmed to prompt a patient to interactively operate one or more switches. Information recorded during an interactive diagnostic assessment procedure is analyzed to provide a health care professional with information that is helpful to determine whether clinical therapy and/or medication may be required. The preferred embodiment of the invention relates to diagnostic assessment of Attention Deficit Hyperactivity Disorder and Attention Deficit Disorder with a game-like video display being used to obtain a measure of various neuropsychologic indicia of attention. | en | Remote psychological diagnosis and monitoring system | 6496710_US | 6554250_US | A61B 5/0022,A61B 5/0205,A61B 5/087,A61B 5/14532,A61B 5/6896,A61B2560/0443,G16H 10/20,G16H 15/00,G16H 20/70,G16H 40/63,G16H 40/67,G16H 50/20 | [
"G06F 19/00",
"A61B 5/0205",
"A61B 5/087",
"A61B 5/00"
] | 38,345 |
534,918,882 | 2019-11-27 | 71,613,218 | N | The present invention relates to an algorithm for automatic fundus image reading, and to a deep learning architecture for automatic fundus image reading, capable of minimizing the amount of data required for learning by training and reading artificial intelligence in a manner similar to that of an ophthalmologist acquiring medical knowledge. The deep learning architecture system for automatic fundus image reading, according to the present invention, comprises: a trunk module (100) in which common parts are combined into one in a plurality of convolutional neural network (CNN) architectures having at least one serially arranged set of feature extraction layers composed of a plurality of convolution layers that perform fundus image feature extraction and one pooling layer that performs subsampling for reducing computation amount; a plurality of branch modules (200), which generates each architecture in the trunk module (100) so as to receive an output of the trunk module (100), thereby identifying a lesion in the fundus image and diagnosing a corresponding disease name therefor; a section (110), which is an architecture in which any one branch module (200) from among the plurality of branch modules (200) is connected to the trunk module (100); a root layer (120) for connecting the trunk module (100) and the branch module (200) by transmitting the output of a specific layer of the trunk module (100) to the branch module (200); and a final decision unit (300), which integrates diagnosis data from the plurality of branch modules (200) so as to determine and output a final disease name. | en | DEEP LEARNING ARCHITECTURE SYSTEM FOR AUTOMATIC FUNDUS IMAGE READING AND AUTOMATIC FUNDUS IMAGE READING METHOD USING DEEP LEARNING ARCHITECTURE SYSTEM | 73418774_KR | 64727280_KR,64201491_KR | A61B 3/0025,A61B 3/12,A61B 3/14,A61B 5/00,G06T 7/0012,G06T2207/20081,G06T2207/20084,G06T2207/30041,G06T2207/30096,G06T2207/30168,G06V 10/40,G06V 10/764,G06V 10/774,G06V 10/776,G06V 10/82,G06V 10/993,G06V2201/03,G16H 30/40,G16H 50/20 | [
"A61B 5/00",
"G16H 30/40",
"A61B 3/14",
"G16H 50/20"
] | 142,694 |
4,953,305 | 2005-04-23 | 34,968,978 | Y | The invention relates to a device for treating patients by brain stimulation, an electronic component and a use of the device and of the electronic component in medicine. According to the prior art, brain electrodes are used for continuous stimulation for treating patients. In this connection it is particularly disadvantageous that the continuous high-frequency stimulation, as an unphysiological, that is to say unnatural input in the area of the brain, for example of the thalamus or of the basal ganglia, can lead to the adaptation of the nerve cell populations affected in the course of a few years. To achieve the same stimulation result, stimulation with higher stimulus amplitude must then be used due to this adaptation. According to the invention, these disadvantages are eliminated by providing a device which comprises: at least one electrode capable of stimulating a brain region in which pathologically synchronous neuronal activity is present; at least one sensor to measure an electrical signal; and control means for detecting the occurrence of a pathological feature of the electrical signal which was measured by the at least one sensor and, when the pathological feature occurs, is capable of delivering to the at least one electrode a first short high--frequency pulse train to control dynamics of neurons of a stimulated neuron population, followed by a second short high-frequency pulse train to desynchronize the neurons of the stimulated neuron population, wherein the first short high-frequency pulse train has a higher amplitude than the second short high-frequency pulse train. | en | DEVICE FOR TREATING PATIENTS BY BRAIN STIMULATION, ELECTRONIC COMPONENT AND USE OF THE DEVICE AND ELECTRONIC COMPONENT IN MEDICINE AND MEDICAL TREATMENT METHOD | 8195185_DE | 12499544_DE | A61N 1/36067,A61N 1/36082 | [
"A61N 1/36"
] | 9,548 |
468,645,045 | 2016-08-18 | 54,258,843 | N | A computer-implemented apparatus for predicting an effect of a proposed surgical strategy for treatment of epilepsy and/or epileptic seizures, the apparatus comprising: a device configured to generate a brain network model representative of brain data, wherein nodes in the network model correspond to brain regions of said brain data and connections between the nodes of the network model correspond to structural and/or functional connections between the brain regions; a device configured to generate synthetic brain activity data in at least some of the nodes of the network model; a device configured to compute a representative brain network ictogenicity (BNI) value from the synthetic brain activity data, wherein said BNI value is representative of a probability of said brain network to generate seizures; a device configured to, repeatedly: a) simulate or effect a surgical strategy comprising removal of at least one node and/or edge from said brain network and subsequently recalculate said BNI value thereof; and b) calculate a value ΔΒΝΙ representative of a magnitude of change in BNI following removal of said at least one node/edge from said brain network, wherein said ΔΒΝΙ value is indicative of an effectiveness of removal of said at least one node/edge from said brain network in reducing said probability of said brain network to generate seizures; thereby to output multiple ΔΒΝΙ values, or data representative thereof, corresponding to respective multiple proposed surgical strategies, each comprising removal of respective nodes/edges or sets of nodes/edges from said brain network. | en | COMPUTER-IMPLEMENTED APPARATUS AND METHOD FOR PREDICTING PERFORMANCE OF SURGICAL STRATEGIES | 54189521_GB | 55605775_GB,55403106_GB | A61B 5/4094,G06N 3/10,G16H 20/40,G16H 50/20,G16H 50/50 | [
"G06F 19/00"
] | 103,356 |
538,471,302 | 2020-09-29 | 68,104,514 | N | The present invention relates to the field of disease tracking and potentially even diagnostics. Specifically, it relates to a method for predicting the total motor score (TMS) in a subject suffering from Huntington's Disease (HD) comprising the steps of determining at least one performance parameter from a dataset of measurements of central motor function capabilities from said subject, comparing the determined at least one performance parameter to a reference obtained from a computer-implemented regression model generated on training data, in an embodiment using partial least-squares (PLS) analysis, with the at least one performance parameters, and predicting the TMS of the subject based on said comparison. The present invention also relates to a mobile device comprising a processor, at least one sensor and a database as well as software which is tangibly embedded to said device and, when running on said device, carries out the method of the invention as well as a system comprising a mobile device comprising at least one sensor and a remote device comprising a processor and a database as well as software which is tangibly embedded to said device and, when running on said device, carries out the method of the invention, wherein said mobile device and said remote device are operatively linked to each other. Furthermore, the invention contemplates the use of the aforementioned mobile device or system for predicting the TMS in a subject suffering from HD using at least one performance parameter from a dataset of measurements of central motor function capabilities from said subject. | en | MEANS AND METHODS FOR ASSESSING HUNTINGTON´S DISEASE (HD) | 7641906_CH,5316242_US | 80666216_CH,74094649_CH,57612364_CH | G16H 50/20,G16H 50/30 | [
"G16H 50/30",
"G16H 50/20"
] | 145,153 |
471,444,983 | 2016-05-10 | 57,248,066 | Y | The purpose of the present invention is to provide a robot behavior generation method that more accurately reproduces human behavior. To accomplish this purpose, there is provided a robot behavior generation method for the purpose of reproducing human behavior with a robot, wherein the robot behavior generation method has: a step S1 for generating a human body model by modeling the configuration of the human body; a step S2 for generating a robot model by modeling a configuration of a robot; a step S3 for creating associations between the human body model generated in step S1 and the robot model generated in step S2; a step S4 for acquiring first motion data indicating movement of a human body model corresponding to behavior of the human body; a step S5 for selectively choosing movement feature indices having first unknown motion data that indicates movement of the human body model generated in step S1, and setting an evaluation standard for a reproduction error with respect to the normative motion data acquired in step S4; a step S6 for selecting a constraint condition necessary for the purpose of movement by a robot included in second unknown motion data that indicates the movement of the robot model generated in step S2; a step S7 for calculating first unknown motion data and second unknown motion data the reproduction errors of which based on the evaluation standard of step S5 are minimum under the association obtained in step S3 and the constraint condition selected in step S6; and a step S8 for using the second unknown motion data calculated in step S7 to control the robot. | en | ROBOT BEHAVIOR GENERATION METHOD | 49725700_JP | 56648525_JP,56775215_JP | B25J 9/1605,B25J 9/1664,B25J 9/1671,B25J 9/1697,G05B2219/39254 | [
"B25J 9/16"
] | 104,903 |
340,249,325 | 2007-07-17 | 38,859,132 | N | Disclosed are 4-indol substituted 1-aminocyclohexane derivatives as represented by the general formula (I), wherein A represents N or CR7-10, wherein A represents N at most twice; W represents O, S or NR4 with the proviso that if W represents O or S, A denotes CR7-10; one of the radicals B or C represents H or optionally substituted alkyl; and the other radical B or C represents a 4-amino-4-(alkyl/phenyl or heteroaryl)-cyclohexyl derivative; and wherein the remaining substituents are as defined herein. Also disclosed are compounds such as 2-(4-(dimethylamino)-4-phenylcyclohex-1-enyl)-3-benzyl-1H-indole hydrochloride and 1-butyl-4-(5-fluoro-3-(2-(piperidin-1-yl)ethyl)-1H-indol-2-yl)-N,N-dimethyl-cyclohexanamine citrate. Further disclosed is a medicament which contains at least one compound as defined above, optionally in the form of a racemate, of pure stereoisomers, in the form of an acid or of a base or in the form of a salt, or in the form of a solvate, and optionally containing one or more additives and/or one or more auxiliary substances and/or one or more optionally further active compounds for the treatment of conditions such as stress, depression, epilepsy, Alzheimer's disease, senile dementia, catalepsy, general cognitive dysfunctions, learning and memory disorders, withdrawal symptoms, alcohol and/or drug and/or medicament abuse and/or dependency, sexual dysfunctions, cardiovascular diseases, hypotension, hypertension, tinnitus, pruritus, migraine, impaired hearing, lack of intestinal motility, impaired food intake, anorexia, obesity, locomotor disorders, diarrhoea etc. | en | 4-INDOL-SUBSTITUTED 1-AMINOCYCLOHEXANE-1- AND CYCLOHEXENE-1-DERIVATIVES HAVING EFFECTS ON THE OPIOD RECEPTOR SYSTEM | 12680714_ | 15081771_,40515866_,15081769_,15016541_,15081774_,25603585_,15949954_,40515867_,40515868_ | A61K 31/404,A61P 1/00,A61P 1/04,A61P 1/12,A61P 1/14,A61P 3/04,A61P 7/00,A61P 9/00,A61P 9/02,A61P 9/12,A61P 13/02,A61P 13/10,A61P 15/10,A61P 17/04,A61P 23/00,A61P 25/00,A61P 25/02,A61P 25/06,A61P 25/08,A61P 25/14,A61P 25/18,A61P 25/22,A61P 25/24,A61P 25/28,A61P 25/30,A61P 25/32,A61P 25/36,A61P 27/16,A61P 29/00,A61P 31/02,A61P 43/00,C07D 209/14,C07D 257/10,C07D 257/12,C07D 307/81,C07D 333/58,C07D 401/04,C07D 401/06,C07D 401/12,C07D 401/14,C07D 403/06,C07D 403/08,C07D 405/06,C07D 409/08,C07D 409/12,C07D 409/14,C07D 471/04 | [
"C07D 209/20",
"C07D 401/12",
"A61K 31/4439",
"C07D 409/08",
"C07D 209/14",
"C07D 471/04",
"C07D 409/12",
"A61K 31/4184",
"C07D 401/06",
"C07D 307/81",
"A61K 31/4178",
"C07D 401/04",
"A61K 31/404",
"C07D 403/06",
"C07D 333/58"
] | 71,337 |
415,386,408 | 2013-06-26 | 50,138,780 | Y | A disclosed technique relates to an interface capable of registering a context of interest (COI) in an augmented reality environment and, more specifically, to an augmented reality interface technique capable of specifying various types of objects of interest in the real space varied dynamically and adding and intuitively presenting virtual guidance/information associated therewith without physical constraints. The interface according to an embodiment of the disclosed technique can overcome the constraints of an augmented reality marker learned and defined previously to register a three-dimensional object of interest in an augmented reality space according to an immediate situation and can also provide an information representing technique in which augmented guide information provided when registering a three-dimensional object of interest varied dynamically according to work steps. [Reference numerals] (AA) COI capturing; (BB) Grouping(I); (C) Integrated context(Env. & User); (CC) COI area; (DD) Non-COI area; (EE) Type(Si); (FF) Content(Si); (GG) User intent; (HH) User data; (I) Key frame image; (i,j) Index; (II) Scenes(FOV); (JJ) Environmental data; (KK) Contextual information manager; (LL) Space management; (MM) Visualization management; (NN) Contextual visualization manager; (OO) Step(S_i-1, C_j-1); (PP) Step(S_i-, C_j); (QQ) Workflow; (RR) Exception(Breakdowns) overcome; (S) Step in workflow; (SS) Intent-User observation; (TT) Exception-Unintented act recognition; (UU) Act analysis-dissatisfaction element extraction; (VV) Combine-Context(Cj) update; (WW) Step(S_i+1, C_j+1) | en | AREAL-TIME COI REGISTRATION SYSTEM AND THE METHOD BASED ON AUGMENTED REALITY | 5220563_KR | 12639238_KR,41603511_KR | G06T 17/00,G06V 10/40 | [
"G06T 17/00",
"G06K 9/46"
] | 84,945 |
57,940,597 | 2007-05-21 | 38,697,108 | Y | A fiber optic gyroscope using a low degree of polarization and polarization-maintaining light path comprises an optical meter head and a circuit signal processing part, The optical meter head comprises: a light source, a phase modulator on basis of the Y-branching optical waveguide, a detector, a coupler and an optical fiber coil, wherein the light source is alight source with low degree of polarization and single mode fiber pigtail coupling; the input terminal of phase modulator on basis of the Y-branching optical waveguide uses a single mode fiber, and the output terminal of phase modulator on basis of the Y-branching optical waveguide adopts a polarization-maintaining fiber; the input fiber pigtail of the said detector is a single mode fiber; the coupler is a 2×2 polarization independence single mode fiber coupler; the optical fiber coil is a polarization-maintaining fiber. By adopting the scheme of the low degree of polarization and polarization-maintaining light path and the signal processing methods such as all-digital closed loop control and random overmodulation etc., the present invention can reduce the effect of light path polarization crosstalk, simplify the assembling technology, enable large scale production and guarantee the good scale factor linearity performance and the lower noise level. Furthermore, by temperature modeling and compensating, the invention enables the bias of the fiber optic gyroscope to drift more slightly within the all-temperature range and therefore the fiber optic gyroscope with good performance and engineering application can be achieved. | en | OPTICAL FIBER GYROSCOPE WITH COMBINATION OF LOW POLARIZATION OPTICAL PATH AND POLARIZATION MAINTAINING OPTICAL PATH | 67172631_CN | 63959003_CN,63962186_CN,63920732_CN,64015239_CN,69068668_CN | G01C 19/722 | [
"G01C 19/72",
"G01C 19/64"
] | 56,920 |
42,815,179 | 2001-07-02 | 22,804,919 | Y | FIELD: medicine, immunology, pharmacy. ^ SUBSTANCE: invention relates to methods for treatment of autoimmune, rheumatic diseases, immune disorders associated with rejection of transplant and involves administration to patient mutant molecules of a soluble CTLA4. These molecules can be administrated in common or successively with the second agent that is chosen from the group consisting of corticosteroid, nonsteroid anti-inflammatory agent, azathioprine, methotrexate, blocker or antagonist of TNFalpha, hydroxychlorokin, sulfasalazin, gold salt, anakinra, cyclophosphamide and leflunomide. CTLA4 molecule represented in Fig. 23 given in the invention description comprises mutation in position +104 CTLA4 wherein leucine is substituted with glutamic acid, and mutation in position +29 CTLA4 wherein alanine is substituted with tyrosine. CTLA4 molecule can comprise an extracellular domain and involves a sequence shown in Fig. 19 given in the invention description beginning from methionine in position +1 or from alanine in position -1 and terminating by aspartic acid in position +124. CTLA4 molecule can represent L104EA29YIg beginning from methionine in position +1 or from alanine in position -1 and terminating by lysine in position +357 as shown in Fig. 19. Invention provides blocking the immune interaction between T- and B-cells and prevention of activation of B-cells based on binding B7 molecule by using indicated CTLA4 molecule wherein mutations in its molecule result to positive changes in avidity binding with B7. ^ EFFECT: improved method of treatment. ^ 31 cl, 3 tbl, 33 dwg, 4 ex | en | METHODS FOR TREATMENT OF RHEUMATIC DISEASES BY USING SOLUBLE CTLA4 | 34551101_US | 64782639_US,68315773_US,67207221_US,65663372_US,65787153_US | A61K 38/00,A61K 38/13,A61K 38/16,A61K 38/17,A61K 38/1793,A61K 38/20,A61K 45/06,A61P 1/04,A61P 1/16,A61P 3/10,A61P 7/00,A61P 7/04,A61P 7/06,A61P 17/00,A61P 17/02,A61P 17/06,A61P 19/00,A61P 19/02,A61P 19/04,A61P 21/02,A61P 21/04,A61P 25/04,A61P 25/28,A61P 27/02,A61P 29/00,A61P 35/00,A61P 35/02,A61P 37/00,A61P 37/02,A61P 37/04,A61P 37/06,A61P 43/00,C07K 14/70521,C07K2319/00 | [
"C07K",
"A61P 25/04",
"A61K 38/16",
"A61P 19/02",
"C12N 15/09",
"G01N 33/53",
"A61P 37/00",
"A61P 21/04",
"A61P 21/02",
"A61P 17/06",
"A61P 43/00",
"A61P 19/04",
"A61K 38/17",
"A61P 25/28",
"A61P 7/00",
"A61P 1/16",
"A61P 1/04",
"A61P 27/02",
"A61K 38/00",
"A61P 37/02",
"C07K 14/705",
"A61P 17/00",
"A61P 35/02",
"C07K 14/725",
"C12P 21/02",
"A61P 37/06",
"A61K 45/06",
"A61P 17/02",
"A61P 37/04",
"A61P 35/00",
"A61P 7/06",
"A61P 7/04",
"A61P 3/10",
"A61P 29/00"
] | 28,556 |
17,324,750 | 1998-12-15 | 22,080,230 | Y | Use of a compound of formula 1 in the preparation of a medicament for treating a pshcyhiatic condition or disorder selected from dementia, dementia of the Alzheimer's type, anxiety disorders, psychotic episodes of anxiety, anxiety associated with psychosis, mood disorders associated with psychotic disorder, psychotic mood disorders, mood disorders associated with schizophrenia, dyskinesias and behavioral manifestations of mental retardation, conduct disorder and autistic disorder. <CHEM> or a pharmaceutically acceptable acid addition salt thereof, wherein Ar is benzoisothiazolyl or an oxide or dioxide thereof each optionally substituted by one fluoro, chloro, trifluoromethyl, methoxy, cyano, nitro or napthyl optionally substituted by fluoro, chloro, trifluoromethyl, methoxy, cyano or nitro; quinolyl; 6-hydroxy-8-quinolyl; isoquinolyl; quinazolyl; benzothiazolyl; benzothiadiazolyl; benzoxazolyl; benzotriazolyl; benzoxazolyl; benzoxazolonyl; indolyl; indanyl optionally substituted by one or two fluoro, 3-indazolyl optionally substituted by 1-trifluoromethylphenyl; or phthalazinyl; n is 1 or 2; and X and Y together with the phenyl to which they are attached form quinolyl; 2-hydroxyquinolyl; benzothiazolyl; 2-aminobenzothiazolyl; benzoisothiazolyl; indazolyl; 2-hydroxyindazolyl, indolyl; spiro; oxindolyl optionally substituted by one to three of (C1-C3)alkyl, or one of chloro, fluoro or phenyl, said phenyl optionally substituted by one chloro or fluoro; benzoxazolyl; 2-aminobenzoxazolyl; benzoxazolonyl; 2-aminobenzoxazolinyl; benzothiazolonyl; benzoimidazolonyl; or benzotriazolyl. | en | Piperazinyl-heterocyclic compounds in the treatment of dementia | 42157_US | 3840957_US | A61K 31/496,A61K 31/502,A61K 31/517,A61P 25/00,A61P 25/18,A61P 25/22,A61P 25/24,A61P 25/28,A61P 43/00 | [
"A61K 31/495",
"A61P 43/00",
"C07D 231/12",
"A61P 25/28",
"A61P 25/00",
"A61P 25/22",
"A61P 25/24",
"A61P 25/18",
"A61K 31/00",
"A61K 31/517",
"A61K 31/496",
"A61K 31/502"
] | 20,027 |
564,195,390 | 2021-06-21 | 76,584,358 | N | Systems and methods for deploying emergency roadside signaling devices are disclosed. In one aspect, system for an autonomous vehicle includes one or more signaling devices configured to visually notify other vehicles when placed on or near a roadway, and an object placing device configured to place the one or more signaling devices. The system further includes a processor and a computer-readable memory in communication with the processor and having stored thereon computer-executable instructions to cause the processor to: determine that the autonomous vehicle has experienced a malfunction, and provide instructions to the object placing device to place the one or more signaling devices on or near the roadway. 101 ( Network Resources 101 WDAREA DATA NETWORKS (e.g., Intemnet, Celliular Telephone Networks, Satellite Networks, WiFi Networks, P2P Networks, VoIP Networks, etc.) 130 /- 132 USER MOBILE IN-VEHICLE DEVICES WEB-ENABLED (eg, Phone, MP3 DEVICES Player, Tablet, CD Player, etc.) VEHICLE VEHICLE VEHICLE OCCUPANT DRIVE SENSOR CONTROL INTERFACE SUBSYSTEMS SUBSYSTEMS SUBSYSTEMS SUBSYSTEMS ENGINE/ INERTIAL STEERING DISPLAYS MOTOR SENSORS 105 WHEELS GLOBALL TIRES POSITIONING THOTL SAR TRANS- MICRO MISSION RAA RKS PHONES ELECTRICAL LIDAR NAVIGATION NAVIGATION AUTON- ENVIRON POWER CAMERAS OMOUS MENTAL CONTROL- MNA 150 142-J 144 - 146-J p4=8 141 - - - - - - - IN-VFH ICL CONTROL SYSTEM 200 VEHICLE USERMOBILE 133 131 SUBSYSTEMI/F DEVICE I/F IMAGE WEB-ENABLED1 PROCESSING POEAG 170 I MODULE 165 POESN 171 DEVICE I/F INTERFACES MODULE DATA Processin PROCESSOR instructions 172 Data Storage | en | Systems and methods for deploying emergency roadside signaling devices | 77256795_US | 13322724_,16042595_,78833464_,84029660_,79889064_,80525309_,56297821_,13411702_,79787260_ | B60Q 1/52,B60Q 7/00,B60W 60/0015,B60W2556/60,E01F 9/619,E01F 9/629,E01F 9/654,E01F 9/70,G05D 1/0274,G05D 1/0278,G05D2201/0213,G07C 5/0816,G09F 13/16 | [
"G05D 1/02",
"G08G 1/123",
"B60Q 7/02",
"G08G 1/09"
] | 162,175 |
482,730,405 | 2017-08-22 | 56,801,451 | N | T The invention provides for a magnetic resonance imaging system (200, 300, 400) comprising a radio-frequency system (216, 214) comprising multiple coil elements (214) for acquiring magnetic resonance data (264). The magnetic resonance imaging system further comprises a memory (250) for storing machine executable instructions (260) and pulse sequence commands (262). The pulse sequence commands are configured for controlling the magnetic resonance imaging system to acquire the magnetic resonance data according to a SENSE imaging protocol. The magnetic resonance imaging system further comprises a processor (244) for controlling the magnetic resonance imaging system. Execution of the machine executable instructions causes the processor to: control (500) the magnetic resonance imaging system to acquire the magnetic resonance data using the pulse sequence commands; reconstruct (502) a set of folded magnetic resonance images (266) from the magnetic resonance data; calculate (504) a voxel deformation map (270) from a static magnetic field (B0) inhomogeneity map; calculate (506) a set of unfolding matrices (274) using a least partially a coil sensitivity matrix (272) for the multiple coil elements, wherein the set of unfolding matrices comprises at least one modified unfolding matrix, wherein the at least one modified unfolding matrix is calculated at least partially using the a coil sensitivity matrix and the voxel deformation map; and calculate (508) undistorted magnetic resonance image data (276) using the set of folded magnetic resonance images and the set of unfolding matrices. | en | BO-CORRECTED SENSITIVITY ENCODING MAGNETIC RESONANCE IMAGING | 18087805_NL | 12545674_NL,25664737_NL,57350108_NL | G01R 33/5611,G01R 33/5612,G01R 33/56536,G01R 33/56554,G01R 33/56563 | [
"G01R 33/561",
"G01R 33/565"
] | 111,055 |
52,011,261 | 2006-10-23 | 37,867,801 | N | A color registration apparatus and method capable of performing color registration without errors regardless of concentration of a developing agent is provided. The color registration apparatus determines a light emitting intensity irradiating onto a registration mark and a minimum light receiving intensity with which the registration mark is identified according to the concentration of the developing agent. The color registration apparatus includes a mark forming unit forming a concentration mark for each color and forming a registration mark for each color in response to a color registration control signal, a mark sensing unit sensing the concentration mark by emitting a plurality of first emitted lights comprising different intensities and sensing the registration mark by emitting second emitted lights, an examining unit comparing the intensities of first sensed lights with a predetermined reference value and generating the color registration control signal in response to the comparison results, a calculating unit that calculates the intensity of the second emitted light using the intensities of the plurality of first emitted lights and the intensities of the plurality of first sensed lights in condition that the intensities of second sensed light are greater than a predetermined value and a color registration unit performing color registration using the intensity of the second sensed light than a predetermined threshold value, wherein the first sensed light is a light reflected from the concentration mark, and the second sensed light reflected from the registration mark. | en | Color registration apparatus and method | 5213908_ | 7507894_KR | G03G 15/01,G03G 15/0131,G03G 15/5058,G03G2215/00059,G03G2215/0161 | [
"B41J 29/393"
] | 43,256 |
54,267,607 | 2001-08-31 | 26,925,046 | Y | A method for psychometric assessment testing of both cognitive and motor ability to assimilate and follow instructions. The assessment method tasks a subject to assemble a subset of inter-fitting parts from a collection of parts in a specific manner as defined by an instruction set presented to the subject, and with the help of specific reference cues. A number of inter-fitting parts are placed before a subject, each bearing various labels for guiding assembly. Some of the parts are functionally similar except in dimension. Next, the subject is given a menu of the parts bearing not-to-scale illustrations of all the parts (labels omitted), and names for the respective parts. Next, the subject is given a ruler, and then a set of assembly instructions including a set of written directions for assembling a subset of the parts in a pre-selected manner by reference to part name, dimensions, and labeled indicia. The subject is instructed to begin, and an administrator times assembly. After completion, the administrator assesses the subject's aptitude by awarding points for properly assembling the subset of parts in the instructed manner, for steps taken by the subject during assembly, and for time to completion, the assessment thereby providing a measure of both cognitive ability and dexterity. The minimalistic content and sparse manner of delivering the instructions exercises the subject's ability to assimilate instructions on their own, as well as assimilating the apparent reference cues that he or she might need, thereby allowing full assessment of autonomy and self-orientation. | en | Psychometric assessment testing method | 10590769_US | 10590770_US | A61B 5/16,G09B 23/28 | [
"A61B 5/16",
"G09B 23/28"
] | 48,606 |
15,710,212 | 2000-03-10 | 27,464,502 | N | A liquid crystal composition comprising anti-ferroelectric liquid crystal compound (1) selected from liquid crystal compounds of the formula (1) and a ferrielectric liquid crystal compound (2) or a racemic compound (2') thereof, wherein (a) the compositional ratio of the anti-ferroelectric liquid crystal compound (1) and the ferrielectric liquid crystal compound (2) or the racemic compound (2') thereof is in the range of from a value which is on the anti-ferroelectric phase side and is apart from a boundary compositional ratio by 5 mol% to a value which is on the ferrielectric phase side and is apart from the boundary compositional ratio by 25 mol%, wherein the boundary compositional ratio is obtained on the basis of a liquid crystal phase diagram prepared on the basis of conoscopic image observations obtained by changing the mixing ratio of the anti-ferroelectric liquid crystal compound (1) and the ferrielectric liquid crystal compound (2) or the racemic compound (2') thereof, (b) in an optical response to an applied voltage, the liquid crystal composition exhibits an optical response which is symmetrical in a positive voltage region and a negative voltage region and which is free of hysteresis or involves a small hysteresis, and (c) the liquid crystal composition has excellent alignment stability., <CHEM> The novel liquid crystal composition of the present invention is almost free from sticking, is excellent in alignment and alignment stability and exhibits a V-letter-shaped optical response so that it can give a highly reliable active matrix liquid crystal display device. | en | Liquid crystal composition | 94299_JP | 783564_JP,783565_JP,783563_JP,783566_JP | C09K 19/0266,C09K 19/2007,C09K 19/2021,C09K2019/2042,C09K2323/00,G02F 1/141 | [
"C09K 19/20",
"C09K 19/02"
] | 12,483 |
510,647,826 | 2018-09-06 | 65,949,595 | Y | The present invention relates to a user-independent brain-computer interface (BCI) providing system and a method thereof. The method is executed by a BCI system for providing a user-independent BCI. The method includes the steps of: (a) obtaining brain signals through one or more paradigms from multiple users and using the obtained brain signals to extract the characteristic pattern information of brain signals of each user and storing reference characteristic information including the same in a BCI database; (b) obtaining idle period brain signals of a new user during a preset resting time when the approach of the new user is sensed and extracting the characteristic pattern information from the idle period brain signals to compute target characteristic information; (c) comparing the reference characteristic information stored in the BCI interface with the target characteristic information in order to select the characteristic pattern information of the brain signals having a characteristic pattern most similar to the characteristic pattern information of the target characteristic information in the reference characteristic information; and (d) applying pre-transition learning information formed in advance to correspond to the characteristic pattern information of the selected brain signals to the new user. The pre-transition learning information includes the brain wave characteristic information including the average, covariance, and deviation of brain waves as well as spectral power for each frequency band and classifier information for classifying the brain wave pattern. | en | - SYSTEM FOR PROVIDING SUBJECT-INDEPENDENT BRAIN-COMPUTER INTERFACE AND METHOD THEREOF | 64807294_KR | 60757465_,70322280_,59317410_ | A61B 5/291,A61B 5/316,A61B 5/374,G06F 3/015,G06F2203/011 | [
"G06F 3/01",
"A61B 5/374"
] | 126,652 |
541,248,839 | 2019-03-28 | 62,017,283 | N | The invention relates to a method for characterizing a visual system of a subject by using measures of the sensitivity to contrast. The visual system comprises visual signal processing elements each having an impact on the sensitivity to contrast, wherein a visual test where visual patterns having different spatiotemporal frequencies and with varying luminance levels and with varying levels of visual degradation of the visual patterns are shown to a subject to measure the sensitivity to contrast of said subject, is performed, wherein a predetermined response model of a visual system is preestablished on the basis of a determination of the visual signal processing element that predominantly limits the sensitivity to contrast for each value of luminance and spatiotemporal frequency, said predetermined response model relating the visual signal processing elements predominantly limiting the sensitivity to contrast to the luminances and to the spatiotemporal frequencies, wherein at least one of the visual signal processing elements is selected in order to be investigated, wherein at least one visual test is performed on the visual system of the subject, the visual test being optimized according to said at least one selected visual signal processing element, during the optimized visual test, the variations of the luminance levels and of spatiotemporal frequencies being limited withina range of luminance and a range of spatiotemporal frequency where the predetermined response model locates the visual signal processing element as predominant in limiting the sensitivity to contrast. | en | Methods and systems for characterizing object vision system | 75648900_,58469333_ | 78277107_,77934201_ | A61B 3/0025,A61B 3/0041,A61B 3/022,A61B 3/032,A61B 3/066,A61B 5/4005,A61B 5/4076,G16H 30/40,G16H 50/30 | [
"A61B 3/00",
"A61B 3/032",
"A61B 3/02",
"A61B 5/00"
] | 146,871 |
47,025,754 | 1985-06-07 | 24,486,298 | N | An inertial sensor assembly (ISA) (12) includes a cluster of three ring laser gyros (20), each gyro (42, 44, 46) producing an output signal having a pulse repetition rate representative of the rate of angular deviation of the ISA about one of three coordinate axes X, Y, and Z. The ring laser gyros (42, 44, 46) are asynchronously dithered at a relatively constant rate. The ISA (12) also includes a triad of three accelerometers (30), with each accelerometer (72, 74, 76) producing an output signal representative of the rate of velocity deviation of the ISA (12) along one of the X, Y, and Z coordinate axes. A first processor, P1 (14), accumulates the pulses produced by each ring laser gyro (42, 44, 46) over its dither period. The resultant counts are stored in registers (202, 204, 206) for subsequent sampling by the P1 processor (14) at a periodic sampling rate which is greater than the dither rate. The P1 processor (14) then synchronizes each sampled pulse count to a common sampling interval, thereby eliminating errors otherwise caused by using positional data values taken at different times. The P1 processor (14) also compensates the ring laser gyro and accelerometer-produced signals at the sensor and the system level for effects such as temperature, bias offsets, scale factor and misalignment by the use of compensating coefficients stored in electrically erasable, programmable read-only memory (260, 262). The processed data from the P1 processor (14) are passed to a P2 processor (16) which performs navigational computations to thereby produce computed positional information. | en | INERTIAL REFERENCE SYSTEM | 14103586_US | 25668127_US,25668126_US,37510948_US | G01C 21/16 | [
"G01C 19/64",
"G01C 21/16"
] | 33,063 |
404,695 | 1997-12-12 | 27,488,284 | Y | A synthetic nuclease resistant antisense oligodeoxynucleotide (AS-ODN) capable of selectively modulating human acetylcholinesterase (AChE) production and a pharmaceutical or medical composition comprising at least one AD-ODN as an active ingredient. In an embodiment the AS-ODN can be selected from 5'ACGCTTTCTTGAGGC 3' (SEQ ID NO.1), 5'GGCACCCTGGGCAGC 3' (SEQ ID NO.2); 5'CCACGTCCTCCTGCACCGTC 3' (SEQ ID NO.6); 5'ATGAACTCGATCTCGTAGCC 3' (SEQ ID NO.7); 5'GCCAGAGGAGGAGGAGAAGG 3' (SEQ ID NO.4); 5'TAGCGTCTACCACCCCTGAC 3' (SEQ ID NO.5), 5'TCTGTGTTATAGCCCAGCCC 3' (SEQ ID NO.17); and 5'GGCCTGTAACAGTTTATTT 3' (SEQ ID NO.18). A nuclease resistant antisense targeted against the splice junction in the AChEmRNA post splice message is disclosed. In an embodiment, a nuclease resistant AS-ODN targeted against the E4-E6 junction in the E1-E4-E6 splice variant AChEmRNA is disclosed as being highly specific for the muscle and central nervous system splice variant of AChE. The synthetic nuclease resistant AS-ODNs are capable of selectively modulating human AChE production in the central nervous system or capable of selectively reducing human AChE deposition in the neuromuscular junction. The present invention also provides a method to restore balanced cholinergic signaling in the brain and spinal cord or reduce AChE in the neuromuscular junction in patients in need of such treatment comprising administering to a patient in need of such treatment a therapeutically effective amount of at least one of the synthetic nuclease resistant AS-ODN capable of selectively modulating human AChE production. | en | SYNTHETIC ANTISENSE OLIGODEOXYNUCLEOTIDES AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM | 375123_IL | 710172_IL,710170_IL,710173_IL,710171_DE,47969798_IL | A01K2217/05,A61K 38/00,A61P 25/00,A61P 43/00,C12N 15/1137,C12N2310/315,C12N2310/321,C12N2310/322,C12N2310/53,C12Y 301/01007 | [
"A61P 25/00",
"C12N 15/09",
"C12N 15/00",
"A61K 31/7088",
"C12N",
"A61K 38/00",
"C12N 9/00",
"A61P 43/00",
"C12Q 1/68",
"A61K 48/00",
"C12N 15/113"
] | 2,310 |